diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000..047fe47
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,3 @@
+.bam filter=lfs diff=lfs merge=lfs -text
+samples/sample_lg_tr.bam filter=lfs diff=lfs merge=lfs -text
+sample_lg_tr.bam filter=lfs diff=lfs merge=lfs -text
diff --git a/.gitignore b/.gitignore
index d117ab7..d45c1f2 100644
--- a/.gitignore
+++ b/.gitignore
@@ -1,6 +1,7 @@
 blib/
 .build/
 _build/
+build/
 cover_db/
 inc/
 Build
diff --git a/.travis.yml b/.travis.yml
index bd34c3d..27ef334 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -1,16 +1,7 @@
-language: perl
-addons:
-  apt:
-    packages:
-    - zlib1g-dev
-perl:
-  - "5.14"
-sudo: false
+sudo: required
+services:
+  - docker
 install:
-  - "source ./install_dependencies.sh"
-before_script:
-  - cpanm --quiet --notest Dist::Zilla::App::Command::cover
-  - cpanm --quiet --notest --skip-satisfied Devel::Cover::Report::Codecov
-script: "dzil test"
-after_success:
-  - dzil cover -test -report codecov
\ No newline at end of file
+  - docker pull sangerpathogens/bio-tradis
+script:
+  - docker run --rm -it sangerpathogens/bio-tradis /bin/bash -c "git clone https://github.com/sanger-pathogens/Bio-Tradis.git && cd Bio-Tradis && dzil test"
diff --git a/CHANGELOG.md b/CHANGELOG.md
new file mode 100644
index 0000000..73b9c7b
--- /dev/null
+++ b/CHANGELOG.md
@@ -0,0 +1,198 @@
+# Change Log
+
+## [Unreleased](https://github.com/sanger-pathogens/Bio-Tradis/tree/HEAD)
+
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.4.1...HEAD)
+
+**Merged pull requests:**
+
+- Include tests in README [\#97](https://github.com/sanger-pathogens/Bio-Tradis/pull/97) ([ssjunnebo](https://github.com/ssjunnebo))
+
+## [v1.4.1](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.4.1) (2018-09-20)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/1.4.1...v1.4.1)
+
+**Merged pull requests:**
+
+- update version for cpan [\#96](https://github.com/sanger-pathogens/Bio-Tradis/pull/96) ([ssjunnebo](https://github.com/ssjunnebo))
+- Add to codecov [\#95](https://github.com/sanger-pathogens/Bio-Tradis/pull/95) ([ssjunnebo](https://github.com/ssjunnebo))
+
+## [1.4.1](https://github.com/sanger-pathogens/Bio-Tradis/tree/1.4.1) (2018-07-19)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/1.4.0...1.4.1)
+
+**Closed issues:**
+
+- Installation on Ubuntu 17.10 fails [\#84](https://github.com/sanger-pathogens/Bio-Tradis/issues/84)
+- Port 18 volume discrepancy? [\#83](https://github.com/sanger-pathogens/Bio-Tradis/issues/83)
+
+**Merged pull requests:**
+
+- Change TryCatch to Try::Tiny [\#94](https://github.com/sanger-pathogens/Bio-Tradis/pull/94) ([ssjunnebo](https://github.com/ssjunnebo))
+- fix typo in badge [\#93](https://github.com/sanger-pathogens/Bio-Tradis/pull/93) ([ssjunnebo](https://github.com/ssjunnebo))
+- Include TOC [\#92](https://github.com/sanger-pathogens/Bio-Tradis/pull/92) ([ssjunnebo](https://github.com/ssjunnebo))
+- 621538 docker [\#91](https://github.com/sanger-pathogens/Bio-Tradis/pull/91) ([ssjunnebo](https://github.com/ssjunnebo))
+- 621538 docker [\#90](https://github.com/sanger-pathogens/Bio-Tradis/pull/90) ([ssjunnebo](https://github.com/ssjunnebo))
+- include reference genome for cram [\#89](https://github.com/sanger-pathogens/Bio-Tradis/pull/89) ([ssjunnebo](https://github.com/ssjunnebo))
+- Revert "Replace cram file without reads" [\#88](https://github.com/sanger-pathogens/Bio-Tradis/pull/88) ([ssjunnebo](https://github.com/ssjunnebo))
+- Replace cram file without reads [\#87](https://github.com/sanger-pathogens/Bio-Tradis/pull/87) ([ssjunnebo](https://github.com/ssjunnebo))
+- update tutorial for ENA switch to https \(from http\) [\#85](https://github.com/sanger-pathogens/Bio-Tradis/pull/85) ([lbarquist](https://github.com/lbarquist))
+
+## [1.4.0](https://github.com/sanger-pathogens/Bio-Tradis/tree/1.4.0) (2017-11-28)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.3.3...1.4.0)
+
+**Closed issues:**
+
+- Duplicate genes [\#81](https://github.com/sanger-pathogens/Bio-Tradis/issues/81)
+- Installing Bio-Tradis Fail  [\#80](https://github.com/sanger-pathogens/Bio-Tradis/issues/80)
+
+**Merged pull requests:**
+
+- include last base of annotation in insertion count [\#82](https://github.com/sanger-pathogens/Bio-Tradis/pull/82) ([lbarquist](https://github.com/lbarquist))
+- Rename license file' [\#79](https://github.com/sanger-pathogens/Bio-Tradis/pull/79) ([ssjunnebo](https://github.com/ssjunnebo))
+- update AUTHORS and rename LICENSE [\#78](https://github.com/sanger-pathogens/Bio-Tradis/pull/78) ([ssjunnebo](https://github.com/ssjunnebo))
+- Tmp file time stamp [\#77](https://github.com/sanger-pathogens/Bio-Tradis/pull/77) ([ssjunnebo](https://github.com/ssjunnebo))
+
+## [v1.3.3](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.3.3) (2017-05-08)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.3.2...v1.3.3)
+
+**Merged pull requests:**
+
+- try localtime for tmp file timestamp [\#76](https://github.com/sanger-pathogens/Bio-Tradis/pull/76) ([ssjunnebo](https://github.com/ssjunnebo))
+
+## [v1.3.2](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.3.2) (2017-05-08)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.3.1...v1.3.2)
+
+**Closed issues:**
+
+- cpan update? [\#75](https://github.com/sanger-pathogens/Bio-Tradis/issues/75)
+- tradis\_comparison.R error [\#71](https://github.com/sanger-pathogens/Bio-Tradis/issues/71)
+
+**Merged pull requests:**
+
+- modified ranges to accommodate higher density insertion data [\#74](https://github.com/sanger-pathogens/Bio-Tradis/pull/74) ([lbarquist](https://github.com/lbarquist))
+- removed File::Slurp [\#73](https://github.com/sanger-pathogens/Bio-Tradis/pull/73) ([vaofford](https://github.com/vaofford))
+- dont add POD to R scripts [\#72](https://github.com/sanger-pathogens/Bio-Tradis/pull/72) ([andrewjpage](https://github.com/andrewjpage))
+
+## [v1.3.1](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.3.1) (2016-09-23)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.3.0...v1.3.1)
+
+**Closed issues:**
+
+- Mapping score always set to 1 if -m option used with plot\_tradis [\#66](https://github.com/sanger-pathogens/Bio-Tradis/issues/66)
+- Error in step 3.5 of bacteria\_tradis, using samtools 1.3 [\#63](https://github.com/sanger-pathogens/Bio-Tradis/issues/63)
+
+**Merged pull requests:**
+
+- change to dist zilla starter bundle [\#70](https://github.com/sanger-pathogens/Bio-Tradis/pull/70) ([nds](https://github.com/nds))
+- switch PCR primers [\#69](https://github.com/sanger-pathogens/Bio-Tradis/pull/69) ([andrewjpage](https://github.com/andrewjpage))
+- updated readme [\#68](https://github.com/sanger-pathogens/Bio-Tradis/pull/68) ([lbarquist](https://github.com/lbarquist))
+- Fix for bug \#66, change mapping\_score option spec in B::T::CL::PlotTradis [\#67](https://github.com/sanger-pathogens/Bio-Tradis/pull/67) ([RoyChaudhuri](https://github.com/RoyChaudhuri))
+
+## [v1.3.0](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.3.0) (2016-04-13)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.2.4...v1.3.0)
+
+**Merged pull requests:**
+
+- Merge Roys changes [\#65](https://github.com/sanger-pathogens/Bio-Tradis/pull/65) ([andrewjpage](https://github.com/andrewjpage))
+- added recipes \(again\) [\#62](https://github.com/sanger-pathogens/Bio-Tradis/pull/62) ([lbarquist](https://github.com/lbarquist))
+
+## [v1.2.4](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.2.4) (2015-12-11)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.2.3...v1.2.4)
+
+**Closed issues:**
+
+- tradis\_essentiality.R [\#28](https://github.com/sanger-pathogens/Bio-Tradis/issues/28)
+
+**Merged pull requests:**
+
+- fixes for revision [\#61](https://github.com/sanger-pathogens/Bio-Tradis/pull/61) ([lbarquist](https://github.com/lbarquist))
+- bugfix to tradis\_essentiality.R [\#60](https://github.com/sanger-pathogens/Bio-Tradis/pull/60) ([lbarquist](https://github.com/lbarquist))
+
+## [v1.2.3](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.2.3) (2015-11-03)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.2.2...v1.2.3)
+
+**Merged pull requests:**
+
+- Bump the version number [\#59](https://github.com/sanger-pathogens/Bio-Tradis/pull/59) ([bewt85](https://github.com/bewt85))
+- Ticket 463867: What if a tag isn't found? [\#58](https://github.com/sanger-pathogens/Bio-Tradis/pull/58) ([bewt85](https://github.com/bewt85))
+- updated bacteria\_tradis help messages [\#57](https://github.com/sanger-pathogens/Bio-Tradis/pull/57) ([lbarquist](https://github.com/lbarquist))
+- Add package version module to dist zilla [\#56](https://github.com/sanger-pathogens/Bio-Tradis/pull/56) ([andrewjpage](https://github.com/andrewjpage))
+
+## [v1.2.2](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.2.2) (2015-09-14)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.2.1...v1.2.2)
+
+**Merged pull requests:**
+
+- Added sequencing recipes [\#55](https://github.com/sanger-pathogens/Bio-Tradis/pull/55) ([lbarquist](https://github.com/lbarquist))
+- updated help messages for R scripts [\#54](https://github.com/sanger-pathogens/Bio-Tradis/pull/54) ([lbarquist](https://github.com/lbarquist))
+- POD formatting [\#53](https://github.com/sanger-pathogens/Bio-Tradis/pull/53) ([andrewjpage](https://github.com/andrewjpage))
+
+## [v1.2.1](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.2.1) (2015-09-10)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.2...v1.2.1)
+
+**Merged pull requests:**
+
+- Simplify installation [\#52](https://github.com/sanger-pathogens/Bio-Tradis/pull/52) ([andrewjpage](https://github.com/andrewjpage))
+
+## [v1.2](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.2) (2015-09-08)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.132190...v1.2)
+
+**Merged pull requests:**
+
+- Ticket 473325: Install two different versions of SAMTOOLS [\#51](https://github.com/sanger-pathogens/Bio-Tradis/pull/51) ([bewt85](https://github.com/bewt85))
+- Add TravisCI support [\#50](https://github.com/sanger-pathogens/Bio-Tradis/pull/50) ([bewt85](https://github.com/bewt85))
+- fixed filtering bug [\#49](https://github.com/sanger-pathogens/Bio-Tradis/pull/49) ([lbarquist](https://github.com/lbarquist))
+- Updated shebang line in R scripts for portability [\#48](https://github.com/sanger-pathogens/Bio-Tradis/pull/48) ([carlacummins](https://github.com/carlacummins))
+- added installation notes [\#47](https://github.com/sanger-pathogens/Bio-Tradis/pull/47) ([lbarquist](https://github.com/lbarquist))
+- only require 2 command line args, not 3 [\#46](https://github.com/sanger-pathogens/Bio-Tradis/pull/46) ([lbarquist](https://github.com/lbarquist))
+- Bug fixes and added features [\#45](https://github.com/sanger-pathogens/Bio-Tradis/pull/45) ([carlacummins](https://github.com/carlacummins))
+- Adding tabix a prerequisite [\#44](https://github.com/sanger-pathogens/Bio-Tradis/pull/44) ([js21](https://github.com/js21))
+- Cram file output [\#43](https://github.com/sanger-pathogens/Bio-Tradis/pull/43) ([andrewjpage](https://github.com/andrewjpage))
+- Code is now cross-platform [\#42](https://github.com/sanger-pathogens/Bio-Tradis/pull/42) ([js21](https://github.com/js21))
+- Pass through samtools exec and verbose mode [\#41](https://github.com/sanger-pathogens/Bio-Tradis/pull/41) ([andrewjpage](https://github.com/andrewjpage))
+- Cram support [\#40](https://github.com/sanger-pathogens/Bio-Tradis/pull/40) ([andrewjpage](https://github.com/andrewjpage))
+- added the missing test files [\#39](https://github.com/sanger-pathogens/Bio-Tradis/pull/39) ([js21](https://github.com/js21))
+- suppressed uninitialised warnings when importing PE data [\#38](https://github.com/sanger-pathogens/Bio-Tradis/pull/38) ([carlacummins](https://github.com/carlacummins))
+- Tabix indexed plot files in place [\#37](https://github.com/sanger-pathogens/Bio-Tradis/pull/37) ([js21](https://github.com/js21))
+- added filtering option, so default is old behavior. -f now enables read ... [\#36](https://github.com/sanger-pathogens/Bio-Tradis/pull/36) ([lbarquist](https://github.com/lbarquist))
+- fixed typo [\#35](https://github.com/sanger-pathogens/Bio-Tradis/pull/35) ([lbarquist](https://github.com/lbarquist))
+- feature addition to tradis\_comparison, bugfix tradis\_essentiality [\#34](https://github.com/sanger-pathogens/Bio-Tradis/pull/34) ([lbarquist](https://github.com/lbarquist))
+- Added AUTHORS file [\#33](https://github.com/sanger-pathogens/Bio-Tradis/pull/33) ([aslett1](https://github.com/aslett1))
+- Fixed problem with opening combined plots in Artemis [\#32](https://github.com/sanger-pathogens/Bio-Tradis/pull/32) ([carlacummins](https://github.com/carlacummins))
+- Fixed problem with unusual characters in filenames [\#31](https://github.com/sanger-pathogens/Bio-Tradis/pull/31) ([carlacummins](https://github.com/carlacummins))
+- Updates [\#30](https://github.com/sanger-pathogens/Bio-Tradis/pull/30) ([carlacummins](https://github.com/carlacummins))
+- index needs to be offset by 2 [\#29](https://github.com/sanger-pathogens/Bio-Tradis/pull/29) ([raeece](https://github.com/raeece))
+- Fixed issue with exposed -y smalt param [\#27](https://github.com/sanger-pathogens/Bio-Tradis/pull/27) ([carlacummins](https://github.com/carlacummins))
+- Exposed -y smalt parameter [\#26](https://github.com/sanger-pathogens/Bio-Tradis/pull/26) ([carlacummins](https://github.com/carlacummins))
+- Added GPL-LICENCE [\#25](https://github.com/sanger-pathogens/Bio-Tradis/pull/25) ([carlacummins](https://github.com/carlacummins))
+- Fixed problems with merging plots [\#24](https://github.com/sanger-pathogens/Bio-Tradis/pull/24) ([carlacummins](https://github.com/carlacummins))
+- Updates to help text [\#23](https://github.com/sanger-pathogens/Bio-Tradis/pull/23) ([carlacummins](https://github.com/carlacummins))
+- Added R scripts [\#22](https://github.com/sanger-pathogens/Bio-Tradis/pull/22) ([carlacummins](https://github.com/carlacummins))
+- Removed leftover debugging statement [\#21](https://github.com/sanger-pathogens/Bio-Tradis/pull/21) ([carlacummins](https://github.com/carlacummins))
+- Exposed SMALT indexing parameters [\#20](https://github.com/sanger-pathogens/Bio-Tradis/pull/20) ([carlacummins](https://github.com/carlacummins))
+- Bug fix [\#19](https://github.com/sanger-pathogens/Bio-Tradis/pull/19) ([carlacummins](https://github.com/carlacummins))
+- Fix for combined plots not reading in Artemis [\#18](https://github.com/sanger-pathogens/Bio-Tradis/pull/18) ([carlacummins](https://github.com/carlacummins))
+- gzip no prompt for overwrite [\#17](https://github.com/sanger-pathogens/Bio-Tradis/pull/17) ([carlacummins](https://github.com/carlacummins))
+- Fixed problem with blank lines [\#16](https://github.com/sanger-pathogens/Bio-Tradis/pull/16) ([carlacummins](https://github.com/carlacummins))
+- Fixed combine\_tradis\_plots [\#15](https://github.com/sanger-pathogens/Bio-Tradis/pull/15) ([carlacummins](https://github.com/carlacummins))
+- Plot update [\#14](https://github.com/sanger-pathogens/Bio-Tradis/pull/14) ([carlacummins](https://github.com/carlacummins))
+- Updated help text for combine\_tradis\_plots [\#13](https://github.com/sanger-pathogens/Bio-Tradis/pull/13) ([carlacummins](https://github.com/carlacummins))
+- Added module to combine plot files [\#12](https://github.com/sanger-pathogens/Bio-Tradis/pull/12) ([carlacummins](https://github.com/carlacummins))
+- Further file checking updates [\#11](https://github.com/sanger-pathogens/Bio-Tradis/pull/11) ([carlacummins](https://github.com/carlacummins))
+- Bug fix in file existance check [\#10](https://github.com/sanger-pathogens/Bio-Tradis/pull/10) ([carlacummins](https://github.com/carlacummins))
+- Updates [\#9](https://github.com/sanger-pathogens/Bio-Tradis/pull/9) ([carlacummins](https://github.com/carlacummins))
+- Updated bacteria\_tradis help [\#8](https://github.com/sanger-pathogens/Bio-Tradis/pull/8) ([carlacummins](https://github.com/carlacummins))
+- Distribution ready [\#7](https://github.com/sanger-pathogens/Bio-Tradis/pull/7) ([carlacummins](https://github.com/carlacummins))
+
+## [v1.132190](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.132190) (2013-08-07)
+[Full Changelog](https://github.com/sanger-pathogens/Bio-Tradis/compare/v1.132140...v1.132190)
+
+## [v1.132140](https://github.com/sanger-pathogens/Bio-Tradis/tree/v1.132140) (2013-08-02)
+**Merged pull requests:**
+
+- Complete package v1 [\#6](https://github.com/sanger-pathogens/Bio-Tradis/pull/6) ([carlacummins](https://github.com/carlacummins))
+- fix cigar string [\#5](https://github.com/sanger-pathogens/Bio-Tradis/pull/5) ([andrewjpage](https://github.com/andrewjpage))
+- Reverse complement fix [\#4](https://github.com/sanger-pathogens/Bio-Tradis/pull/4) ([andrewjpage](https://github.com/andrewjpage))
+- die if the number of reads outputted differs [\#3](https://github.com/sanger-pathogens/Bio-Tradis/pull/3) ([andrewjpage](https://github.com/andrewjpage))
+- Executables in bin [\#2](https://github.com/sanger-pathogens/Bio-Tradis/pull/2) ([carlacummins](https://github.com/carlacummins))
+- Bio-Tradis [\#1](https://github.com/sanger-pathogens/Bio-Tradis/pull/1) ([carlacummins](https://github.com/carlacummins))
+
diff --git a/Dockerfile b/Dockerfile
index 51c7ca8..5af4ee7 100644
--- a/Dockerfile
+++ b/Dockerfile
@@ -1,14 +1,34 @@
 # This container will install Bio-Tradis from master
 #
-FROM debian:testing
+FROM debian:bullseye-slim
 
 # Install the dependancies
-RUN apt-get update -qq && apt-get install -y sudo make wget unzip zlib1g-dev cpanminus gcc bzip2 libncurses5-dev libncursesw5-dev libssl-dev r-base git
-RUN cpanm IPC::System::Simple DateTime::Locale DateTime
-RUN sudo Rscript -e "source('http://bioconductor.org/biocLite.R')" -e "biocLite(c('edgeR','getopt', 'MASS'))"
-RUN git clone https://github.com/sanger-pathogens/Bio-Tradis.git
-RUN cd Bio-Tradis && ./install_dependencies.sh
-ENV PATH /Bio-Tradis/bin:/Bio-Tradis/build/smalt-0.7.6-bin:/Bio-Tradis/build/tabix-master:/Bio-Tradis/build/samtools-1.3:$PATH
-RUN export PATH
+RUN apt-get update -qq && apt-get install -y sudo make wget unzip zlib1g-dev cpanminus gcc bzip2 libncurses5-dev libncursesw5-dev libssl-dev r-base git libxml-libxml-perl libgd-gd2-perl bioperl bwa smalt tabix samtools
+RUN wget https://github.com/lh3/minimap2/releases/download/v2.17/minimap2-2.17_x64-linux.tar.bz2
+RUN tar xjfv minimap2-2.17_x64-linux.tar.bz2
+
+# Install R dependencies
+RUN Rscript -e "install.packages('BiocManager')" -e "BiocManager::install()" -e "BiocManager::install(c('edgeR','getopt', 'MASS'))"
+
+# Install some perl dependencies (will probably install more later after adding source code).
+# It seems like we have to force installation of Xpath because the tests fail for some reason.  
+# This in turn means we need to force install BioPerl as well
+RUN cpanm IPC::System::Simple DateTime::Locale DateTime Dist::Zilla Moose Text::CSV ExtUtils::MakeMaker Getopt::Long Try::Tiny Exception::Class
+RUN cpanm Dist::Zilla::Plugin::AutoPrereqs Dist::Zilla::Plugin::Encoding Dist::Zilla::Plugin::FileFinder::ByName Dist::Zilla::Plugin::MetaResources Dist::Zilla::Plugin::PkgVersion Dist::Zilla::Plugin::PodWeaver Dist::Zilla::Plugin::RequiresExternal Dist::Zilla::Plugin::RunExtraTests Dist::Zilla::PluginBundle::Git Dist::Zilla::PluginBundle::Starter
+RUN cpanm --force XML::DOM::XPath
+RUN cpanm --force Bio::Seq Bio::SeqIO
+
+# Add source code
+ADD . Bio-Tradis
+
+# Install missing dependencies gathered from source code
+# This can take a while and slow down building the docker image if we install everything this way.  
+# Some known dependencies are installed earlier in the dockerfile (before adding source code) to speed up build time
+WORKDIR /Bio-Tradis
+RUN dzil authordeps --missing | cpanm 
+RUN dzil listdeps --missing | cpanm
+
+# Set environment
+ENV PATH /Bio-Tradis/bin:/minimap2-2.17_x64-linux:$PATH
 ENV PERL5LIB=/Bio-Tradis/lib:$PERL5LIB
-RUN export PERL5LIB
\ No newline at end of file
+WORKDIR /work
diff --git a/README.md b/README.md
index 265a5ee..167fd47 100644
--- a/README.md
+++ b/README.md
@@ -4,6 +4,8 @@ A set of tools to analyse the output from TraDIS analyses
 [![Build Status](https://travis-ci.org/sanger-pathogens/Bio-Tradis.svg?branch=master)](https://travis-ci.org/sanger-pathogens/Bio-Tradis)  
 [![License: GPL v3](https://img.shields.io/badge/License-GPL%20v3-brightgreen.svg)](https://github.com/sanger-pathogens/Bio-Tradis/blob/master/software_license)  
 [![status](https://img.shields.io/badge/Bioinformatics-10.1093-brightgreen.svg)](https://doi.org/10.1093/bioinformatics/btw022)  
+[![install with bioconda](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io/recipes/biotradis/README.html)   
+[![Container ready](https://img.shields.io/badge/container-ready-brightgreen.svg)](https://quay.io/repository/biocontainers/biotradis)  
 [![Docker Build Status](https://img.shields.io/docker/build/sangerpathogens/bio-tradis.svg)](https://hub.docker.com/r/sangerpathogens/bio-tradis)  
 [![Docker Pulls](https://img.shields.io/docker/pulls/sangerpathogens/bio-tradis.svg)](https://hub.docker.com/r/sangerpathogens/bio-tradis)  
 [![codecov](https://codecov.io/gh/sanger-pathogens/bio-tradis/branch/master/graph/badge.svg)](https://codecov.io/gh/sanger-pathogens/bio-tradis)
@@ -14,6 +16,7 @@ A set of tools to analyse the output from TraDIS analyses
     * [Required dependencies](#required-dependencies)
     * [Bioconda](#bioconda)
     * [Docker](#docker)
+    * [Running the tests](#running-the-tests)
   * [Usage](#usage)
     * [Scripts](#scripts)
     * [Analysis Scripts](#analysis-scripts)
@@ -32,6 +35,7 @@ For more information on the TraDIS method, see http://bioinformatics.oxfordjourn
 Bio-Tradis has the following dependencies:
 
 ### Required dependencies
+* bwa
 * smalt
 * samtools
 * tabix
@@ -44,17 +48,8 @@ There are a number of ways to install Bio-Tradis and details are provided below.
 Install conda and enable the bioconda channel.
 
 ```
-conda config --add channels r
-conda config --add channels defaults
-conda config --add channels conda-forge
-conda config --add channels bioconda
-conda install r smalt samtools perl-app-cpanminus
-
-sudo cpanm -f Bio::Tradis
-R 
-source("http://bioconductor.org/biocLite.R")
-biocLite()
-biocLite(c("edgeR","getopt", "MASS"))
+conda install-c bioconda biotradis=1.4.1.dev
+
 ```
 
 ### Docker
@@ -66,6 +61,11 @@ To use Bio-Tradis use a command like this (substituting in your directories), wh
 
     docker run --rm -it -v /home/ubuntu/data:/data sangerpathogens/bio-tradis bacteria_tradis -h
 
+### Running the tests
+The test can be run with dzil from the top level directory:  
+  
+`dzil test`  
+
 ## Usage
 
 For command-line usage instructions, please see the tutorial in the file "BioTraDISTutorial.pdf". Note that default parameters are for comparative experiments, and will need to be modified for gene essentiality studies.
@@ -88,7 +88,7 @@ Executable scripts to carry out most of the listed functions are available in th
 * `filter_tradis_tags` - Create a fastq file containing reads that match the supplied tag
 * `remove_tradis_tags` - Creates a fastq file containing reads with the supplied tag removed from the sequences
 * `tradis_plot` - Creates an gzipped insertion site plot
-* `bacteria_tradis` - Runs complete analysis, starting with a fastq file and produces mapped BAM files and plot files for each file in the given file list and a statistical summary of all files. Note that the -f option expects a text file containing a list of fastq files, one per line.
+* `bacteria_tradis` - Runs complete analysis, starting with a fastq file and produces mapped BAM files and plot files for each file in the given file list and a statistical summary of all files. Note that the -f option expects a text file containing a list of fastq files, one per line. This script can be run with or without supplying tags. 
 
 A help menu for each script can be accessed by running the script with no parameters.
 
@@ -155,15 +155,16 @@ __Bio::Tradis::Map__
 * Methods:
 	* `index_ref` - create index files of the reference genome. These are required
 				for the mapping step. Only skip this step if index files already
-				exist. -k and -s options for referencing are calculated based
+				exist. If SMALT is used as the aligner -sk and -ss options for referencing are calculated based
 				on the length of the reads being mapped:
-		* <70 : `-k 13 -s 4`
-		* >70 & <100 : `-k 13 -s 6`
-		* >100 : `-k 20 -s 13`
+		* <70 : `-sk 13 -ss 4`
+		* >70 & <100 : `-sk 13 -ss 6`
+		* >100 : `-sk 20 -ss 13`
 	* `do_mapping` - map `fastqfile` to `reference`. Options used for mapping are:
-				 `-r -1, -x and -y 0.96`
+				 `-k the min seed length for BWA`
+				 `-s (for using SMALT as alternative aligner) -r -1, -x and -y 0.96 for SMALT (see SMALT manual)`
 				
-	For more information on the mapping and indexing options discussed here, see the SMALT manual (ftp://ftp.sanger.ac.uk/pub4/resources/software/smalt/smalt-manual-0.7.4.pdf)
+	For more information on the mapping and indexing options discussed here, see the BWA manual (http://rothlab.ucdavis.edu/howto/attachments/bwa_manpage.pdf) and/or SMALT manual (ftp://ftp.sanger.ac.uk/pub4/resources/software/smalt/smalt-manual-0.7.4.pdf)
 				
 __Bio::Tradis::TradisPlot__  
 * Required parameters:
@@ -253,4 +254,4 @@ Please report any issues to the [issues page](https://github.com/sanger-pathogen
 If you use this software please cite:
 
 
-"The TraDIS toolkit: sequencing and analysis for dense transposon mutant libraries", Barquist L, Mayho M, Cummins C, Cain AK, Boinett CJ, Page AJ, Langridge G, Quail MA, Keane JA, Parkhill J. Bioinformatics. 2016 Apr 1;32(7):1109-11. doi: [10.1093/bioinformatics/btw022](https://doi.org/10.1093/bioinformatics/btw022). Epub 2016 Jan 21.
\ No newline at end of file
+"The TraDIS toolkit: sequencing and analysis for dense transposon mutant libraries", Barquist L, Mayho M, Cummins C, Cain AK, Boinett CJ, Page AJ, Langridge G, Quail MA, Keane JA, Parkhill J. Bioinformatics. 2016 Apr 1;32(7):1109-11. doi: [10.1093/bioinformatics/btw022](https://doi.org/10.1093/bioinformatics/btw022). Epub 2016 Jan 21.
diff --git a/bcinstall.log b/bcinstall.log
new file mode 100644
index 0000000..287ce7b
--- /dev/null
+++ b/bcinstall.log
@@ -0,0 +1,7 @@
+--> Working on Bio::Tradis
+Fetching http://www.cpan.org/authors/id/S/SS/SSJUNNEBO/Bio-Tradis-1.4.1.tar.gz ... OK
+Configuring Bio-Tradis-1.4.1 ... OK
+==> Found dependencies: Moose
+--> Working on Moose
+Fetching http://www.cpan.org/authors/id/E/ET/ETHER/Moose-2.2011.tar.gz ... OK
+Configuring Moose-2.2011 ... N/A
diff --git a/bin/add_tradis_tags b/bin/add_tradis_tags
index f4cf68f..d55123f 100755
--- a/bin/add_tradis_tags
+++ b/bin/add_tradis_tags
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::DetectTags;
+use FindBin qw($Bin); 
 
 # ABSTRACT: check if tr tag is present
 # PODNAME: check_tags
@@ -14,6 +15,7 @@ Checks the presence of tr/tq tags in a given BAM file
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::AddTags;
 
diff --git a/bin/bacteria_tradis b/bin/bacteria_tradis
index 5680dcc..14b801c 100755
--- a/bin/bacteria_tradis
+++ b/bin/bacteria_tradis
@@ -2,6 +2,10 @@
 
 package Bio::Tradis::Bin::RunTradis;
 
+use FindBin qw($Bin);
+=======
+
+
 # ABSTRACT: Perform full tradis analysis
 # PODNAME: run_tradis
 
@@ -15,6 +19,7 @@ site plots for use in Artemis
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::TradisAnalysis;
 
diff --git a/bin/check_tradis_tags b/bin/check_tradis_tags
index ac1007c..09733fd 100755
--- a/bin/check_tradis_tags
+++ b/bin/check_tradis_tags
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::DetectTags;
+use FindBin qw($Bin); 
 
 # ABSTRACT: check if tr tag is present
 # PODNAME: check_tags
@@ -14,6 +15,7 @@ Checks the presence of tr/tq tags in a given BAM file
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::CheckTags;
 
diff --git a/bin/combine_tradis_plots b/bin/combine_tradis_plots
index 9d90d2c..d892dd2 100755
--- a/bin/combine_tradis_plots
+++ b/bin/combine_tradis_plots
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::CombineTradisPlots;
+use FindBin qw($Bin); 
 
 # ABSTRACT: Combine multiple plotfiles and generate updated statistics for the combined files
 
@@ -17,6 +18,7 @@ plotfile and as an identifier in the stats file, so ensure these are unique.
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::PlotCombine;
 
diff --git a/bin/filter_tradis_tags b/bin/filter_tradis_tags
index 01ae6a2..180fca5 100755
--- a/bin/filter_tradis_tags
+++ b/bin/filter_tradis_tags
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::FilterTags;
+use FindBin qw($Bin); 
 
 # ABSTRACT: filter tags at start of fastq sequences
 # PODNAME: filter_tags
@@ -15,6 +16,7 @@ match the tag provided
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::FilterFastqTags;
 
diff --git a/bin/remove_tradis_tags b/bin/remove_tradis_tags
index 0d54139..d62462a 100755
--- a/bin/remove_tradis_tags
+++ b/bin/remove_tradis_tags
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::RemoveTags;
+use FindBin qw($Bin); 
 
 # ABSTRACT: remove user specified tags from start of fastq sequences
 # PODNAME: remove_tags
@@ -14,6 +15,7 @@ Removes tags from the sequence and quality strings based on user input
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::RemoveFastqTags;
 
diff --git a/bin/tradis_comparison.R b/bin/tradis_comparison.R
index c3f5164..d1073ba 100755
--- a/bin/tradis_comparison.R
+++ b/bin/tradis_comparison.R
@@ -3,7 +3,7 @@
 # PODNAME: tradis_comparison.R
 # ABSTRACT: tradis_comparison.R
 
-library("edgeR")
+if(!require(edgeR)){install.packages("edgeR", repos = "http://cran.us.r-project.org")}
 library("getopt")
 
 options(width=80)
diff --git a/bin/tradis_gene_insert_sites b/bin/tradis_gene_insert_sites
index e55ea6a..8c60fa5 100755
--- a/bin/tradis_gene_insert_sites
+++ b/bin/tradis_gene_insert_sites
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::GeneInsertSites;
+use FindBin qw($Bin); 
 
 # ABSTRACT: Generate insertion site details from TraDIS pipeline plots
 
diff --git a/bin/tradis_merge_plots b/bin/tradis_merge_plots
index 05c1109..c62e30e 100755
--- a/bin/tradis_merge_plots
+++ b/bin/tradis_merge_plots
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::MergePlots;
+use FindBin qw($Bin); 
 
 # ABSTRACT: 
 
diff --git a/bin/tradis_plot b/bin/tradis_plot
index ce00c9e..29dea64 100755
--- a/bin/tradis_plot
+++ b/bin/tradis_plot
@@ -1,6 +1,7 @@
 #!/usr/bin/env perl
 
 package Bio::Tradis::Bin::TradisPlot;
+use FindBin qw($Bin); 
 
 # ABSTRACT: Generate plots as part of a tradis analysis
 # PODNAME: tradis_plot
@@ -15,6 +16,7 @@ a reference in GFF format
 BEGIN { unshift( @INC, '../lib' ) }
 BEGIN { unshift( @INC, './lib' ) }
 BEGIN { unshift( @INC, '/software/pathogen/internal/prod/lib/' ) }
+BEGIN { unshift( @INC, "$Bin/../lib/" ) }
 
 use Bio::Tradis::CommandLine::PlotTradis;
 
diff --git a/build/bwa-0.7.17.tbz b/build/bwa-0.7.17.tbz
new file mode 100644
index 0000000..eb05d75
Binary files /dev/null and b/build/bwa-0.7.17.tbz differ
diff --git a/build/samtools-1.3.tbz b/build/samtools-1.3.tbz
new file mode 100644
index 0000000..9efbfac
Binary files /dev/null and b/build/samtools-1.3.tbz differ
diff --git a/build/smalt-0.7.6.tgz b/build/smalt-0.7.6.tgz
new file mode 100644
index 0000000..2a7444b
Binary files /dev/null and b/build/smalt-0.7.6.tgz differ
diff --git a/build/tabix-master.tgz b/build/tabix-master.tgz
new file mode 100644
index 0000000..c739bb7
Binary files /dev/null and b/build/tabix-master.tgz differ
diff --git a/debian/changelog b/debian/changelog
index a4a285b..4478550 100644
--- a/debian/changelog
+++ b/debian/changelog
@@ -1,3 +1,9 @@
+bio-tradis (1.4.3+git20191202.7322c1b-1) UNRELEASED; urgency=medium
+
+  * New upstream snapshot.
+
+ -- Debian Janitor <janitor@jelmer.uk>  Tue, 03 Dec 2019 08:53:44 +0000
+
 bio-tradis (1.4.1+dfsg-1) unstable; urgency=medium
 
   * New upstream version
diff --git a/dist.ini b/dist.ini
index 72204da..6a47a5b 100644
--- a/dist.ini
+++ b/dist.ini
@@ -3,7 +3,7 @@ author  = Carla Cummins <path-help@sanger.ac.uk>
 license = GPL_3
 copyright_holder = Wellcome Trust Sanger Institute
 copyright_year   = 2013
-version = 1.4.1
+version = 1.4.4
 
 [MetaResources]
 homepage        = http://www.sanger.ac.uk/
@@ -45,10 +45,16 @@ filename = t/data/DetectTags/sample_sm_no_tr.bam
 filename = t/data/FilterTags/sample.fastq.gz
 filename = t/data/InsertSite/small_multi_sequence.bam
 filename = t/data/Parsers/test.bam
-filename = t/data/RunTradis/expected.1mm.plot.gz
-filename = t/data/RunTradis/expected.plot.gz
-filename = t/data/RunTradis/test.tagged.fastq.gz
-filename = t/data/RunTradis/test2.tagged.fastq.gz
+filename = t/data/RunTradisBWA/expected.1mm.plot.gz
+filename = t/data/RunTradisBWA/expected.plot.gz
+filename = t/data/RunTradisBWA/test.tagged.fastq.gz
+filename = t/data/RunTradisBWA/test2.tagged.fastq.gz
+filename = t/data/RunTradisSmalt/expected.1mm.plot.gz
+filename = t/data/RunTradisSmalt/expected.plot.gz
+filename = t/data/RunTradisSmalt/test.tagged.fastq.gz
+filename = t/data/RunTradisSmalt/test2.tagged.fastq.gz
+filename = t/data/RunTradisTaglessBWA/expected.plot.gz
+filename = t/data/RunTradisTaglessSmalt/expected.plot.gz
 filename = t/data/TradisPlot/expected.plot.gz
 filename = t/data/TradisPlot/test.mapped.bam
 filename = t/data/AddTags/expected_tradis.cram
diff --git a/install_dependencies.sh b/install_dependencies.sh
index 9a2d133..dbadc5d 100755
--- a/install_dependencies.sh
+++ b/install_dependencies.sh
@@ -6,10 +6,12 @@ set -e
 start_dir=$(pwd)
 
 SMALT_VERSION="0.7.6"
+BWA_VERSION="0.7.17"
 TABIX_VERSION="master"
 SAMTOOLS_VERSION="1.3"
 
 SMALT_DOWNLOAD_URL="http://downloads.sourceforge.net/project/smalt/smalt-${SMALT_VERSION}-bin.tar.gz"
+BWA_DOWNLOAD_URL="https://sourceforge.net/projects/bio-bwa/files/bwa-${BWA_VERSION}.tar.bz2/download"
 TABIX_DOWNLOAD_URL="https://github.com/samtools/tabix/archive/${TABIX_VERSION}.tar.gz"
 SAMTOOLS_DOWNLOAD_URL="https://github.com/samtools/samtools/releases/download/${SAMTOOLS_VERSION}/samtools-${SAMTOOLS_VERSION}.tar.bz2"
 
@@ -34,6 +36,7 @@ download () {
 }
 
 download $SMALT_DOWNLOAD_URL "smalt-${SMALT_VERSION}.tgz"
+download $BWA_DOWNLOAD_URL "bwa-${BWA_VERSION}.tbz"
 download $TABIX_DOWNLOAD_URL "tabix-${TABIX_VERSION}.tgz"
 download $SAMTOOLS_DOWNLOAD_URL "samtools-${SAMTOOLS_VERSION}.tbz"
 
@@ -42,7 +45,7 @@ if [ "$TRAVIS" = 'true' ]; then
   echo "Using Travis's apt plugin"
 else
   sudo apt-get update -q
-  sudo apt-get install -y -q zlib1g-dev
+  sudo apt-get install -y -q zlib1g-dev libxml-libxml-perl libgd-gd2-perl bioperl 
 fi
 
 # Build all the things
@@ -57,6 +60,17 @@ if [ ! -e "$smalt_dir/smalt" ]; then
   ln "$smalt_dir/smalt_x86_64" "$smalt_dir/smalt" 
 fi
 
+## bwa
+cd $build_dir
+bwa_dir=$(pwd)/"bwa-${BWA_VERSION}"
+if [ ! -d $bwa_dir ]; then
+  tar xjfv bwa-${BWA_VERSION}.tbz
+fi
+cd $bwa_dir
+if [ ! -e "$bwa_dir/bwa" ]; then
+  make
+fi
+
 ## tabix
 cd $build_dir
 tabix_dir=$(pwd)/"tabix-$TABIX_VERSION"
@@ -96,6 +110,7 @@ update_path () {
 }
 
 update_path ${smalt_dir}
+update_path ${bwa_dir}
 update_path "${tabix_dir}"
 update_path "${samtools_dir}"
 
@@ -103,6 +118,8 @@ cd $start_dir
 
 # Install perl dependencies
 cpanm Dist::Zilla
+cpanm Dist::Zilla::PluginBundle::Starter
+
 dzil authordeps --missing | cpanm
 dzil listdeps --missing | cpanm
 
diff --git a/lib/Bio/Tradis/CommandLine/RunMapping.pm b/lib/Bio/Tradis/CommandLine/RunMapping.pm
index df15cc7..dcc21ea 100644
--- a/lib/Bio/Tradis/CommandLine/RunMapping.pm
+++ b/lib/Bio/Tradis/CommandLine/RunMapping.pm
@@ -23,16 +23,18 @@ has 'refname' =>
   ( is => 'rw', isa => 'Str', required => 0, default => 'ref.index' );
 has 'outfile' =>
   ( is => 'rw', isa => 'Str', required => 0, default => 'mapped.sam' );
+has 'smalt' => ( is => 'rw', isa => 'Maybe[Int]', required => 0, default => 0 );
 has 'smalt_k' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
 has 'smalt_s' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
 has 'smalt_y' => ( is => 'rw', isa => 'Maybe[Num]', required => 0, default => 0.96 );
 has 'smalt_r' => ( is => 'rw', isa => 'Maybe[Int]', required => 0, default => -1 );
 has 'smalt_n' => ( is => 'rw', isa => 'Maybe[Int]', required => 0, default => 1 );
 
+
 sub BUILD {
     my ($self) = @_;
 
-    my ( $fastqfile, $ref, $refname, $outfile, $smalt_k, $smalt_s, $smalt_y, $smalt_r,$smalt_n,  $help );
+    my ( $fastqfile, $ref, $refname, $outfile, $smalt, $smalt_k, $smalt_s, $smalt_y, $smalt_r,$smalt_n,  $help );
 
     GetOptionsFromArray(
         $self->args,
@@ -40,6 +42,7 @@ sub BUILD {
         'r|reference=s'   => \$ref,
         'rn|refname=s'    => \$refname,
         'o|outfile=s'     => \$outfile,
+        's|smalt=i'    => \$smalt,
 	'sk|smalt_k=i'    => \$smalt_k,
 	'ss|smalt_s=i'    => \$smalt_s,
 	'sy|smalt_y=f'    => \$smalt_y,
@@ -52,6 +55,7 @@ sub BUILD {
     $self->reference( abs_path($ref) )       if ( defined($ref) );
     $self->refname($refname)                 if ( defined($refname) );
     $self->outfile( abs_path($outfile) )     if ( defined($outfile) );
+    $self->smalt( $smalt )               if ( defined($smalt) );
     $self->smalt_k( $smalt_k )               if ( defined($smalt_k) );
     $self->smalt_s( $smalt_s )               if ( defined($smalt_s) );
     $self->smalt_y( $smalt_y )               if ( defined($smalt_y) );
@@ -76,6 +80,7 @@ sub run {
         reference => $self->reference,
         refname   => $self->refname,
         outfile   => $self->outfile,
+        smalt => $self->smalt,
 	smalt_k   => $self->smalt_k,
 	smalt_s   => $self->smalt_s,
 	smalt_y   => $self->smalt_y,
@@ -87,8 +92,8 @@ sub run {
 
 sub usage_text {
       print <<USAGE;
-Indexes the reference genome and maps the given fastq file.
--k and -s options for indexing are calculated for the length of
+Indexes the reference genome and maps the given fastq file. If smalt is to be used set -s or --smalt and 
+-sk and -s as options for indexing which are calculated for the length of
 the read as follows unless otherwise specified ( --smalt_k & 
 --smalt_s options )
 Read length    | k  |  s
@@ -104,10 +109,12 @@ Options:
 -r        : reference in fasta format
 -rn       : reference index name (optional. default: ref.index)
 -o        : mapped SAM output name (optional. default: mapped.sam)
+-k        : minimum seed length for BWA mapping (optional)
+--smalt   : smalt to be used as aligner (oprional. default: bwa)
 --smalt_k : custom k-mer value for SMALT mapping
 --smalt_s : custom step size for SMALT mapping
 --smalt_r : custom r value for SMALT mapping
--n        : number of threads to use for SMALT and samtools sort (optional. default = 1)
+-n        : number of threads to use for mapping and samtools sort (optional. default = 1)
 
 USAGE
       exit;
diff --git a/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm b/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm
index 95b5ff7..78512f9 100644
--- a/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm
+++ b/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm
@@ -18,7 +18,7 @@ use Try::Tiny;
 has 'args'        => ( is => 'ro', isa => 'ArrayRef', required => 1 );
 has 'script_name' => ( is => 'ro', isa => 'Str',      required => 1 );
 has 'fastqfile'   => ( is => 'rw', isa => 'Str',      required => 0 );
-has 'tag'         => ( is => 'rw', isa => 'Str',      required => 0 );
+has 'tag'         => ( is => 'rw', isa => 'Maybe[Str]',      required => 0 );
 has 'mismatch' => ( is => 'rw', isa => 'Int', required => 0, default => 0 );
 has 'tagdirection' =>
   ( is => 'rw', isa => 'Str', required => 0, default => '3' );
@@ -26,6 +26,8 @@ has 'reference' => ( is => 'rw', isa => 'Str',  required => 0 );
 has 'help'      => ( is => 'rw', isa => 'Bool', required => 0 );
 has 'mapping_score' =>
   ( is => 'rw', isa => 'Int', required => 0, default => 30 );
+has 'min_seed_len' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
+has 'smalt' => ( is => 'rw', isa => 'Bool', default => 0 );
 has 'smalt_k' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
 has 'smalt_s' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
 has 'smalt_y' => ( is => 'rw', isa => 'Maybe[Num]', required => 0, default => 0.96 );
@@ -56,7 +58,7 @@ sub BUILD {
     my ($self) = @_;
 
     my (
-        $fastqfile, $tag,     $td,      $mismatch, $ref,$smalt_n, $essentiality,
+        $fastqfile, $tag,     $td,      $mismatch, $ref,$smalt_n, $essentiality, $min_seed_len, $smalt,
         $map_score, $smalt_k, $smalt_s, $smalt_y, $smalt_r, $help, $verbose,$samtools_exec
     );
 
@@ -68,14 +70,16 @@ sub BUILD {
         'mm|mismatch=i'     => \$mismatch,
         'r|reference=s'     => \$ref,
         'm|mapping_score=i' => \$map_score,
+        'k|min_seed_len=i'  => \$min_seed_len,
+        's|smalt'           => \$smalt,
         'sk|smalt_k=i'      => \$smalt_k,
         'ss|smalt_s=i'      => \$smalt_s,
         'sy|smalt_y=f'      => \$smalt_y,
-				'n|smalt_n=i'       => \$smalt_n,
-	      'sr|smalt_r=i'      => \$smalt_r,
+        'n|smalt_n=i'       => \$smalt_n,
+        'sr|smalt_r=i'      => \$smalt_r,
         'v|verbose'         => \$verbose,
         'samtools_exec=s'   => \$samtools_exec,
-				'e|essentiality'    => \$essentiality,
+        'e|essentiality'    => \$essentiality,
         'h|help'            => \$help
     );
 
@@ -93,17 +97,22 @@ sub BUILD {
     $self->mismatch($mismatch)               if ( defined($mismatch) );
     $self->reference( abs_path($ref) )       if ( defined($ref) );
     $self->mapping_score($map_score)         if ( defined($map_score) );
+    $self->min_seed_len($min_seed_len)       if ( defined($min_seed_len) );
+    $self->smalt($smalt)                     if ( defined($smalt) );
     $self->smalt_k($smalt_k)                 if ( defined($smalt_k) );
     $self->smalt_s($smalt_s)                 if ( defined($smalt_s) );
     $self->smalt_y($smalt_y)                 if ( defined($smalt_y) );
-    $self->smalt_r($smalt_r)		         if ( defined($smalt_r) );
-	$self->smalt_n($smalt_n)		         if ( defined($smalt_n) );
+    $self->smalt_r($smalt_r)                 if ( defined($smalt_r) );
+    $self->smalt_n($smalt_n)                 if ( defined($smalt_n) );
     $self->help($help)                       if ( defined($help) );
     $self->verbose($verbose)                 if ( defined($verbose));
     $self->samtools_exec($samtools_exec)     if ( defined($samtools_exec) );
     
+
+
     # print usage text if required parameters are not present
-    ( $fastqfile && $tag && $ref ) or die $self->usage_text;
+    ( $fastqfile ) or die "--fastqfile required/n" . $self->usage_text;
+    ( $ref ) or die "--reference required\n" . $self->usage_text;
 }
 
 sub run {
@@ -149,11 +158,13 @@ sub run {
             mapping_score    => $self->mapping_score,
             output_directory => $self->_output_directory,
             _stats_handle    => $self->_stats_handle,
+            min_seed_len     => $self->min_seed_len,
+            smalt            => $self->smalt,
             smalt_k          => $self->smalt_k,
             smalt_s          => $self->smalt_s,
             smalt_y          => $self->smalt_y,
             smalt_r          => $self->smalt_r,
-			smalt_n          => $self->smalt_n,
+            smalt_n          => $self->smalt_n,
             verbose          => $self->verbose,
             samtools_exec    => $self->samtools_exec
         );
@@ -250,11 +261,13 @@ Usage: bacteria_tradis [options]
 
 Options:
 -f        : text file listing fastq files with tradis tags attached
--t        : tag to search for
+-t        : tag to search for (optional.  If not set runs bwa in tagless mode with no filtering.)
 -r        : reference genome in fasta format (.fa)
 -td       : tag direction - 3 or 5 (optional. default = 3)
 -mm       : number of mismatches allowed when matching tag (optional. default = 0)
 -m        : mapping quality cutoff score (optional. default = 30)
+-k        : custom k-mer value (min seed length) (optional)
+--smalt   : use smalt rather than bwa as the mapper
 --smalt_k : custom k-mer value for SMALT mapping (optional)
 --smalt_s : custom step size for SMALT mapping (optional)
 --smalt_y : custom y parameter for SMALT (optional. default = 0.96)
diff --git a/lib/Bio/Tradis/Map.pm b/lib/Bio/Tradis/Map.pm
index 726f882..9d48ac1 100644
--- a/lib/Bio/Tradis/Map.pm
+++ b/lib/Bio/Tradis/Map.pm
@@ -72,6 +72,8 @@ has 'refname' =>
   ( is => 'rw', isa => 'Str', required => 0, default => 'ref.index' );
 has 'outfile' =>
   ( is => 'rw', isa => 'Str', required => 0, default => 'mapped.sam' );
+has 'min_seed_len' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
+has 'smalt' => ( is => 'rw', isa => 'Bool', required => 0, default => 0 );
 has 'smalt_k' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
 has 'smalt_s' => ( is => 'rw', isa => 'Maybe[Int]', required => 0 );
 has 'smalt_y' => ( is => 'rw', isa => 'Maybe[Num]', required => 0, default => 0.96 );
@@ -83,23 +85,32 @@ sub index_ref {
     my $ref     = $self->reference;
     my $refname = $self->refname;
 
-    # Calculate index parameters
+    my $cmd = "";
+    if ($self->smalt) {
+        # Calculate index parameters
+        my $read_len = $self->_calculate_read_len();
+        my ( $k, $s ) = $self->_calculate_index_parameters($read_len);
+        $cmd = "smalt index -k $k -s $s $refname $ref > /dev/null 2>&1";
+    } else {
+        $cmd = "bwa index $ref > /dev/null 2>&1"
+    }
+    system($cmd);
+    return $cmd;
+}
+
+sub _calculate_read_len {
+    my ($self) = @_;
     my $pars = Bio::Tradis::Parser::Fastq->new( file => $self->fastqfile );
     $pars->next_read;
     my @read = $pars->read_info;
-	my $read_len = length($read[1]);
-    my ( $k, $s ) = $self->_calculate_index_parameters($read_len);
-
-    my $cmd = "smalt index -k $k -s $s $refname $ref > /dev/null 2>&1";
-    system($cmd);
-    return $cmd;
+    return length($read[1]);
 }
 
 sub _calculate_index_parameters {
 	my ($self, $read_len)  = @_;
 	my ( $k, $s );
-	
-	if( defined $self->smalt_k ){ $k = $self->smalt_k; }
+    
+    if ( defined $self->smalt_k ){ $k = $self->smalt_k; }
 	else{ $k = $self->_smalt_k_default($read_len); }
 	
 	if( defined $self->smalt_s ){ $s = $self->smalt_s; }
@@ -108,6 +119,12 @@ sub _calculate_index_parameters {
 	return ( $k, $s );
 }
 
+sub _min_seed_len_default {
+	my ($self, $read_len)  = @_;
+	if($read_len < 100){ return 13; }
+	else{ return 19; }
+}
+
 sub _smalt_k_default {
 	my ($self, $read_len)  = @_;
 	if($read_len < 100){ return 13; }
@@ -124,18 +141,29 @@ sub _smalt_s_default {
 sub do_mapping {
     my ($self)  = @_;
     my $fqfile  = $self->fastqfile;
+    my $ref = $self->reference;
     my $refname = $self->refname;
     my $outfile = $self->outfile;
     my $y = $self->smalt_y;
     my $r = $self->smalt_r;
-		my $n = $self->smalt_n;
-
-    my $smalt = "smalt map -n $n -x -r $r -y $y $refname $fqfile 1> $outfile  2> smalt.stderr";
+    my $n = $self->smalt_n;
+
+    my $align = "";
+    if ($self->smalt) { 
+        $align = "smalt map -n $n -x -r $r -y $y $refname $fqfile 1> $outfile 2> align.stderr";
+    } else {
+        my $read_len = $self->_calculate_read_len();
+        my $k = ( defined $self->min_seed_len ) ? 
+            $self->min_seed_len : 
+            $self->_min_seed_len_default($read_len);
+    
+        $align = "bwa mem -k $k -t $n $ref $fqfile 1> $outfile 2> align.stderr";
+    }
 
-    system($smalt);
-    unlink('smalt.stderr');
+    system($align);
+    unlink('align.stderr');
     
-    return $smalt;
+    return $align;
 }
 
 __PACKAGE__->meta->make_immutable;
diff --git a/lib/Bio/Tradis/RunTradis.pm b/lib/Bio/Tradis/RunTradis.pm
index e1fc6b8..4ad8b41 100644
--- a/lib/Bio/Tradis/RunTradis.pm
+++ b/lib/Bio/Tradis/RunTradis.pm
@@ -29,8 +29,6 @@ Artemis (or other genome browsers), mapped BAM files for each lane and a statist
 			intermediary format conversion and sorting) steps starting from
 			filtering.
 
-=item * C<tag> - TraDIS tag to filter and then remove
-
 =item * C<reference> - path to/name of reference genome in fasta format (.fa)
 
 =back
@@ -45,6 +43,8 @@ Artemis (or other genome browsers), mapped BAM files for each lane and a statist
 
 =item * C<mapping_score> - cutoff value for mapping score when creating insertion site plots. Default = 30
 
+=item * C<tag> - TraDIS tag to filter and then remove
+
 =back
 
 =head1 METHODS
@@ -68,7 +68,7 @@ has 'verbose' => ( is => 'rw', isa => 'Bool', default => 0 );
 has 'fastqfile' => ( is => 'rw', isa => 'Str', required => 1 );
 has '_unzipped_fastq' =>
   ( is => 'rw', isa => 'Str', lazy => 1, builder => '_build__unzipped_fastq' );
-has 'tag' => ( is => 'ro', isa => 'Str', required => 1 );
+has 'tag' => ( is => 'ro', isa => 'Maybe[Str]', required => 0 );
 has 'tagdirection' =>
   ( is => 'ro', isa => 'Str', required => 1, default => '3' );
 has 'mismatch' => ( is => 'rw', isa => 'Int', required => 1, default => 0 );
@@ -87,6 +87,8 @@ has 'outfile' => (
         return $o;
     }
 );
+has 'min_seed_len' => ( is => 'rw', isa => 'Maybe[Int]',   required => 0 );
+has 'smalt' => ( is => 'rw', isa => 'Bool', default => 0 );
 has 'smalt_k' => ( is => 'rw', isa => 'Maybe[Int]',   required => 0 );
 has 'smalt_s' => ( is => 'rw', isa => 'Maybe[Int]',   required => 0 );
 has 'smalt_y' => ( is => 'rw', isa => 'Maybe[Num]', required => 0, default => 0.96 );
@@ -209,20 +211,24 @@ sub run_tradis {
 
     print STDERR "::::::::::::::::::\n$fq\n::::::::::::::::::\n\n" if($self->verbose);
 
-    # Step 1: Filter tags that match user input tag
-    print STDERR "..........Step 1: Filter tags that match user input tag\n" if($self->verbose);
-    $self->_filter;
+    if (defined($self->tag)) {
+        # Step 1: Filter tags that match user input tag
+        print STDERR "..........Step 1: Filter tags that match user input tag\n" if($self->verbose);
+        $self->_filter;
 
-    print STDERR "..........Step 1.1: Check that at least one read started with the tag\n" if($self->verbose);
-    $self->_check_filter;
+        print STDERR "..........Step 1.1: Check that at least one read started with the tag\n" if($self->verbose);
+        $self->_check_filter;
 
-    # Step 2: Remove the tag from the sequence and quality strings
-    print STDERR
-"..........Step 2: Remove the tag from the sequence and quality strings\n" if($self->verbose);
-    $self->_remove;
+        # Step 2: Remove the tag from the sequence and quality strings
+        print STDERR "..........Step 2: Remove the tag from the sequence and quality strings\n" if($self->verbose);
+        $self->_remove;
+    } else {
+        print STDERR "..........Tagless mode selected skipping steps 1 and 2\n" if($self->verbose);
+    }
 
     # Step 3: Map file to reference
-    print STDERR "..........Step 3: Map file to reference\n" if($self->verbose);
+    my $mapper = $self->smalt ? "smalt" : "bwa";
+    print STDERR "..........Step 3: Map file to reference using $mapper\n" if($self->verbose);
     $self->_map;
 
     # Step 4: Convert output from SAM to BAM, sort and index
@@ -317,17 +323,20 @@ sub _map {
     my $temporary_directory = $self->_temp_directory;
 
     my $ref = $self->reference;
+    my $fqfile = !defined($self->tag) ? $self->_unzipped_fastq : "$temporary_directory/tags_removed.fastq";
 
     my $mapping = Bio::Tradis::Map->new(
-        fastqfile => "$temporary_directory/tags_removed.fastq",
+        fastqfile => $fqfile,
         reference => "$ref",
         refname   => "$temporary_directory/ref.index",
         outfile   => "$temporary_directory/mapped.sam",
+        min_seed_len  => $self->min_seed_len,
         smalt_k   => $self->smalt_k,
         smalt_s   => $self->smalt_s,
         smalt_y   => $self->smalt_y,
         smalt_r   => $self->smalt_r,
-        smalt_n   => $self->smalt_n
+        smalt_n   => $self->smalt_n,
+        smalt     => $self->smalt
     );
     $mapping->index_ref;
     $mapping->do_mapping;
@@ -425,9 +434,11 @@ sub _stats {
     $stats .= "$total_reads,";
 
     # Matching reads
-    my $matching =
-      `wc $temporary_directory/filter.fastq | awk '{print \$1/4}'`;
-    chomp($matching);
+    my $matching = $total_reads;
+    if (defined($self->tag)) {
+        $matching = `wc $temporary_directory/filter.fastq | awk '{print \$1/4}' `;
+        chomp($matching);
+    }
     $stats .= "$matching,";
     $stats .= ( $matching / $total_reads ) * 100 . ",";
 
diff --git a/source_path b/source_path
new file mode 100755
index 0000000..3454c0b
--- /dev/null
+++ b/source_path
@@ -0,0 +1,22 @@
+SMALT_VERSION="0.7.6"
+BWA_VERSION="0.7.17"
+TABIX_VERSION="master"
+SAMTOOLS_VERSION="1.3"
+
+smalt_dir=$(pwd)/"smalt-${SMALT_VERSION}-bin"
+bwa_dir=$(pwd)/"bwa-${BWA_VERSION}"
+tabix_dir=$(pwd)/"tabix-$TABIX_VERSION"
+samtools_dir=$(pwd)/"samtools-$SAMTOOLS_VERSION"
+
+update_path () {
+  new_dir=$1
+  if [[ ! "$PATH" =~ (^|:)"${new_dir}"(:|$) ]]; then
+    export PATH=${new_dir}:${PATH}
+  fi
+}
+
+update_path ${smalt_dir}
+update_path ${bwa_dir}
+update_path "${tabix_dir}"
+update_path "${samtools_dir}"
+
diff --git a/t/Bio/Tradis/CommandLine/TradisAnalysis.t b/t/Bio/Tradis/CommandLine/TradisAnalysis.t
index 532c45b..38032be 100644
--- a/t/Bio/Tradis/CommandLine/TradisAnalysis.t
+++ b/t/Bio/Tradis/CommandLine/TradisAnalysis.t
@@ -23,7 +23,7 @@ my $output_directory = $output_directory_obj->dirname;
 ok(
     my $obj = Bio::Tradis::CommandLine::TradisAnalysis->new(
               args              => ['-f', 't/data/CommandLine/fastq.list', '-t',
-                                    "TAAGAGTCAG", '-r', "t/data/RunTradis/smallref.fa"],
+                                    "TAAGAGTCAG", '-r', "t/data/RunTradisSmalt/smallref.fa"],
               script_name       => 'bacteria_tradis_test',
               _output_directory => $output_directory
     ),
@@ -46,7 +46,7 @@ $output_directory = $output_directory_obj->dirname;
 
 $obj = Bio::Tradis::CommandLine::TradisAnalysis->new(
        args              => ['-f', 't/data/CommandLine/fastq.list', '-t',
-                             "CGCACAGCCG", '-r', "t/data/RunTradis/smallref.fa"],
+                             "CGCACAGCCG", '-r', "t/data/RunTradisSmalt/smallref.fa"],
        script_name       => 'bacteria_tradis_test',
        _output_directory => $output_directory
 );
@@ -71,7 +71,7 @@ $output_directory = $output_directory_obj->dirname;
 
 $obj = Bio::Tradis::CommandLine::TradisAnalysis->new(
        args              => ['-f', 't/data/CommandLine/fastq.list', '-t',
-                             "AAAAAAAAAA", '-r', "t/data/RunTradis/smallref.fa"],
+                             "AAAAAAAAAA", '-r', "t/data/RunTradisSmalt/smallref.fa"],
        script_name       => 'bacteria_tradis_test',
        _output_directory => $output_directory
 );
@@ -88,4 +88,4 @@ while (<STATS>) { $line_count++; }
 is( $line_count, 0, "neither input fastq has reads with tag");
 rmtree($output_directory);
 
-done_testing();
+done_testing();
\ No newline at end of file
diff --git a/t/Bio/Tradis/Map.t b/t/Bio/Tradis/Map.t
index e3d6e08..8050922 100644
--- a/t/Bio/Tradis/Map.t
+++ b/t/Bio/Tradis/Map.t
@@ -29,7 +29,8 @@ ok(
         fastqfile => $fastqfile,
         reference => $ref,
         refname   => $refname,
-        outfile   => $outfile
+        outfile   => $outfile,
+        smalt     => 1
     ),
     'creating object'
 );
@@ -37,13 +38,41 @@ ok( $obj->index_ref,              'testing reference indexing' );
 ok( -e 't/data/Map/test.ref.sma', 'checking index file existence' );
 ok( -e 't/data/Map/test.ref.smi', 'checking index file existence' );
 
-ok( $obj->do_mapping,           'testing reference indexing' );
+ok( $obj->do_mapping,           'testing smalt mapping' );
 ok( -e 't/data/Map/mapped.out', 'checking index file existence' );
 system("grep -v ^\@ t/data/Map/mapped.out > mapped.nohead.out");
-system("grep -v ^\@ t/data/Map/expected.mapped > expected.nohead.mapped");
+system("grep -v ^\@ t/data/Map/expected.smalt.mapped > expected.smalt.nohead.mapped");
 compare_ok(
     'mapped.nohead.out',
-    'expected.nohead.mapped',
+    'expected.smalt.nohead.mapped',
+    'checking file contents'
+);
+
+ok(
+    $obj = Bio::Tradis::Map->new(
+        fastqfile => $fastqfile,
+        reference => $ref,
+        refname   => $refname,
+        outfile   => $outfile,
+        smalt     => 0
+    ),
+    'creating object'
+);
+ok( $obj->index_ref,              'testing reference indexing' );
+ok( -e 't/data/Map/smallref.fa.amb', 'checking index file existence' );
+ok( -e 't/data/Map/smallref.fa.ann', 'checking index file existence' );
+ok( -e 't/data/Map/smallref.fa.bwt', 'checking index file existence' );
+ok( -e 't/data/Map/smallref.fa.pac', 'checking index file existence' );
+ok( -e 't/data/Map/smallref.fa.sa', 'checking index file existence' );
+
+
+ok( $obj->do_mapping,           'testing bwa mapping' );
+ok( -e 't/data/Map/mapped.out', 'checking index file existence' );
+system("grep -v ^\@ t/data/Map/mapped.out > mapped.nohead.out");
+system("grep -v ^\@ t/data/Map/expected.bwa.mapped > expected.bwa.nohead.mapped");
+compare_ok(
+    'mapped.nohead.out',
+    'expected.bwa.nohead.mapped',
     'checking file contents'
 );
 
@@ -54,6 +83,7 @@ ok(
         reference => $ref,
         refname   => $refname,
         outfile   => $outfile,
+        smalt     => 1,
         smalt_k   => 10,
         smalt_s   => 10,
         smalt_y   => 0.9
@@ -61,17 +91,21 @@ ok(
     'creating object'
 );
 
-my $index_cmd = $obj->index_ref;
-my $index_exp = "smalt index -k 10 -s 10 $refname $ref > /dev/null 2>&1";
-is( $index_cmd, $index_exp, "indexing args correct" );
-
-my $map_cmd = $obj->do_mapping;
-my $map_exp = "smalt map -n 1 -x -r -1 -y 0.9 $refname $fastqfile 1> $outfile  2> smalt.stderr";
-is( $map_cmd, $map_exp, "mapping args correct" );
+my $index_smalt_cmd = $obj->index_ref;
+my $index_smalt_exp = "smalt index -k 10 -s 10 $refname $ref > /dev/null 2>&1";
+is( $index_smalt_cmd, $index_smalt_exp, "indexing args correct" );
 
+my $map_smalt_cmd = $obj->do_mapping;
+my $map_smalt_exp = "smalt map -n 1 -x -r -1 -y 0.9 $refname $fastqfile 1> $outfile 2> align.stderr";
+is( $map_smalt_cmd, $map_smalt_exp, "mapping args correct" );
 
 
 unlink('t/data/Map/test.ref.sma');
 unlink('t/data/Map/test.ref.smi');
 unlink('t/data/Map/mapped.out');
+unlink('t/data/Map/smallref.fa.amb');
+unlink('t/data/Map/smallref.fa.ann');
+unlink('t/data/Map/smallref.fa.bwt');
+unlink('t/data/Map/smallref.fa.pac');
+unlink('t/data/Map/smallref.fa.sa');
 done_testing();
diff --git a/t/Bio/Tradis/RunTradisBWA.t b/t/Bio/Tradis/RunTradisBWA.t
new file mode 100644
index 0000000..2046ec7
--- /dev/null
+++ b/t/Bio/Tradis/RunTradisBWA.t
@@ -0,0 +1,275 @@
+#!/usr/bin/env perl
+use strict;
+use warnings;
+use Cwd;
+use File::Path 'rmtree';
+use File::Temp;
+use Test::Files qw(compare_ok);
+
+BEGIN { unshift( @INC, './lib' ) }
+BEGIN { unshift( @INC, '../lib' ) }
+
+BEGIN {
+    use Test::Most;
+    use Test::Exception;
+    use_ok('Bio::Tradis::RunTradis');
+}
+
+my $output_directory_obj = File::Temp->newdir( 'tmp_run_tradis_tests_XXXXX',
+                                               CLEANUP => 0,
+                                               DIR => cwd() );
+my $output_directory = $output_directory_obj->dirname;
+my $temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                             DIR => $output_directory );
+my $temp_directory = $temp_directory_obj->dirname();
+
+my ( $obj, $fastqfile, $stats_handle, $ref, $tag, $outfile, $aligner);
+
+# First, test all parts and complete pipeline without mismatch
+
+$fastqfile = "t/data/RunTradisBWA/test.tagged.fastq";
+$ref       = "t/data/RunTradisBWA/smallref.fa";
+$tag       = "TAAGAGTCAG";
+$outfile   = "test.plot";
+$aligner   = 0;
+open( $stats_handle, '>', "$output_directory/test.stats" );
+
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile         => $fastqfile,
+        reference         => $ref,
+        tag               => $tag,
+        smalt             => $aligner,
+        outfile           => $outfile,
+        output_directory  => $output_directory,
+        _temp_directory   => $temp_directory,
+        _stats_handle     => $stats_handle
+    ),
+    'creating object - Normal files, no mismatch'
+);
+
+# Filtering step
+ok( $obj->_filter, 'testing filtering step' );
+ok(
+    -e "$temp_directory/filter.fastq",
+    'checking filtered file existence - Normal files, no mismatch'
+);
+compare_ok(
+    "$temp_directory/filter.fastq",
+    't/data/RunTradisBWA/filtered.fastq',
+    'checking filtered file contents - Normal files, no mismatch'
+);
+
+# Check filtering step
+ok( $obj->_check_filter, 'testing check filtering step' );
+system("mv $temp_directory/filter.fastq $temp_directory/filter.fastq.bak");
+throws_ok {$obj->_check_filter} 'Bio::Tradis::Exception::TagFilterError', 'complain if no filtered reads';
+system("touch $temp_directory/filter.fastq");
+throws_ok {$obj->_check_filter} 'Bio::Tradis::Exception::TagFilterError', 'complain if filtered reads are empty';
+system("echo foo > $temp_directory/filter.fastq");
+throws_ok {$obj->_check_filter} 'Bio::Tradis::Exception::TagFilterError', 'complain if filtered reads has less than 4 lines';
+system("echo 'foo\nbar\nbaz\nquux' > $temp_directory/filter.fastq");
+throws_ok {$obj->_check_filter} 'Bio::Tradis::Exception::TagFilterError', 'complain if filtered reads do not look like a fastq';
+system("echo 'foo\nbar\n+' > $temp_directory/filter.fastq");
+throws_ok {$obj->_check_filter} 'Bio::Tradis::Exception::TagFilterError', 'complain if filtered reads are too short';
+system("echo 'foo\nbar\n+\nquux' > $temp_directory/filter.fastq");
+ok( $obj->_check_filter, 'check very basic filtered reads validation');
+system("mv $temp_directory/filter.fastq.bak $temp_directory/filter.fastq");
+
+# Tag removal
+ok( $obj->_remove, 'testing tag removal' );
+ok( -e "$temp_directory/tags_removed.fastq",
+    'checking de-tagged file existence - Normal files, no mismatch' );
+compare_ok(
+    "$temp_directory/tags_removed.fastq",
+    't/data/RunTradisBWA/notags.fastq',
+    'checking de-tagged file contents - Normal files, no mismatch'
+);
+
+# Mapping
+ok( $obj->_map,                             'testing mapping' );
+ok( -e "$temp_directory/mapped.sam", 'checking SAM existence' );
+`grep -v "\@PG" $temp_directory/mapped.sam > $output_directory/tmp1.sam`;
+`grep -v "\@PG" t/data/RunTradisBWA/mapped.sam > $output_directory/tmp2.sam`;
+compare_ok( 
+    "$output_directory/tmp1.sam", 
+    "$output_directory/tmp2.sam",
+    'checking mapped file contents' 
+);
+
+# Conversion
+ok( $obj->_sam2bam,                         'testing SAM/BAM conversion' );
+ok( -e "$temp_directory/mapped.bam", 'checking BAM existence' );
+
+# Sorting
+ok( $obj->_sort_bam, 'testing BAM sorting' );
+ok( -e "$temp_directory/mapped.sort.bam",
+    'checking sorted BAM existence - Normal files, no mismatch' );
+ok( -e "$temp_directory/mapped.sort.bam.bai",
+    'checking indexed BAM existence - Normal files, no mismatch' );
+
+#Bamcheck
+ok( $obj->_bamcheck, 'testing bamcheck' );
+ok( -e "$temp_directory/mapped.bamcheck",
+    'checking bamcheck file existence - Normal files, no mismatch' );
+
+# Plot
+ok( $obj->_make_plot, 'testing plotting' );
+ok( -e "$temp_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files, no mismatch' );
+system(
+"gunzip -c $temp_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped"
+);
+system("gunzip -c t/data/RunTradisBWA/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking plot file contents - Normal files, no mismatch'
+);
+
+
+# Complete pipeline
+ok( $obj->run_tradis, 'testing complete analysis - Normal files, no mismatch' );
+ok( -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files, no mismatch' );
+system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
+system("gunzip -c t/data/RunTradisBWA/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking completed pipeline file contents - Normal files, no mismatch'
+);
+
+unlink("$temp_directory/filter.fastq");
+unlink("$temp_directory/tags_removed.fastq");
+
+unlink("$output_directory/test.plot.AE004091.insert_site_plot.gz");
+unlink("$output_directory/expected.plot.unzipped");
+unlink("$output_directory/test.plot.unzipped");
+
+# Test complete pipeline with 1 mismatch allowed
+
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile         => $fastqfile,
+        reference         => $ref,
+        tag               => $tag,
+        smalt            => $aligner,
+        outfile           => $outfile,
+        mismatch          => 1,
+        output_directory  => $output_directory,
+        _temp_directory   => $temp_directory,
+        _stats_handle     => $stats_handle
+    ),
+    'creating object - Normal files one mismatch'
+);
+
+ok( $obj->run_tradis, 'testing complete analysis with mismatch' );
+ok( -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files one mismatch' );
+system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
+
+
+system("gunzip -c t/data/RunTradisBWA/expected.1mm.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking completed pipeline with mismatch file contents - Normal files one mismatch'
+);
+
+unlink("$output_directory/tmp1.sam");
+unlink("$output_directory/tmp2.sam");
+unlink("$output_directory/test.plot.AE004091.insert_site_plot.gz");
+unlink("$output_directory/expected.plot.unzipped");
+unlink("$output_directory/test.plot.unzipped");
+
+
+# Test pipeline with gzipped input
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+$fastqfile = "t/data/RunTradisBWA/test.tagged.fastq.gz";
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => $ref,
+        tag              => $tag,
+        smalt            => $aligner,
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle
+    ),
+    'creating object with gzipped data - Normal files one mismatch'
+);
+
+ok( $obj->run_tradis, 'testing complete analysis with gzipped data' );
+ok(
+    -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence (gzipped data) - Normal files one mismatch'
+);
+ok( -e "$output_directory/test.plot.mapped.bam", 'checking mapped bam existence - Normal files one mismatch');
+ok( -e "$output_directory/test.plot.mapped.bam.bai", 'checking indexed bam file - Normal files one mismatch');
+
+system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
+system("gunzip -c t/data/RunTradisBWA/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking completed pipeline with gzipped data file contents - Normal files one mismatch'
+);
+
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => $ref,
+        tag              => $tag,
+        smalt            => $aligner,
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle,
+        k                => 10,
+      
+    ),
+    'creating object with custom smalt parameters'
+);
+# Filtering step
+$obj->_filter;
+$obj->_remove;
+ok( $obj->_map, 'mapping with custom parameters fine' );
+
+
+# Check die if ref is not found
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => "not_really_a_ref.fa",
+        tag              => $tag,
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle,
+
+    ),
+    'creating object'
+);
+throws_ok {$obj->run_tradis} 'Bio::Tradis::Exception::RefNotFound', 'correct error thrown'; 
+
+unlink('t/data/RunTradisBWA/smallref.fa.amb');
+unlink('t/data/RunTradisBWA/smallref.fa.ann');
+unlink('t/data/RunTradisBWA/smallref.fa.bwt');
+unlink('t/data/RunTradisBWA/smallref.fa.pac');
+unlink('t/data/RunTradisBWA/smallref.fa.sa');
+rmtree($output_directory);
+done_testing();
diff --git a/t/Bio/Tradis/RunTradis.t b/t/Bio/Tradis/RunTradisSmalt.t
similarity index 90%
rename from t/Bio/Tradis/RunTradis.t
rename to t/Bio/Tradis/RunTradisSmalt.t
index 0bf23a3..f8dd6bc 100644
--- a/t/Bio/Tradis/RunTradis.t
+++ b/t/Bio/Tradis/RunTradisSmalt.t
@@ -15,7 +15,7 @@ BEGIN {
     use_ok('Bio::Tradis::RunTradis');
 }
 
-my $output_directory_obj = File::Temp->newdir( 'tmp_run_tradis_tests_XXXXX',
+my $output_directory_obj = File::Temp->newdir( 'tmp_run_tradis_smalt_tests_XXXXX',
                                                CLEANUP => 0,
                                                DIR => cwd() );
 my $output_directory = $output_directory_obj->dirname;
@@ -23,14 +23,15 @@ my $temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
                                              DIR => $output_directory );
 my $temp_directory = $temp_directory_obj->dirname();
 
-my ( $obj, $fastqfile, $stats_handle, $ref, $tag, $outfile );
+my ( $obj, $fastqfile, $stats_handle, $ref, $tag, $outfile, $aligner);
 
 # First, test all parts and complete pipeline without mismatch
 
-$fastqfile = "t/data/RunTradis/test.tagged.fastq";
-$ref       = "t/data/RunTradis/smallref.fa";
+$fastqfile = "t/data/RunTradisSmalt/test.tagged.fastq";
+$ref       = "t/data/RunTradisSmalt/smallref.fa";
 $tag       = "TAAGAGTCAG";
 $outfile   = "test.plot";
+$aligner   = 1;
 open( $stats_handle, '>', "$output_directory/test.stats" );
 
 ok(
@@ -38,6 +39,7 @@ ok(
         fastqfile         => $fastqfile,
         reference         => $ref,
         tag               => $tag,
+        smalt             => $aligner,
         outfile           => $outfile,
         output_directory  => $output_directory,
         _temp_directory   => $temp_directory,
@@ -54,7 +56,7 @@ ok(
 );
 compare_ok(
     "$temp_directory/filter.fastq",
-    't/data/RunTradis/filtered.fastq',
+    't/data/RunTradisSmalt/filtered.fastq',
     'checking filtered file contents - Normal files, no mismatch'
 );
 
@@ -80,7 +82,7 @@ ok( -e "$temp_directory/tags_removed.fastq",
     'checking de-tagged file existence - Normal files, no mismatch' );
 compare_ok(
     "$temp_directory/tags_removed.fastq",
-    't/data/RunTradis/notags.fastq',
+    't/data/RunTradisSmalt/notags.fastq',
     'checking de-tagged file contents - Normal files, no mismatch'
 );
 
@@ -88,7 +90,7 @@ compare_ok(
 ok( $obj->_map,                             'testing mapping' );
 ok( -e "$temp_directory/mapped.sam", 'checking SAM existence' );
 `grep -v "\@PG" $temp_directory/mapped.sam > $output_directory/tmp1.sam`;
-`grep -v "\@PG" t/data/RunTradis/mapped.sam > $output_directory/tmp2.sam`;
+`grep -v "\@PG" t/data/RunTradisSmalt/mapped.sam > $output_directory/tmp2.sam`;
 compare_ok( 
     "$output_directory/tmp1.sam", 
     "$output_directory/tmp2.sam",
@@ -118,7 +120,7 @@ ok( -e "$temp_directory/test.plot.AE004091.insert_site_plot.gz",
 system(
 "gunzip -c $temp_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped"
 );
-system("gunzip -c t/data/RunTradis/expected.plot.gz > $output_directory/expected.plot.unzipped");
+system("gunzip -c t/data/RunTradisSmalt/expected.plot.gz > $output_directory/expected.plot.unzipped");
 compare_ok(
     "$output_directory/test.plot.unzipped",
     "$output_directory/expected.plot.unzipped",
@@ -131,7 +133,7 @@ ok( $obj->run_tradis, 'testing complete analysis - Normal files, no mismatch' );
 ok( -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
     'checking plot file existence - Normal files, no mismatch' );
 system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
-system("gunzip -c t/data/RunTradis/expected.plot.gz > $output_directory/expected.plot.unzipped");
+system("gunzip -c t/data/RunTradisSmalt/expected.plot.gz > $output_directory/expected.plot.unzipped");
 compare_ok(
     "$output_directory/test.plot.unzipped",
     "$output_directory/expected.plot.unzipped",
@@ -156,6 +158,7 @@ ok(
         fastqfile         => $fastqfile,
         reference         => $ref,
         tag               => $tag,
+        smalt            => $aligner,
         outfile           => $outfile,
         mismatch          => 1,
         output_directory  => $output_directory,
@@ -170,7 +173,7 @@ ok( -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
     'checking plot file existence - Normal files one mismatch' );
 system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
 system(
-    "gunzip -c t/data/RunTradis/expected.1mm.plot.gz > $output_directory/expected.plot.unzipped");
+    "gunzip -c t/data/RunTradisSmalt/expected.1mm.plot.gz > $output_directory/expected.plot.unzipped");
 compare_ok(
     "$output_directory/test.plot.unzipped",
     "$output_directory/expected.plot.unzipped",
@@ -187,12 +190,13 @@ unlink("$output_directory/test.plot.unzipped");
 $temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
                                           DIR => $output_directory );
 $temp_directory = $temp_directory_obj->dirname();
-$fastqfile = "t/data/RunTradis/test.tagged.fastq.gz";
+$fastqfile = "t/data/RunTradisSmalt/test.tagged.fastq.gz";
 ok(
     $obj = Bio::Tradis::RunTradis->new(
         fastqfile        => $fastqfile,
         reference        => $ref,
         tag              => $tag,
+        smalt            => $aligner,
         outfile          => $outfile,
         output_directory => $output_directory,
         _temp_directory  => $temp_directory,
@@ -210,7 +214,7 @@ ok( -e "$output_directory/test.plot.mapped.bam", 'checking mapped bam existence
 ok( -e "$output_directory/test.plot.mapped.bam.bai", 'checking indexed bam file - Normal files one mismatch');
 
 system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
-system("gunzip -c t/data/RunTradis/expected.plot.gz > $output_directory/expected.plot.unzipped");
+system("gunzip -c t/data/RunTradisSmalt/expected.plot.gz > $output_directory/expected.plot.unzipped");
 compare_ok(
     "$output_directory/test.plot.unzipped",
     "$output_directory/expected.plot.unzipped",
@@ -226,6 +230,7 @@ ok(
         fastqfile        => $fastqfile,
         reference        => $ref,
         tag              => $tag,
+        smalt            => $aligner,
         outfile          => $outfile,
         output_directory => $output_directory,
         _temp_directory  => $temp_directory,
diff --git a/t/Bio/Tradis/RunTradisTaglessBwa.t b/t/Bio/Tradis/RunTradisTaglessBwa.t
new file mode 100644
index 0000000..e77ef0a
--- /dev/null
+++ b/t/Bio/Tradis/RunTradisTaglessBwa.t
@@ -0,0 +1,156 @@
+#!/usr/bin/env perl
+use strict;
+use warnings;
+use Cwd;
+use File::Path 'rmtree';
+use File::Temp;
+use Test::Files qw(compare_ok);
+
+BEGIN { unshift( @INC, './lib' ) }
+BEGIN { unshift( @INC, '../lib' ) }
+
+BEGIN {
+    use Test::Most;
+    use Test::Exception;
+    use_ok('Bio::Tradis::RunTradis');
+}
+
+my $output_directory_obj = File::Temp->newdir( 'tmp_run_tradis_tagless_tests_XXXXX',
+                                               CLEANUP => 0,
+                                               DIR => cwd() );
+my $output_directory = $output_directory_obj->dirname;
+my $temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                             DIR => $output_directory );
+my $temp_directory = $temp_directory_obj->dirname();
+
+my ( $obj, $fastqfile, $stats_handle, $ref, $outfile, $aligner);
+
+# First, test all parts and complete pipeline without mismatch
+
+$fastqfile = "t/data/RunTradisTaglessBWA/notags.fastq";
+$ref       = "t/data/RunTradisTaglessBWA/smallref.fa";
+$outfile   = "test.plot";
+$aligner   = 0;
+open( $stats_handle, '>', "$output_directory/test.stats" );
+
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile         => $fastqfile,
+        reference         => $ref,
+        smalt             => $aligner,
+        outfile           => $outfile,
+        output_directory  => $output_directory,
+        _temp_directory   => $temp_directory,
+        _stats_handle     => $stats_handle
+    ),
+    'creating object - Normal files, no mismatch'
+);
+
+
+
+# Mapping
+ok( $obj->_map,                             'testing mapping' );
+ok( -e "$temp_directory/mapped.sam", 'checking SAM existence' );
+`grep -v "\@PG" $temp_directory/mapped.sam > $output_directory/tmp1.sam`;
+`grep -v "\@PG" t/data/RunTradisTaglessBWA/mapped.sam > $output_directory/tmp2.sam`;
+compare_ok( 
+    "$output_directory/tmp1.sam", 
+    "$output_directory/tmp2.sam",
+    'checking mapped file contents' 
+);
+
+# Conversion
+ok( $obj->_sam2bam,                         'testing SAM/BAM conversion' );
+ok( -e "$temp_directory/mapped.bam", 'checking BAM existence' );
+
+# Sorting
+ok( $obj->_sort_bam, 'testing BAM sorting' );
+ok( -e "$temp_directory/mapped.sort.bam",
+    'checking sorted BAM existence - Normal files, no mismatch' );
+ok( -e "$temp_directory/mapped.sort.bam.bai",
+    'checking indexed BAM existence - Normal files, no mismatch' );
+
+#Bamcheck
+ok( $obj->_bamcheck, 'testing bamcheck' );
+ok( -e "$temp_directory/mapped.bamcheck",
+    'checking bamcheck file existence - Normal files, no mismatch' );
+
+# Plot
+ok( $obj->_make_plot, 'testing plotting' );
+ok( -e "$temp_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files, no mismatch' );
+system(
+"gunzip -c $temp_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped"
+);
+system("gunzip -c t/data/RunTradisTaglessBWA/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking plot file contents - Normal files, no mismatch'
+);
+
+
+# Complete pipeline
+ok( $obj->run_tradis, 'testing complete analysis - Normal files, no mismatch' );
+ok( -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files, no mismatch' );
+system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
+system("gunzip -c t/data/RunTradisTaglessBWA/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking completed pipeline file contents - Normal files, no mismatch'
+);
+
+unlink("$temp_directory/filter.fastq");
+unlink("$temp_directory/tags_removed.fastq");
+
+unlink("$output_directory/test.plot.AE004091.insert_site_plot.gz");
+unlink("$output_directory/expected.plot.unzipped");
+unlink("$output_directory/test.plot.unzipped");
+
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => $ref,
+        smalt            => $aligner,
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle,
+        k                => 10,
+      
+    ),
+    'creating object with custom smalt parameters'
+);
+
+ok( $obj->_map, 'mapping with custom parameters fine' );
+
+# Check die if ref is not found
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => "not_really_a_ref.fa",
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle,
+      
+    ),
+    'creating object'
+);
+throws_ok {$obj->run_tradis} 'Bio::Tradis::Exception::RefNotFound', 'correct error thrown'; 
+
+unlink('t/data/RunTradisTaglessBWA/smallref.fa.amb');
+unlink('t/data/RunTradisTaglessBWA/smallref.fa.ann');
+unlink('t/data/RunTradisTaglessBWA/smallref.fa.bwt');
+unlink('t/data/RunTradisTaglessBWA/smallref.fa.pac');
+unlink('t/data/RunTradisTaglessBWA/smallref.fa.sa');
+rmtree($output_directory);
+done_testing();
diff --git a/t/Bio/Tradis/RunTradisTaglessSmalt.t b/t/Bio/Tradis/RunTradisTaglessSmalt.t
new file mode 100644
index 0000000..21ee16b
--- /dev/null
+++ b/t/Bio/Tradis/RunTradisTaglessSmalt.t
@@ -0,0 +1,154 @@
+#!/usr/bin/env perl
+use strict;
+use warnings;
+use Cwd;
+use File::Path 'rmtree';
+use File::Temp;
+use Test::Files qw(compare_ok);
+
+BEGIN { unshift( @INC, './lib' ) }
+BEGIN { unshift( @INC, '../lib' ) }
+
+BEGIN {
+    use Test::Most;
+    use Test::Exception;
+    use_ok('Bio::Tradis::RunTradis');
+}
+
+my $output_directory_obj = File::Temp->newdir( 'tmp_run_tradis_tagless_smalt_tests_XXXXX',
+                                               CLEANUP => 0,
+                                               DIR => cwd() );
+my $output_directory = $output_directory_obj->dirname;
+my $temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                             DIR => $output_directory );
+my $temp_directory = $temp_directory_obj->dirname();
+
+my ( $obj, $fastqfile, $stats_handle, $ref, $outfile, $aligner);
+
+# First, test all parts and complete pipeline without mismatch
+
+$fastqfile = "t/data/RunTradisTaglessSmalt/notags.fastq";
+$ref       = "t/data/RunTradisTaglessSmalt/smallref.fa";
+$outfile   = "test.plot";
+$aligner   = 1;
+open( $stats_handle, '>', "$output_directory/test.stats" );
+
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile         => $fastqfile,
+        reference         => $ref,
+        smalt             => $aligner,
+        outfile           => $outfile,
+        output_directory  => $output_directory,
+        _temp_directory   => $temp_directory,
+        _stats_handle     => $stats_handle
+    ),
+    'creating object - Normal files, no mismatch'
+);
+
+
+
+# Mapping
+ok( $obj->_map,                             'testing mapping' );
+ok( -e "$temp_directory/mapped.sam", 'checking SAM existence' );
+`grep -v "\@PG" $temp_directory/mapped.sam > $output_directory/tmp1.sam`;
+`grep -v "\@PG" t/data/RunTradisTaglessSmalt/mapped.sam > $output_directory/tmp2.sam`;
+compare_ok( 
+    "$output_directory/tmp1.sam", 
+    "$output_directory/tmp2.sam",
+    'checking mapped file contents' 
+);
+
+# Conversion
+ok( $obj->_sam2bam,                         'testing SAM/BAM conversion' );
+ok( -e "$temp_directory/mapped.bam", 'checking BAM existence' );
+
+# Sorting
+ok( $obj->_sort_bam, 'testing BAM sorting' );
+ok( -e "$temp_directory/mapped.sort.bam",
+    'checking sorted BAM existence - Normal files, no mismatch' );
+ok( -e "$temp_directory/mapped.sort.bam.bai",
+    'checking indexed BAM existence - Normal files, no mismatch' );
+
+#Bamcheck
+ok( $obj->_bamcheck, 'testing bamcheck' );
+ok( -e "$temp_directory/mapped.bamcheck",
+    'checking bamcheck file existence - Normal files, no mismatch' );
+
+# Plot
+ok( $obj->_make_plot, 'testing plotting' );
+ok( -e "$temp_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files, no mismatch' );
+system(
+"gunzip -c $temp_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped"
+);
+system("gunzip -c t/data/RunTradisTaglessSmalt/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking plot file contents - Normal files, no mismatch'
+);
+
+
+# Complete pipeline
+ok( $obj->run_tradis, 'testing complete analysis - Normal files, no mismatch' );
+ok( -e "$output_directory/test.plot.AE004091.insert_site_plot.gz",
+    'checking plot file existence - Normal files, no mismatch' );
+system("gunzip -c $output_directory/test.plot.AE004091.insert_site_plot.gz > $output_directory/test.plot.unzipped");
+system("gunzip -c t/data/RunTradisTaglessSmalt/expected.plot.gz > $output_directory/expected.plot.unzipped");
+compare_ok(
+    "$output_directory/test.plot.unzipped",
+    "$output_directory/expected.plot.unzipped",
+    'checking completed pipeline file contents - Normal files, no mismatch'
+);
+
+
+
+unlink("$output_directory/test.plot.AE004091.insert_site_plot.gz");
+unlink("$output_directory/expected.plot.unzipped");
+unlink("$output_directory/test.plot.unzipped");
+
+
+
+# Test mapping stage with custom smalt parameters
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => $ref,
+        smalt            => $aligner,
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle,
+        smalt_k          => 10,
+        smalt_s          => 2
+    ),
+    'creating object with custom smalt parameters'
+);
+
+ok( $obj->_map, 'mapping with custom parameters fine' );
+
+# Check die if ref is not found
+$temp_directory_obj = File::Temp->newdir( CLEANUP => 0,
+                                          DIR => $output_directory );
+$temp_directory = $temp_directory_obj->dirname();
+ok(
+    $obj = Bio::Tradis::RunTradis->new(
+        fastqfile        => $fastqfile,
+        reference        => "not_really_a_ref.fa",
+        outfile          => $outfile,
+        output_directory => $output_directory,
+        _temp_directory  => $temp_directory,
+        _stats_handle    => $stats_handle,
+        smalt_k          => 10,
+        smalt_s          => 2
+    ),
+    'creating object with custom smalt parameters'
+);
+throws_ok {$obj->run_tradis} 'Bio::Tradis::Exception::RefNotFound', 'correct error thrown'; 
+
+rmtree($output_directory);
+done_testing();
diff --git a/t/data/Map/expected.bwa.mapped b/t/data/Map/expected.bwa.mapped
new file mode 100644
index 0000000..aced8c5
--- /dev/null
+++ b/t/data/Map/expected.bwa.mapped
@@ -0,0 +1,25 @@
+@SQ	SN:AE004091	LN:9840
+@PG	ID:bwa	PN:bwa	VN:0.7.17-r1194-dirty	CL:bwa mem -k 13 -t 4 smallref.fa test.fastq
+HS21_09876:1:1105:9650:48712#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1106:8638:38957#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1204:19746:42237#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2210:2408:11148#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2210:16541:84795#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1201:6607:66324#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2102:12312:75235#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1106:16061:54950#83	0	AE004091	7058	60	44M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF	NM:i:1	MD:Z:0T43	AS:i:43	XS:i:0
+HS21_09876:1:2101:14032:85058#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2111:11125:6617#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG	HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF	NM:i:1	MD:Z:27T14	AS:i:37	XS:i:0
+HS21_09876:1:2202:3163:76297#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2205:20175:3703#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2205:6527:34286#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:1201:10071:48582#83	0	AE004091	9265	60	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2107:20205:78513#83	0	AE004091	9269	60	6S38M	*	0	0	GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD	NM:i:0	MD:Z:38	AS:i:38	XS:i:0
+HS21_09876:1:2207:12005:97464#83	0	AE004091	9265	60	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:1208:12319:4648#83	0	AE004091	9274	60	2S42M	*	0	0	CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC	AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2209:14024:59451#83	0	AE004091	9390	60	44M	*	0	0	CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA	FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF	NM:i:2	MD:Z:0G11T31	AS:i:38	XS:i:0
+HS21_09876:2:1211:5990:82312#83	0	AE004091	3184	60	44M	*	0	0	TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC	HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE	NM:i:1	MD:Z:0G43	AS:i:43	XS:i:0
+HS21_09876:2:2103:19946:55809#83	0	AE004091	3957	60	44M	*	0	0	GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC	HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:1104:10740:37072#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:2201:4547:41892#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:2213:12056:100809#83	0	AE004091	7058	60	44M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF	NM:i:1	MD:Z:0T43	AS:i:43	XS:i:0
diff --git a/t/data/Map/expected.mapped b/t/data/Map/expected.smalt.mapped
similarity index 100%
rename from t/data/Map/expected.mapped
rename to t/data/Map/expected.smalt.mapped
diff --git a/t/data/RunTradisBWA/expected.1mm.plot.gz b/t/data/RunTradisBWA/expected.1mm.plot.gz
new file mode 100644
index 0000000..eb56f18
Binary files /dev/null and b/t/data/RunTradisBWA/expected.1mm.plot.gz differ
diff --git a/t/data/RunTradisBWA/expected.plot.gz b/t/data/RunTradisBWA/expected.plot.gz
new file mode 100644
index 0000000..bfa74e6
Binary files /dev/null and b/t/data/RunTradisBWA/expected.plot.gz differ
diff --git a/t/data/RunTradis/filelist.txt b/t/data/RunTradisBWA/filelist.txt
similarity index 100%
rename from t/data/RunTradis/filelist.txt
rename to t/data/RunTradisBWA/filelist.txt
diff --git a/t/data/RunTradis/filtered.fastq b/t/data/RunTradisBWA/filtered.fastq
similarity index 100%
rename from t/data/RunTradis/filtered.fastq
rename to t/data/RunTradisBWA/filtered.fastq
diff --git a/t/data/RunTradisBWA/mapped.sam b/t/data/RunTradisBWA/mapped.sam
new file mode 100644
index 0000000..aced8c5
--- /dev/null
+++ b/t/data/RunTradisBWA/mapped.sam
@@ -0,0 +1,25 @@
+@SQ	SN:AE004091	LN:9840
+@PG	ID:bwa	PN:bwa	VN:0.7.17-r1194-dirty	CL:bwa mem -k 13 -t 4 smallref.fa test.fastq
+HS21_09876:1:1105:9650:48712#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1106:8638:38957#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1204:19746:42237#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2210:2408:11148#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2210:16541:84795#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1201:6607:66324#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2102:12312:75235#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1106:16061:54950#83	0	AE004091	7058	60	44M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF	NM:i:1	MD:Z:0T43	AS:i:43	XS:i:0
+HS21_09876:1:2101:14032:85058#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2111:11125:6617#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG	HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF	NM:i:1	MD:Z:27T14	AS:i:37	XS:i:0
+HS21_09876:1:2202:3163:76297#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2205:20175:3703#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2205:6527:34286#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:1201:10071:48582#83	0	AE004091	9265	60	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2107:20205:78513#83	0	AE004091	9269	60	6S38M	*	0	0	GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD	NM:i:0	MD:Z:38	AS:i:38	XS:i:0
+HS21_09876:1:2207:12005:97464#83	0	AE004091	9265	60	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:1208:12319:4648#83	0	AE004091	9274	60	2S42M	*	0	0	CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC	AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2209:14024:59451#83	0	AE004091	9390	60	44M	*	0	0	CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA	FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF	NM:i:2	MD:Z:0G11T31	AS:i:38	XS:i:0
+HS21_09876:2:1211:5990:82312#83	0	AE004091	3184	60	44M	*	0	0	TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC	HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE	NM:i:1	MD:Z:0G43	AS:i:43	XS:i:0
+HS21_09876:2:2103:19946:55809#83	0	AE004091	3957	60	44M	*	0	0	GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC	HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:1104:10740:37072#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:2201:4547:41892#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:2213:12056:100809#83	0	AE004091	7058	60	44M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF	NM:i:1	MD:Z:0T43	AS:i:43	XS:i:0
diff --git a/t/data/RunTradis/notags.fastq b/t/data/RunTradisBWA/notags.fastq
similarity index 100%
rename from t/data/RunTradis/notags.fastq
rename to t/data/RunTradisBWA/notags.fastq
diff --git a/t/data/RunTradis/smallref.fa b/t/data/RunTradisBWA/smallref.fa
similarity index 100%
rename from t/data/RunTradis/smallref.fa
rename to t/data/RunTradisBWA/smallref.fa
diff --git a/t/data/RunTradis/test.tagged.fastq b/t/data/RunTradisBWA/test.tagged.fastq
similarity index 100%
rename from t/data/RunTradis/test.tagged.fastq
rename to t/data/RunTradisBWA/test.tagged.fastq
diff --git a/t/data/RunTradis/test.tagged.fastq.gz b/t/data/RunTradisBWA/test.tagged.fastq.gz
similarity index 100%
rename from t/data/RunTradis/test.tagged.fastq.gz
rename to t/data/RunTradisBWA/test.tagged.fastq.gz
diff --git a/t/data/RunTradis/test2.tagged.fastq b/t/data/RunTradisBWA/test2.tagged.fastq
similarity index 100%
rename from t/data/RunTradis/test2.tagged.fastq
rename to t/data/RunTradisBWA/test2.tagged.fastq
diff --git a/t/data/RunTradis/test2.tagged.fastq.gz b/t/data/RunTradisBWA/test2.tagged.fastq.gz
similarity index 100%
rename from t/data/RunTradis/test2.tagged.fastq.gz
rename to t/data/RunTradisBWA/test2.tagged.fastq.gz
diff --git a/t/data/RunTradis/expected.1mm.plot.gz b/t/data/RunTradisSmalt/expected.1mm.plot.gz
similarity index 100%
rename from t/data/RunTradis/expected.1mm.plot.gz
rename to t/data/RunTradisSmalt/expected.1mm.plot.gz
diff --git a/t/data/RunTradis/expected.plot.gz b/t/data/RunTradisSmalt/expected.plot.gz
similarity index 100%
rename from t/data/RunTradis/expected.plot.gz
rename to t/data/RunTradisSmalt/expected.plot.gz
diff --git a/t/data/RunTradisSmalt/filelist.txt b/t/data/RunTradisSmalt/filelist.txt
new file mode 100644
index 0000000..cc9c0cc
--- /dev/null
+++ b/t/data/RunTradisSmalt/filelist.txt
@@ -0,0 +1,2 @@
+test.tagged.fastq
+test2.tagged.fastq
diff --git a/t/data/RunTradisSmalt/filtered.fastq b/t/data/RunTradisSmalt/filtered.fastq
new file mode 100644
index 0000000..5fbeb3f
--- /dev/null
+++ b/t/data/RunTradisSmalt/filtered.fastq
@@ -0,0 +1,92 @@
+@HS21_09876:1:1105:9650:48712#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF
+@HS21_09876:1:1106:8638:38957#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+B@CFFFFFHHHHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD
+@HS21_09876:1:1204:19746:42237#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF
+@HS21_09876:1:2210:2408:11148#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHHHHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF
+@HS21_09876:1:2210:16541:84795#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BCCFFFFFHHFDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE
+@HS21_09876:1:1201:6607:66324#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BCCDFBDEHHHHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD
+@HS21_09876:1:2102:12312:75235#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BCCDFFFFHHHHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE
+@HS21_09876:1:1106:16061:54950#83
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BBBDFFFFHHFHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF
+@HS21_09876:1:2101:14032:85058#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFFFFHHHHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF
+@HS21_09876:1:2111:11125:6617#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG
++
+BCCDDDDDFHHG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF
+@HS21_09876:1:2202:3163:76297#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFDDDHHHHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF
+@HS21_09876:1:2205:20175:3703#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFFFEHHH>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE
+@HS21_09876:1:2205:6527:34286#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFFFFHHHGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF
+@HS21_09876:1:1201:10071:48582#83
+TAAGAGTCAGGCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+CCCDFFFFHHHHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE
+@HS21_09876:1:2107:20205:78513#83
+TAAGAGTCAGGCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+BCCFFFFFHHHHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD
+@HS21_09876:1:2207:12005:97464#83
+TAAGAGTCAGGCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+BCCDFFFFHHHGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D
+@HS21_09876:1:1208:12319:4648#83
+TAAGAGTCAGCAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC
++
+B=BDFFFDH>AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E
+@HS21_09876:1:2209:14024:59451#83
+TAAGAGTCAGCCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA
++
+BCCDFFFFHHFHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF
+@HS21_09876:2:1211:5990:82312#83
+TAAGAGTCAGTTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC
++
+BCCFFFFFHHHGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE
+@HS21_09876:2:2103:19946:55809#83
+TAAGAGTCAGGGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC
++
+BBCFDEFFHHHHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE
+@HS21_09876:2:1104:10740:37072#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BBBDDFFFHHHHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C
+@HS21_09876:2:2201:4547:41892#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BCCDFFFFHHGGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE
+@HS21_09876:2:2213:12056:100809#83
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BBCDDDDDHDBFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF
diff --git a/t/data/RunTradis/mapped.sam b/t/data/RunTradisSmalt/mapped.sam
similarity index 100%
rename from t/data/RunTradis/mapped.sam
rename to t/data/RunTradisSmalt/mapped.sam
diff --git a/t/data/RunTradisSmalt/notags.fastq b/t/data/RunTradisSmalt/notags.fastq
new file mode 100644
index 0000000..ed95c28
--- /dev/null
+++ b/t/data/RunTradisSmalt/notags.fastq
@@ -0,0 +1,92 @@
+@HS21_09876:1:1105:9650:48712#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF
+@HS21_09876:1:1106:8638:38957#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD
+@HS21_09876:1:1204:19746:42237#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF
+@HS21_09876:1:2210:2408:11148#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF
+@HS21_09876:1:2210:16541:84795#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE
+@HS21_09876:1:1201:6607:66324#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD
+@HS21_09876:1:2102:12312:75235#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE
+@HS21_09876:1:1106:16061:54950#83
+GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF
+@HS21_09876:1:2101:14032:85058#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF
+@HS21_09876:1:2111:11125:6617#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG
++
+HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF
+@HS21_09876:1:2202:3163:76297#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF
+@HS21_09876:1:2205:20175:3703#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE
+@HS21_09876:1:2205:6527:34286#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF
+@HS21_09876:1:1201:10071:48582#83
+GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE
+@HS21_09876:1:2107:20205:78513#83
+GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD
+@HS21_09876:1:2207:12005:97464#83
+GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D
+@HS21_09876:1:1208:12319:4648#83
+CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC
++
+AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E
+@HS21_09876:1:2209:14024:59451#83
+CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA
++
+FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF
+@HS21_09876:2:1211:5990:82312#83
+TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC
++
+HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE
+@HS21_09876:2:2103:19946:55809#83
+GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC
++
+HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE
+@HS21_09876:2:1104:10740:37072#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C
+@HS21_09876:2:2201:4547:41892#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE
+@HS21_09876:2:2213:12056:100809#83
+GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF
diff --git a/t/data/RunTradisSmalt/smallref.fa b/t/data/RunTradisSmalt/smallref.fa
new file mode 100644
index 0000000..58dcfe9
--- /dev/null
+++ b/t/data/RunTradisSmalt/smallref.fa
@@ -0,0 +1,165 @@
+>AE004091 AE004091.2 Pseudomonas aeruginosa PAO1, complete genome.
+tttaaagagaccggcgattctagtgaaatcgaacgggcaggtcaatttccaaccagcgat
+gacgtaatagatagatacaaggaagtcatttttcttttaaaggatagaaacggttaatgc
+tcttgggacggcgcttttctgtgcataactcgatgaagcccagcaattgcgtgtttctcc
+ggcaggcaaaaggttgtcgagaaccggtgtcgaggctgtttccttcctgagcgaagcctg
+gggatgaacgagatggttatccacagcggttttttccacacggctgtgcgcagggatgta
+cccccttcaaagcaagggttatccacaaagtccaggacgaccgtccgtcggcctgcctgc
+ttttattaaggtcttgatttgcttggggcctcagcgcatcggcatgtggataagtccggc
+ccgtccggctacaataggcgcttatttcgttgtgccgcctttccaatctttgggggatat
+ccgtgtccgtggaactttggcagcagtgcgtggatcttctccgcgatgagctgccgtccc
+aacaattcaacacctggatccgtcccttgcaggtcgaagccgaaggcgacgaattgcgtg
+tgtatgcacccaaccgtttcgtcctcgattgggtgaacgagaaatacctcggtcggcttc
+tggaactgctcggtgaacgcggcgagggtcagttgcccgcgctttccttattaataggca
+gcaagcgtagccgtacgccgcgcgccgccatcgtcccatcgcagacccacgtggctcccc
+cgcctccggttgctccgccgccggcgccagtgcagccggtatcggccgcgcccgtggtag
+tgccacgtgaagagctgccgccagtgacgacggctcccagcgtgtcgagcgatccctacg
+agccggaagaacccagcatcgatccgctggccgccgccatgccggctggagcagcgcctg
+cggtgcgcaccgagcgcaacgtccaggtcgaaggtgcgctgaagcacaccagctatctca
+accgtaccttcaccttcgagaacttcgtcgagggcaagtccaaccagttggcccgcgccg
+ccgcctggcaggtggcggacaacctcaagcacggctacaacccgctgttcctctacggtg
+gcgtcggtctgggcaagacccacctgatgcatgcggtgggcaaccacctgctgaagaaga
+acccgaacgccaaggtggtctacctgcattcggaacgtttcgtcgcggacatggtgaagg
+ccttgcagctcaacgccatcaacgaattcaagcgcttctaccgctcggtggacgcactgt
+tgatcgacgacatccagttcttcgcccgtaaggagcgctcccaggaggagttcttccaca
+ccttcaatgcccttctcgaaggcggccagcaggtgatcctcaccagcgaccgctatccga
+aggaaatcgaaggcctggaagagcggctgaaatcccgcttcggctggggcctgacggtgg
+ccgtcgagccgccggaactggaaacccgggtggcgatcctgatgaagaaggccgagcagg
+cgaagatcgagctgccgcacgatgcggccttcttcatcgcccagcgcatccgttccaacg
+tgcgtgaactggaaggtgcgctgaagcgggtgatcgcccactcgcacttcatgggccggc
+cgatcaccatcgagctgattcgcgagtcgctgaaggacctgttggcccttcaggacaagc
+tggtcagcatcgacaacatccagcgcaccgtcgccgagtactacaagatcaagatatccg
+atctgttgtccaagcggcgttcgcgctcggtggcgcgcccgcgccaggtggccatggcgc
+tctccaaggagctgaccaaccacagcctgccggagatcggcgtggccttcggcggtcggg
+atcacaccacggtgttgcacgcctgtcgtaagatcgctcaacttagggaatccgacgcgg
+atatccgcgaggactacaagaacctgctgcgtaccctgacaacctgacgcagcccacgag
+gcaagggactagaccatgcatttcaccattcaacgcgaagccctgttgaaaccgctgcaa
+ctggtcgccggcgtcgtggaacgccgccagacattgccggttctctccaacgtcctgctg
+gtggtcgaaggccagcaactgtcgctgaccggcaccgacctcgaagtcgagctggttggt
+cgcgtggtactggaagatgccgccgaacccggcgagatcaccgtaccggcgcgcaagctg
+atggacatctgcaagagcctgccgaacgacgtgctgatcgacatccgtgtcgaagagcag
+aaacttctggtgaaggccgggcgtagccgcttcaccctgtccaccctgccggccaacgat
+ttccccaccgtagaggaaggtcccggctcgctgaacttcagcattgcccagagcaagctg
+cgtcgcctgatcgaccgcaccagcttcgccatggcccagcaggacgtgcgttactacctc
+aacggcatgctgctggaagtgaacggcggcaccctgcgctccgtcgccaccgacggccac
+cgactggccatgtgctcgctggatgcgcagatcccgtcgcaggaccgccaccaggtgatc
+gtgccgcgcaaaggcatcctcgaactggctcgtctgctcaccgagcaggacggcgaagtc
+ggcatcgtcctgggccagcaccatatccgtgccaccactggcgaattcaccttcacttcg
+aagctggtggacggcaagttcccggactacgagcgtgtactgccgcgcggtggcgacaag
+ctggtggtcggtgaccgccagcaactgcgcgaagccttcagccgtaccgcgatcctctcc
+aacgagaagtaccgcggcattcgcctgcagctttccaacggtttgctgaaaatccaggcg
+aacaacccggagcaggaagaggccgaggaagaagtgcaggtcgagtacaacggcggcaac
+ctggagataggcttcaacgtcagttacctgctcgacgtgctgggtgtgatcggtaccgag
+caggtccgcttcatcctttccgattccaacagcagcgccctggtccacgaggccgacaat
+gacgattctgcctatgtcgtcatgccgatgcgcctctaaacatactgaatgtccctgacc
+cgcgtttcggtcaccgcggtgcgcaacctgcacccggtgaccctctccccctccccccgc
+atcaacatcctctacggcgacaacggcagcggcaagaccagcgtgctcgaagccatccac
+ctgctgggcctggcgcgttcattccgcagtgcgcgcttgcagccggtgatccagtatgag
+gaagcggcctgcaccgtattcggccaggtgatgttggccaacggcatcgccagcaacctg
+gggatttcccgtgagcgccagggcgagttcaccatccgcatcgatgggcagaacgcccgg
+agtgcggctcaattggcggaaactctcccactgcaactgatcaacccggacagctttcgg
+ttgctcgagggagcgccgaagatccggcgacagttcctcgattggggagtgttccacgtg
+gaacctcggtttctgcccgtctggcagcgcctgcagaaggcgctgcgccagcggaactcc
+tggctccggcatggtaaactggaccccgcgtcgcaagcggcctgggaccgggaattgagc
+ctggccagcgatgagatcgatgcctaccgcagaagctatatccaggcgttgaaaccggta
+ttcgaggaaacactcgccgaattggtttcactggatgacctgacccttagctactaccga
+ggctgggacaaggaccgggacctcctggaggttctggcttccagcctgttgcgcgaccag
+cagatgggccacacccaggcgggaccgcagcgtgcggatcttcgcatacggttggcaggt
+cataacgccgcggagattctctcgcgcggtcagcagaagctggtggtatgcgccctgcgc
+atcgcccaaggccatctgatcaatcgcgccaagcgcggacagtgcgtctacctggtggac
+gacctgccctcggaactggatgagcagcatcgaatggctctttgccgcttgcttgaagat
+ttgggttgccaggtattcatcacctgcgtggacccgcaactattgaaagacggctggcgc
+acggatacgccggtatccatgttccacgtggaacatggaaaagtctctcagaccacgacc
+atcgggagtgaagcatgagcgagaacaacacgtacgactcttccagcatcaaggtgctga
+aggggctggatgccgtacgcaagcgccccggcatgtacatcggcgacaccgacgatggca
+ccggtctgcaccacatggtgttcgaggtggtggataactccatcgacgaagcgctggccg
+gttactgcagcgaaatcagcatcaccatccatacggatgagtcgatcactgtccgcgaca
+atggacgcggtattccggtggatatccacaaggaagaaggggtttctgcggcggaagtga
+tcatgaccgtcctccacgccggcggcaagttcgacgacaacacctacaaggtgtccggcg
+gcttgcacggtgtgggcgtctcggtggtgaacgcgctgtcccatgaactacgcctgacca
+tccgtcgccacaacaaggtctgggaacaggtctaccaccacggcgttccgcagttcccac
+tgcgcgaagtgggcgagaccgatggctccggcaccgaagttcacttcaagccgtccccgg
+agaccttcagcaacatccacttcagttgggacatcctggccaagcgcatccgcgagctgt
+ccttcctcaactccggcgtcggcatcctgctgcgcgacgagcgtaccggcaaggaggagc
+tgttcaagtacgaaggcggtctgaaggccttcgtcgagtacctgaacaccaacaagaccg
+cggtgaacgaggtattccacttcaacgtccagcgtgaagaggacggcgtgggtgtggaag
+tcgccttgcagtggaacgacagcttcaacgagaacctgctctgcttcaccaacaacatcc
+cgcagcgtgacggcggcacccacctggccggtttccgttcggcgctgacgcgtaacctga
+acaactacatcgaggccgaaggcctggcgaagaagttcaagatcgccaccaccggcgacg
+atgcccgcgaaggcctcaccgcgatcatctcggtgaaggtaccggacccgaagttcagct
+cgcagaccaaggacaagctggtctcctccgaggtgaagactgcggtggaacaggagatgg
+gcaagtacttcgccgacttcctgctggagaatcccaacgaagccaaggccgtggtcggca
+agatgatcgacgccgcccgtgcccgcgaggccgcgcgcaaggcgcgcgagatgacccgcc
+gcaagggcgcgctggacatcgccggcctgcccggcaaactggccgattgccaggaaaagg
+acccggcgctctccgaactgtacatcgtggagggtgactccgcgggcggttccgccaagc
+agggccgcaatcgccggacccaggcgatcctgccgctcaagggcaagatcctcaacgtcg
+aaaaggcgcgcttcgacaagatgctctcctcccaggaggtcggtacgctgatcaccgccc
+tgggctgtggcatcggccgcgaggaatacaacatcgacaagctgcgctaccacaacatca
+tcatcatgaccgatgctgacgtcgacggttcgcacatccgcaccctgctgttgaccttct
+tcttccgccagatgcccgagctgatcgagcgtggctacatctacatcgcccagcccccgt
+tgtacaaggtcaagcgcggcaagcaggagcagtacatcaaggacgaccaggccatggaag
+agtacatgacccagtcggccctggaagacgccagcctgcacgtcaacgagcacgctccgg
+gcctgtccggggcggcgctggagaaactggtcaacgagtatcgcggggtgatcgccaccc
+tcaagcgcctgtcgcgcctgtacccccaggagctgaccgagcacttcatctacctgccta
+ccgtgtcggtggacgacctggctaacgagtcggccatgcagggctggttggagaagttcc
+aggcgcgcctgaccgccgccgagaagtccggcctgacctacaaggccagcctgcgcgaag
+accgcgagcgccacctgtggctgcccgaggtggaactggtggcccacggcctgtccagct
+acgtcaccttcaaccgtgacttcttcgccagcaatgactaccgctcggtgtcgctgctcg
+gcgaccagctgaacagcctgctggaagacggcgcctacgtgcagaagggtgagcgcaagc
+gcccgatcagcgccttcaaggacggcctggactggctgatggccgaaggtaccaagcgcc
+acagcatccagcgatacaaggggctgggcgagatgaaccctgagcagctgtgggaaacca
+ccatggatccgaacgtccggcgcatgctcaaggtgaccatcgaggatgccatcgccgccg
+accagatcttcaacaccctgatgggcgatgccgtggagccgcgccgcgacttcatcgaaa
+gcaacgcgctggcggtgtcgaacctggacgtgtgacaggtcggcagaccgaccctcatgg
+aaaccccggcctggcgccggggttttctttttgcgccaggtagcctggatacgggcgcca
+ggggtgccttgccaaggtgtggccgagccccggttactcgccggcattggcaccctggac
+ccgggcctcctggcggcgtggcaccgcttctgtgggcagcggtcgccggtcggttcggtc
+gatcgttgccagccggccttgctttgcgcctcgcgtgaaaacaagaagccccgctatggc
+ggggcttcttttatcgaatcggcgcacagtacgccttgcagggggctttgcggcccttca
+cgagaccaccgacggctccggatggctgacccgctgctggatggggctgatctcggccat
+ggtctcgctgacccaggcttcggcgcgctggtttagctcggcgatggcgcgcgggccttc
+gccttcggcgtgcatggccgggccgatcaccacctggatggtgcccgggtacttggccca
+gccggccttgggccaatactgcccggcgttgtgggcgatcggcagtaccggtagcccggc
+gttgaccgccagggcggtgccgccgcgggagaacttgcccatctgccccaccggaatacg
+cgtgccttccgggaagatcagcacccaggcgcctttcttcaggcactcgtcgccctgctt
+ggccagttgcttgagggccagcttgggctggctgcggtcgatggcgatgggcttgagcag
+ggccagggcccagccgaagaacggcacgtagagcagctcgcgcttgagtacctggctgag
+tggctcgaagaagccggagaggaagaaggtttcccaggtgctctggtgcttggagaggat
+cacgcagggcttttccgggatgttctccagtccgcgcacctcgtagcggatgccggcgac
+cacgcgggtcagccagatcgcgaagcggcaccagttctgtaccacgaagcggtagcgggc
+gcggaacggcaggatcggcgcgatgaagaagctgagggtgccccagacgaacgcgctggc
+ggacagcagcaggtaaaagaggacggttctgatggcctgcactgtcgacatgtattctga
+ccttactgaagtaatgcgctggcgactgccgccagatcgtcgaatatcagggtgccctct
+ggcaagggcttgcccagcgtacgtacaccttttccggtctttaccaataccggctgacaa
+tcgacggcccgcgccgcctccaggtcaccgatgctgtcgccgacgaaccagatacccgac
+agatcgaccccgtagtgctcgccgatctgccgcagcatacccggcttcggcttgcggcag
+tcgcaaccgtcgtccggtccatgcggacaatagacgatgaggccgacctcgccgccctgc
+tccgcgaccagttcgcgcaagcgcgcatgcatggcctcgagcactgccaggtcgtaatag
+ccacgggcgatgccggactggttggtagccaccgcgacggtccagccggcctggctcagg
+cgggcgatggcctcgatcgagctggggatggggatccactcgtcgagggtcttgatgtaa
+tcgtcggagtcgaggttgatgactccatcgcggtcgagaatcagcagggaacgggacatc
+gatgcgcagttggccatgaacggaaaggatcgattctacctcagccagccggagcatcgc
+ggatggatcgacgagccccctacgctggacaatctgtactagattcaataatggcaatgg
+aatggcaatcccaggccagggagtcatttggcacgcagcagtgggtgtctcggagtacgt
+gcgaaccccttggcgggtggatcaccggagtaacgcagtaagcgcctatcgcatgccagc
+acggccgaccggccgtgtttccaccacaggtggagcgggcgtgacgacggggagttccgg
+ggcgtctgcccgttcccaaggacggtaaccgtgaaacgcctgaaaaagacactgcacctt
+tcaagcttgtccctcgcttccctggctctttcttccgccgccctggcggccgctccggtc
+atgctcgaccagggcaaggaatggaccgaaagccaccgccaggacttctacagccgcgac
+cagggctcgcaggtgatgcccctgccctggctcaaggcgttgcgacagccggatggaacg
+cctttcctcgccgacagcctggcccgctacggctatttgcccaaccccaaggcgcccgcg
+gaaggcctgccggtgggcttcaccgtagccggcacgggcgcccggcagatggtcggcatg
+acctgttcggcctgccatacccggcagatcgaggtgaagggcactgcctatcggatcgac
+ggcggtccggcgatcgtcgacttccaggcattcctcgccgacctcgatcgggccgtggga
+ccgctgaccagcgatgacgccgccttcgacgccttcgccaagccgatcctcggggccaat
+ccgcctcccggtgcgcgcgacgctctgctcgcggcggtgaaggaatggtacgagccctat
+cacacgctgatcgagcgcgcgctgcccaaggacacctggggaccggcgcggctggacgcg
+gtatcgatgatcttcaaccgccttaccgggctggatatcggcaccgcgccgccctacctg
+attcccgacaacatcaaggcggccgatgcgccggtgcgctatccgttcctgtggaacgcg
+gcgcggcagaacaagacccagtggcccggcttcgccgccaacggcaacgacctgctcggc
+ctggcgcgcaatgtcggcgaggtctacggggtgttcgccaccttccacccgcagaagagc
+aagttccacctgctgggcatggactacctgaagatcaactcggccaacttccacgggctg
+ggcaagctggaagacctgatcaagaagatcggcccgccgaagtggccctgggcggtggac
+aagcacctggccaggaaaggcgcgctgatcttcgcccgcaagaccgacgaaggtggctgc
+gtggagtgccacggcatccggatcaaggacctggtgctttgggacactccgctgagggac
+gtcggcagcgacagccgccagcacgccatcctcgatggccaggtgcagaccggcgtgatg
diff --git a/t/data/RunTradisSmalt/test.tagged.fastq b/t/data/RunTradisSmalt/test.tagged.fastq
new file mode 100644
index 0000000..036f778
--- /dev/null
+++ b/t/data/RunTradisSmalt/test.tagged.fastq
@@ -0,0 +1,112 @@
+@HS21_09876:1:1105:9650:48712#84
+TAAGATTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF
+@HS21_09876:1:1106:8638:38957#84
+TGAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+B@CFFFFFHHHHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD
+@HS21_09876:1:1105:9650:48712#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF
+@HS21_09876:1:1106:8638:38957#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+B@CFFFFFHHHHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD
+@HS21_09876:1:1204:19746:42237#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF
+@HS21_09876:1:2210:2408:11148#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHHHHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF
+@HS21_09876:1:2210:16541:84795#83
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BCCFFFFFHHFDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE
+@HS21_09876:1:1201:6607:66324#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BCCDFBDEHHHHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD
+@HS21_09876:1:2102:12312:75235#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BCCDFFFFHHHHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE
+@HS21_09876:1:1106:16061:54950#83
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BBBDFFFFHHFHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF
+@HS21_09876:1:2101:14032:85058#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFFFFHHHHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF
+@HS21_09876:1:2111:11125:6617#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG
++
+BCCDDDDDFHHG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF
+@HS21_09876:1:2202:3163:76297#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFDDDHHHHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF
+@HS21_09876:1:2205:20175:3703#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFFFEHHH>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE
+@HS21_09876:1:2205:6527:34286#83
+TAAGAGTCAGGAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+BCCDFFFFHHHGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF
+@HS21_09876:1:1201:10071:48582#83
+TAAGAGTCAGGCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+CCCDFFFFHHHHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE
+@HS21_09876:1:2107:20205:78513#83
+TAAGAGTCAGGCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+BCCFFFFFHHHHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD
+@HS21_09876:1:2207:12005:97464#83
+TAAGAGTCAGGCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+BCCDFFFFHHHGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D
+@HS21_09876:1:1208:12319:4648#83
+TAAGAGTCAGCAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC
++
+B=BDFFFDH>AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E
+@HS21_09876:1:2209:14024:59451#83
+TAAGAGTCAGCCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA
++
+BCCDFFFFHHFHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF
+@HS21_09876:2:1211:5990:82312#83
+TAAGAGTCAGTTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC
++
+BCCFFFFFHHHGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE
+@HS21_09876:2:2103:19946:55809#83
+TAAGAGTCAGGGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC
++
+BBCFDEFFHHHHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE
+@HS21_09876:2:1104:10740:37072#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BBBDDFFFHHHHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C
+@HS21_09876:2:2201:4547:41892#83
+TAAGAGTCAGCCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+BCCDFFFFHHGGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE
+@HS21_09876:2:2213:12056:100809#83
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BBCDDDDDHDBFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF
+@HS21_09876:1:1115:10349:43433#83
+TTTTCGACAACCTTTTGCCTGCCGGAGAAACACGCAGTTGCTACCNNACNCTNN
++
+8,(,*A<A2;DGE4B>HGFEDDCFG8CE=FF8BB7ED?FEEE522!!<2!:0!!
+@HS21_09876:1:1211:4356:84410#83
+TTCTCGACAACCTTTTGCCTGCCGGAGAAACACGCAGTTGCTACCTGACTCTTA
++
+>E52EHFGFFGGFFFGHGHEEEGFGEGFGFGFGCGGFGFGFDHHHHFFFFFCCC
+@HS21_09876:1:1101:19209:27276#83
+CGCACAGCCGTGTGGAAAAAACCGCTGTGGATAACCATCTCGGCCTGACTCTTA
++
+CEF4GHFDFFEEIFECHFGEFFGFEFGFGFFFGDHGHGFEFFHHHHFFFFFCCC
diff --git a/t/data/RunTradisSmalt/test.tagged.fastq.gz b/t/data/RunTradisSmalt/test.tagged.fastq.gz
new file mode 100644
index 0000000..d4b5f3f
Binary files /dev/null and b/t/data/RunTradisSmalt/test.tagged.fastq.gz differ
diff --git a/t/data/RunTradisSmalt/test2.tagged.fastq b/t/data/RunTradisSmalt/test2.tagged.fastq
new file mode 100644
index 0000000..598b411
--- /dev/null
+++ b/t/data/RunTradisSmalt/test2.tagged.fastq
@@ -0,0 +1,452 @@
+@HS21_09876:1:1207:4978:63940#75
+TAAGAGTCAGGGGATAGAAACGGTTAATGCTCTTGGGACGGCGCTTTTCTGTGC
++
+CCCFFFFFHHGHC7E4EEFGFFGGFFFCEG@EHGFFEGFEGFFEGEHFFGFGFE
+@HS21_09876:1:1203:13201:16985#75
+TAAGAGTCAGCGGGTTAATGCTCTTGGGACGGCGCTTTTCTGTGCATAACTCGA
++
+BCCFFFFFGHHHCED9GEFDEFGFIFEGCEFEHGGFGGFFGFFGGEFGHGEGFF
+@HS21_09876:1:1105:14817:70208#75
+TAAGAGTCAGGCCTCTTGGGACGGCGCTTTTCTGTGCATAACTCGACGAAGCCC
++
+CCCFFFFFHHHHCEF8HHFGCFGGEFEFEGGEFFGFFGFFGFGFGEGGHGFEFE
+@HS21_09876:1:1101:1155:30938#75
+TAAGAGTCAGGTTGCATAACTCGACGAAGCCCAGCAACTGCGTGTTTCTCCGGC
++
+B=?DDDEFHCFHBDD,AEFEGDGGCFFGE>DEAHEFFFCFGFFFDEGEFGFFFE
+@HS21_09876:1:2204:6930:62477#75
+TAAGAGTCAGGGGCAAAAGGTTGTCGAGAACCGGTGTCGAGGCTGTTTCCTTCC
++
+BBCFFFFFHHHHCEF5GHFFCFDGEFBCHFFEFFGFFGFFGFFDGEEGFGFGFE
+@HS21_09876:1:2211:14592:36752#75
+TAAGAGTCAGGGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTCCCCC
++
+CCCFFFFFHFHH9BF%GGFFEFDGFFF;EFFEHGGFEGFFGFFEGDEFHGFGFE
+@HS21_09876:1:1101:1117:56616#75
+TAAGAGTCAGGGGCCTGCACCGTATTCGGCCAGGTGATGTTGGCCAACGGCATC
++
+=:=DADDDFFHHCDF8EEFGGFGEEFDGHEEEGGCFFFFFGFGFGCGGFGE@ED
+@HS21_09876:1:1106:9993:12675#75
+TAAGAGTCAGGGGCCTGCACCGTATTCGGCCAGGTGATGTTGGCCAACGGCATC
++
+BBBFFFFFHHFHCBI2DEFGGFGEFFFGHGIEHHGFFGFFGFFJGEHFFGFDFE
+@HS21_09876:1:2205:12308:83747#75
+TAAGAGTCAGGGGCCTGCACCGTATTCGGCCAGGTGATGTTGGCCAACGGCATC
++
+BCCFFFFFHHHHC@F7EEFGFFGFEFGGGFHEGEFFFGFFGFFECDEGHGFFFF
+@HS21_09876:1:2211:5325:48675#75
+TAAGAGTCAGGGGCCTGCACCGTATTCGGCCAGGTGATGTTGGCCAACGGCATC
++
+1:B4A2AD2ACF57<'GE4EEFG9@FDDGGIEE?F:=8FEGFGDGACGFGEDA:
+@HS21_09876:1:1202:13852:46659#75
+TAAGAGTCAGGGGCCAACGGCATCGCCAGCAACCTGGGGATTTCCCGTGAGCGC
++
+CCCFFFFFHHHHCEH8EEFGFFDG7FG;EFFEAHEFGGFFBFGEGEGGFGEGFF
+@HS21_09876:1:1110:4160:49896#75
+TAAGAGTCAGAAACTCTCCCACTGCAACTGATCAACCCGGACAGCTTTCGGTTG
++
+BCBFFFFDHHHHCDF8AEFGCFGHDFGCHGDEFFGFFGGFGFGFG8GGHGFFFE
+@HS21_09876:1:2205:9754:20814#75
+TAAGAGTCAGAAACTCTCCCACTGCAACTGATCAACCCGGACAGCTTTCGGTTG
++
+BBCFDEFEHHHHCEE4EIFGGFAFEFGGHFFEGEFFGGFEGFFFGEFEHGFEFF
+@HS21_09876:1:1104:13063:60859#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHH>0@F,GEFE3CHEEFDC2FEEAG?FCEFED=F8CEEEH;;EDE
+@HS21_09876:1:1107:8692:25384#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+@@CFFFFFHHHHA@E7EIFEEFGE-<FF>F@EHDCFF8G>GFFBGCCCHGF:AD
+@HS21_09876:1:1109:11137:7630#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BCCFFFFFHHGHCBF8EEFDEFGEEFGG>GFEGGCFFGGFGFFEGGFFHGFEFF
+@HS21_09876:1:1110:7663:40978#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BB@=DADDHDFH?7D9EGFFEFGFEFF;>FDED?FFEGGEGFGFACFFFGFFFE
+@HS21_09876:1:1201:5332:2719#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BCCFFFFFHHHHADF4EHFEEFGFEFEGCG@EEFCFFGFFGFGFGEEGHGFFFD
+@HS21_09876:1:1204:12364:36595#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCBD2EGFF<FGEIFFD>FFEDFEFFGFFGFGEGEGEHGFGFF
+@HS21_09876:1:2102:4320:20528#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBBFFFDDFFHHCEF2EEFGCFGEEGED>G@EEGEFGGGEGFGEBCEGHGFEED
+@HS21_09876:1:2102:17907:93005#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHCEE5EEFFEFGEEFEGFEEEDFCFGGFFGFFGGGFGHGFEFF
+@HS21_09876:1:2104:19430:56353#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCDFFFEHHHHCBH5FGFEEFGEDEFG>EHEEEEFFGGEGFFEGDGGFGFGFE
+@HS21_09876:1:2106:8768:77924#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHHHHCBE7EGFFEFG87CEDFEFEFHCFFGFFGFFEGEGEHGFEDF
+@HS21_09876:1:2109:3560:75405#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+B@@DFDDFHHHHCBD,FGFE<FGEIEEG>FIEGGFFGGGFGFFEGEFGFGFEFD
+@HS21_09876:1:2201:7109:15683#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHHHHCBF5GHFECFGEFFEGEGEEEFFFEGFFGFFGGGEFHGFEFF
+@HS21_09876:1:2204:5779:59154#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFEHHHHCEF7EEFF<DGHIEFD>E@EHGFFFGGEGFFDCEEGHGEFFE
+@HS21_09876:1:2210:14908:13619#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHFHHC7H,EEFG<FGC7CDD>DEEAFGF=GA>GFG8GCGGHGFDFD
+@HS21_09876:1:2210:1263:58662#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBBFFFFFHHHGBBH4HE?FE@GC7GFDFEDEAHCFFG;>GFGFG8EEHGF@DD
+@HS21_09876:1:2211:14421:77160#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHFFF;EE-HEFFCFGCDFGDFFHEDFFFGGFEGFGEGEGGHGFGEF
+@HS21_09876:1:1107:18833:61679#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+CCCFFFFFHHHH87E,G24E<9<F@<F;2>IE-FGFFG/1GFFFGEGE=;FGFC
+@HS21_09876:1:1201:13166:59616#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BCCFFFFFHHHHCDF5GEFFEFEFEFFDEGGEHGEFEEFFGFGFGDEGHGFGFD
+@HS21_09876:1:1205:1312:68078#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+B@@FFFFFHHHHCDE,GEFCEFEFEFDGCGFEGGGFFEFEGFFEGECEHGFFFE
+@HS21_09876:1:2101:9743:73722#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BCCFFFFFHHHHCDF7EEFFEFGFEFBDFEHEEFGFFFFFGFGFGEEEFGFEFE
+@HS21_09876:1:2112:4406:21609#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BBCDFFFFHHHD-<<+8=F<EADG7FFBEGFEEFG9F4FEGF?FGGEEHGFEEE
+@HS21_09876:1:2207:15792:48961#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BCCFFFFFHHHGCEF,AGFCCFDEEFD;CGIEAECFF8GFGFF8GEGGFGFEFE
+@HS21_09876:1:1102:3356:32350#75
+TAAGAGTCAGGGGACATCGATGCGCAGTTGGCCATGAACGGAAAGGATCGATTC
++
+CCCFFFFFHHHHC@F8EHFEEFGEIFDDEGGEGGFFFGFFGFFEGEFGHGFEFE
+@HS21_09876:1:1108:19283:13217#75
+TAAGAGTCAGGGGACATCGATGCGCAGTTGGCCATGAACGGAAAGGATCGATTC
++
+B@CBDDBDHHHH8BF2EHFF<FGHFFDCGFFEGEGFEGFFGFFDGDGFHGFDFD
+@HS21_09876:1:1201:19929:5101#75
+TAAGAGTCAGCCCCCTACGCTGGACAATCTGTACTAGATTCAATAATGGCAATG
++
+BCCDFFFFHHHHCEH7GHFFFFGGEFGFFFFEDHGFGGFEGFFGGEGFHGFDFF
+@HS21_09876:1:2105:4638:75190#75
+TAAGAGTCAGCCCCCTACGCTGGACAATCTGTACTAGATTCAATAATGGCAATG
++
+BBCDFFFFHCFHCEH7GEFGFFGEEFDEFFFEGHGFGGFFGFGDGEGFHGFEFE
+@HS21_09876:1:2207:17913:29384#75
+TAAGAGTCAGCCCCCTACGCTGGACAATCTGTACTAGATTCAATAATGGCAATG
++
+BCCDFFFFHHHHCDH9EHFGGFGHDFGDHGEEHGGFGGGFGFFEGEGFHGDEFF
+@HS21_09876:1:2112:7251:38022#75
+TAAGAGTCAGTTTCCCAAGGACGGTAACCGTGAAACGCCTGAAAAAGACACTGC
++
+BBCFFFFDFFHF-7())EF=F8GE+EE2FF5+EEF7=/AF=F/FGDCE=G;@AD
+@HS21_09876:1:1104:16812:95781#75
+TAAGAGTCAGGGGGCAAGGAATGGACCGAAAGCCACCGCCAGGACTTCTACAGC
++
+BCBFFFFFHHHHCDH%GEFGGCGEEFFGHGGEDFGFFGFFGFGFGCFGFGFGFD
+@HS21_09876:1:2107:10172:88839#75
+TAAGAGTCAGGGGCAAGGAATGGACCGAAAGCCACCGCCAGGACTTCTACAGCC
++
+CCCFFFFFHHHHCBE-GIFEE@GECFFDHEIEFHGFFGGFAFGEGDFFHGFDFF
+@HS21_09876:1:2101:13178:6874#75
+TAAGAGTCAGGGGTGATGCCCCTGCCCTGGCTCAAGGCGTTGCGACAGCCGGAT
++
+BCCDFFFFHA?FC7<7E2FDFF<EDFFEEEF>HEGFGGFEGFE?GDGG=GDFBE
+@HS21_09876:1:2207:5093:25809#75
+TAAGAGTCAGCCCCCTGCCCTGGCTCAAGGCGTTGCGACAGCCGGATGGAACGC
++
+BBCDDEFDHHFFCBF,FEFECFGFFFF;HGGEFFEFEGFFGFGDGEGGHGFFBE
+@HS21_09876:1:1105:3593:46102#75
+TAAGAGTCAGGGGCTCAAGGCGTTGCGACAGCCGGATGGAACGCCTTTCCTCGC
++
+CCCFFFFFHHHHCDE4EGFGECGFEFFEGFEEGFEFEGGEGFFJGFFGHGFGFF
+@HS21_09876:1:1214:11162:39342#75
+TAAGAGTCAGGGGCTCAAGGCGTTGCGACAGCCGGATGGAACGCCTTTCCTCGC
++
+BCCDDFFFHHHHCB<&3GFEFFGGEFFDFGDEHGECGGGFGFFFGEEGFDFEFD
+@HS21_09876:1:2103:18144:97839#75
+TAAGAGTCAGGGGCTCAAGGCGTTGCGACAGCCGGATGGAACGCCTTTCCTCGC
++
+CCCFFFFFHHGFCEE'EIFFGFDFDFECGGHEFGGFFCGFGFGDGEGEHGFEFD
+@HS21_09876:1:1109:10864:56828#75
+TAAGAGTCAGCCCGCTGACCAGCGATGACGCCGCCTTCGACGCCTTCGCCAAGC
++
+BCCDFFFFHHHFABE2EHFGCFEEE<FCHGFEHEGFEGFE=FGFGEECHGFFFE
+@HS21_09876:1:2102:16237:67170#75
+TAAGAGTCAGGGGACAAGCACCTGGCCAGGAAAGGCGCGCTGATCTTCGCCCGC
++
+B@CFFFFFHHHHCBF8GEFEGFGECFFEFEIEFEGFGGGFGFFGGEGEHGFGFD
+@HS21_09876:1:1107:14911:52768#75
+TAAGAGTCAGGGGGACACTCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCA
++
+CCCFFFFFHHA?8B<48<?<E9EEI<B;>DFEAF?FEGAD==GE98EG=G@@ED
+@HS21_09876:1:2108:6881:4925#75
+TAAGAGTCAGGGGGACACTCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCA
++
+CCCFFFEEHHHHCEE0EEFGFFGGEFDGHEFEEFGFGFGFGFGDGDEEHGDEFE
+@HS21_09876:1:1111:18499:9859#75
+TAAGAGTCAGCCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCACGCCATCC
++
+BBCFFFFFHHHHCEF0GEFDEFEFIFFGGGFEHDGFFGGFGFFEGEGFHGFGFF
+@HS21_09876:1:1210:19511:97335#75
+TAAGAGTCAGCCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCACGCCATCC
++
+CCCFFFFDHFFHCDH7HGFGGFGEIFFGHGHEFFGFFGFEGFFGGGGEHGFEFD
+@HS21_09876:1:1103:13218:78186#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+CCCFFFFFHHHHCDF7EEFDC9GEFFECEEFEHGGFGGFFGFFFGGFGFGFFFC
+@HS21_09876:1:2107:11891:7630#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+@CCFFDDDHFFHCED0GIFDEFGEEFFDEFIEEFEFFEFEGFFBGEFGFGFEFD
+@HS21_09876:1:2201:9833:67072#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+CCCFFFFFHHHHCEE5GHFDEFGHDFEDFEGEEHGFGGFFGFGFGDGGFGFEFC
+@HS21_09876:2:2101:20921:89053#75
+TAAGAGTCAGGGGATAGAAACGGTTAATGCTCTTGGGACGGCGCTTTTCTGTGC
++
+CCCFFFFFHHHHD9E0FEFEGGGFHFFHHGGFGCFGFHFFGGGFFFFFGFEEEF
+@HS21_09876:2:2205:9713:92092#75
+TAAGAGTCAGGGGATAGAAACGGTTAATGCTCTTGGGACGGCGCTTTTCTGTGC
++
+CCCFFFFFHHHGED<6?EFEDG;:EEC;=GEAG@GFF;FGGCA9F>DFDFCE@E
+@HS21_09876:2:2208:11577:65116#75
+TAAGAGTCAGGGGATAGAAACGGTTAATGCTCTTGGGACGGCGCTTTTCTGTGC
++
+BBCFFDFFDFFA@AE3F3@D:GGFD:FHD>=FGFGD<A>1GDAGF?<FG?EBFC
+@HS21_09876:2:2210:17556:49545#75
+TAAGAGTCAGGGGATAGAAACGGTTAATGCTCTTGGGACGGCGCTTTTCTGTGC
++
+B@BFFFFFHHHHF9E1FDGEE=GDDEFAH>FEGGDEFGFFGDG9FF<FEFH:FB
+@HS21_09876:2:1203:11706:53883#75
+TAAGAGTCAGGGGCAAAAGGTTGTCGAGAACCGGTGTCGAGGCTGTTTCCTTCC
++
+B@CFFFFFHHHHEDE,FFFEGG;:HEFDHGG6GC=>FFFCG;AFFFFFGFEF9E
+@HS21_09876:2:2103:7357:48165#75
+TAAGAGTCAGCCCATCCACCTGCTGGGCCTGGCGCGTTCATTCCGCAGTGCGCG
++
+CCCFFFFFHHHHDEE3GEDFGGGFEGGFHGFFGGGEFHFFGGGFFFFFDFHFEF
+@HS21_09876:2:1102:4592:99056#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHHHHDDE,FFGFFGGF-GIFCFGFGHDDFGFFGGEFFFFFEFFFED
+@HS21_09876:2:1105:18701:63246#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BBCFFFFFHHHHFDE3FFFEFGGDDFFFDEHEGHGFFFFF>GFFFFFFGFEFED
+@HS21_09876:2:1107:9181:47786#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHFHHEDE1FFF4GGGEEFGFFGFHGHGFFHFFGEGFFFEFEFEFCE
+@HS21_09876:2:2101:7072:68459#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHDEE3FFFFDGGF7EFHAFFGGFGEFHFFGGGFFFFFGFHFFD
+@HS21_09876:2:2104:11024:92879#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFFHHHHDDE7FFDG:GGDEEFF=GGFAHFFFFFGGEEFFFFFGFEFEF
+@HS21_09876:2:2106:9334:51625#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BB@FBDADFHHFEA<1FFG::=GFH0=;1>=FA@D>FAF<>;A9FFFFG?=B9E
+@HS21_09876:2:2107:14640:85151#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+BB@BDDFFHHFHFEE,FIDFDGGDFFGF=GHGGHFFFHFHGEGFFF@FGEEEDD
+@HS21_09876:2:2201:18727:56295#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+B=BDFFFFHHD>EAE3GDFCD=GEEDGH1>C6GGD>FG3FGHEFFF0F7EEDDC
+@HS21_09876:2:2203:20492:60041#75
+TAAGAGTCAGGGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+CCCFFFFEHFFFCEE'FFFFDGGEEGGFAFFFGHGDFHFFGHGFFFFFGEEEEF
+@HS21_09876:2:1102:1602:23426#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BBCFFFFFHHFHDAE6FFDEGGGDC:FDHEGHA@GGFGFFGEGFFFFFGEFBFE
+@HS21_09876:2:1104:6936:48990#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+CCCFFFFFHHHHDEE,FFFEGGGDF:F;HFGFGFGEFGFFGGEGFFFFGFFFEF
+@HS21_09876:2:2101:9813:71457#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BCCDFFFFHHHHEEE3FIDEGGGDEDFAHGGGGGGGFFFFGHEFFFFFEFHDEF
+@HS21_09876:2:2201:13960:2115#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BCCFFFFFHHHHFEE4FFGEGGGDFAGDHGHGGGGFFGFFGEDFFFFFDFHDED
+@HS21_09876:2:2202:14819:44089#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+CCCFFFFFHHHHD9E4GFFFIGGDF:GDHGGGGHGFFFFFGEEGFFFFEFEEEG
+@HS21_09876:2:2203:10287:44498#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BCCFFFFFHHHHDEE6GIFEGGGDDDGHHGGFGFGFFFFEGFFGFFFFGFEEEF
+@HS21_09876:2:2206:9622:55348#75
+TAAGAGTCAGGGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BBCFFFFFHHHHDDE,FFFEGGGDFAGHHGGFGHFDFFFFGGDFFFFFDEHEEE
+@HS21_09876:2:1101:1182:4708#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BBBFFFFFHHGHF=E6EFFEEGGGFDGGEGFAGFGFFCFFGHEFFFEFFGFEED
+@HS21_09876:2:2207:16105:64688#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BCCFFFFFHHHHFEE1FFDDDGBFEGCFAFFEGHDEFCFEGDF9F;<FDFHF@F
+@HS21_09876:2:2208:6290:56164#75
+TAAGAGTCAGGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTCGGCGC
++
+BCCFFFFFHHHHFEE7FEFDEGCFFGFHHEFHGFGGFAFFGGGGFF@FGEEFCG
+@HS21_09876:2:1103:10943:7841#75
+TAAGAGTCAGGGGACATCGATGCGCAGTTGGCCATGAACGGAAAGGATCGATTC
++
+BCBFFFFFHHHHFDE8FFFFDGGFEECFHGHFGFFDFFFFGGFFFFFFGFEDEF
+@HS21_09876:2:2105:16580:94645#75
+TAAGAGTCAGGGGACATCGATGCGCAGTTGGCCATGAACGGAAAGGATCGATTC
++
+CCCDFFFFHHHGEDE3GEFGGGG6FGGHHFHFGFGFFGFEGFEFFFFFGFEFCG
+@HS21_09876:2:2201:10169:48549#75
+TAAGAGTCAGGGGACATCGATGCGCAGTTGGCCATGAACGGAAAGGATCGATTC
++
+CCCFFFFFHHHHFEE6GFFDEGGFHEFFHFHFGGGDFFFFGFGFFFFFGFEECC
+@HS21_09876:2:1206:3642:93629#75
+TAAGAGTCAGCCCCCTACGCTGGACAATCTGTACTAGATTCAATAATGGCAATG
++
+BCCDFFFFHHFBEA<'F>@EFGG:EEFH=FCEG3FF<;FFGHFFFFDFGECEDF
+@HS21_09876:2:1212:2848:49763#75
+TAAGAGTCAGCCCCCTACGCTGGACAATCTGTACTAGATTCAATAATGGCAATG
++
+BCCDDEFFHGGHFDE,DDEDHG;E;FG;HFGEGFGDFF3FGEGFFFFF7FFF9D
+@HS21_09876:2:2101:18079:59533#75
+TAAGAGTCAGCCCGTGAAACGCCTGAAAAAGACACTGCACCTTTCAAGCTTGTC
++
+@@@DDDDDHHA+9AB1F>G01AG:CD1H=>CEA3F3FA><G;GF</CFBEC/B8
+@HS21_09876:2:2203:9677:46062#75
+TAAGAGTCAGGAAAAAAGACACTGCACCTTTCAAGCTTGTCCCTCGTTTCCCTG
++
+BCCFFFFFHHHHFDE1FEDEGGCGHGFHHGGFGHGFFHFFGEGFFFFFGFEEED
+@HS21_09876:2:1205:13947:81320#75
+TAAGAGTCAGGGGGCAAGGAATGGACCGAAAGCCACCGCCAGGACTTCTACAGC
++
+CCCFFFFFHHHHDEE6FFGEGGGFHGGFHGGGGGGFFFFFGFGFFFFFEFEDEG
+@HS21_09876:2:1208:6932:10738#75
+TAAGAGTCAGGGGGCAAGGAATGGACCGAAAGCCACCGCCAGGACTTCTACAGC
++
+B@CDDEFFHDHHCEE7FFGEGGGEDEGFHFHEGFGGFHFFGFGEFFFFGEEFDE
+@HS21_09876:2:2106:12096:83091#75
+TAAGAGTCAGGGGGCAAGGAATGGACCGAAAGCCACCGCCAGGACTTCTACAGC
++
+BCCFFFFFHHHHDEE0GFDEIGGGEGGGHGGFGHGFFFFFGFGFFFFFDEEECE
+@HS21_09876:2:2106:9969:96661#75
+TAAGAGTCAGGGGGCAAGGAATGGACCGAAAGCCACCGCCAGGACTTCTACAGC
++
+BBBFFADDAF?D1AE6FFFGEGGEDGCDHGGAG@D>FAFEGEGFFFEFGFEEEE
+@HS21_09876:2:1111:18613:97316#75
+TAAGAGTCAGCCCCCTGCCCTGGCTCAAGGCGTTGCGACAGCCGGATGGAACGC
++
+BBCBDFFFHHHHDAE,EFFFGGGEEEGADEHFGCGDFGFFGGGFFFFFDGEFCE
+@HS21_09876:2:2112:7311:2729#75
+TAAGAGTCAGCCCCCTGCCCTGGCTCAAGGCGTTGCGACAGCCGGATGGAACGC
++
+BCCDFEFEHFFH7EE)GEGFFGGGCEI;HGGFGFGFFHFEGEG6FFDFECC76D
+@HS21_09876:2:2209:5184:70364#75
+TAAGAGTCAGCCCCCTGCCCTGGCTCAAGGCGTTGCGACAGCCGGATGGAACGC
++
+CCCFFFFFHFFHDEE7FFFGFGGGDGGHHGGFGFGDFCFFGEEGFFFFEFFFEF
+@HS21_09876:2:2206:10363:37150#75
+TAAGAGTCAGGGGGCTTCACCGTAGCCGGCACGGGCGCCCGGCAGATGGTCGGC
++
+BBBFFFFFHHHHDDE1FF@HIGGE?GGFHFEFGHGEFFFFGFGFFFFFGEEFBE
+@HS21_09876:2:1211:8018:71514#75
+TAAGAGTCAGCCCGCTGACCAGCGATGACGCCGCCTTCGACGCCTTCGCCAAGC
++
+BBCDDEDFHHGHDAE,FEDE:2;ECF=H=>GF5@G>FGFH3CGFFF@FDEEF9E
+@HS21_09876:2:2207:12305:87719#75
+TAAGAGTCAGCCCGCTGACCAGCGATGACGCCGCCTTCGACGCCTTCGCCAAGC
++
+@@CADAADFFFFFEE6FEGFGGGFEFFHHGGFGHGFFHFEGHEFFFEFGFEDEB
+@HS21_09876:2:1109:4620:60950#75
+TAAGAGTCAGAAAGCAGATCCTCGGGGCCAATCCGCCTCCCGGTGCGCGCGACG
++
+CCCFFFFFHHHHDEE4FFFEGGGHFGGFHFCFGFGEFHFFGGEGFFFFDFEFCE
+@HS21_09876:2:1108:17674:57476#75
+TAAGAGTCAGCCCTTCCACCCGCAGAAGAGCAAGTTCCACCTGCTGGGCATGGA
++
+CCCFFFFFHHHHFEE4FFDGIGGGFGGFHGGFGGGFFFFFGFFFFFFFDFHFEC
+@HS21_09876:2:1208:4027:38154#75
+TAAGAGTCAGCCCTTCCACCCGCAGAAGAGCAAGTTCCACCTGCTGGGCATGGA
++
+BCCFFFFFHHHHFEE6GFFEIGGGCGFFHGGFGGGEFGFFGFGFFFFFDFHFFE
+@HS21_09876:2:2104:21108:77778#75
+TAAGAGTCAGCCCTTCCACCCGCAGAAGAGCAAGTTCCACCTGCTGGGCATGGA
++
+CCCFFFFFHHHHDEE,EFFGFGGDEEGHHGGFGCGFFCFFGFEFFFDFGCHFE8
+@HS21_09876:2:1105:10717:93499#75
+TAAGAGTCAGGGGGACACTCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCA
++
+CCCFFFFFHHHHDEB6DFFFDG;EEFFFAGHFGFGFFAFFGEGFFFFFGCH:9F
+@HS21_09876:2:2107:17307:90872#75
+TAAGAGTCAGCCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCACGCCATCC
++
+BCCDFEFDHHFHDAE7FFFFFGGFHGGHHGFFGGGEFFFFGGEFFFFFDFHEEG
+@HS21_09876:2:2108:10562:66996#75
+TAAGAGTCAGCCCGCTGAGGGACGTCGGCAGCGACAGCCGCCAGCACGCCATCC
++
+CCCFFFFEHHFFDEE6FFDIGGGF>GFHHGFFGFGFFFFFGEGFFFFFDFFFCD
+@HS21_09876:2:1204:3124:19338#75
+TAAGAGTCAGGGGTGCAGACCGGCGTGATGGAGGGCGCGCGGATGCCGTTCGGC
++
+CCCFFFFFHHHHDAE6FFGEIGGEHDGHHGGFGFDEFFFEGEEFFFFFDEEFFF
+@HS21_09876:2:1104:8314:51088#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+CCCFFFFFHGDFFEE1GFGEFGGEDDGDH>GAGFGFFHFFGGECFFFFGFHBDC
+@HS21_09876:2:1205:9430:9196#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+BBCDFFFFHHHHDEE7FFFGDGGEHEFHHFHFGFGDFFFFGGGFFFFFDFEFCC
+@HS21_09876:2:1211:6841:16284#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+BCCFFFFFHHHHDDE1FEDEE=GEFGFHHGGEGFG>FFFCGCG@FF@FDGF@DE
+@HS21_09876:2:2101:5488:100342#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+CCCFFFDDHHHHDEE3FFGCD=GFEGFHHEGEGFFDFGFEGDEFFFFFGFEFB8
+@HS21_09876:2:2109:9412:27195#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+BCCFFFFEHGBCC@<,D>GF:CGFDGGD=GG6ACDDF@FFGDECFFFF7EEDE.
+@HS21_09876:2:2208:5757:63730#75
+TAAGAGTCAGCCCGTAGCGGTGGCCGGTTCGATCCTGCAGCACTTCGTGCCGAT
++
+BCCDDEFFHFHHFEE6FIFEEGGFEFIF=GHGGHGFFH>FGEG9FFEFDFHFEB
diff --git a/t/data/RunTradisSmalt/test2.tagged.fastq.gz b/t/data/RunTradisSmalt/test2.tagged.fastq.gz
new file mode 100644
index 0000000..0e187f2
Binary files /dev/null and b/t/data/RunTradisSmalt/test2.tagged.fastq.gz differ
diff --git a/t/data/RunTradisTaglessBWA/expected.plot.gz b/t/data/RunTradisTaglessBWA/expected.plot.gz
new file mode 100644
index 0000000..502edfa
Binary files /dev/null and b/t/data/RunTradisTaglessBWA/expected.plot.gz differ
diff --git a/t/data/RunTradisTaglessBWA/filelist.txt b/t/data/RunTradisTaglessBWA/filelist.txt
new file mode 100644
index 0000000..6b61337
--- /dev/null
+++ b/t/data/RunTradisTaglessBWA/filelist.txt
@@ -0,0 +1 @@
+notags.fastq
diff --git a/t/data/RunTradisTaglessBWA/mapped.sam b/t/data/RunTradisTaglessBWA/mapped.sam
new file mode 100644
index 0000000..aced8c5
--- /dev/null
+++ b/t/data/RunTradisTaglessBWA/mapped.sam
@@ -0,0 +1,25 @@
+@SQ	SN:AE004091	LN:9840
+@PG	ID:bwa	PN:bwa	VN:0.7.17-r1194-dirty	CL:bwa mem -k 13 -t 4 smallref.fa test.fastq
+HS21_09876:1:1105:9650:48712#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1106:8638:38957#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1204:19746:42237#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2210:2408:11148#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2210:16541:84795#83	0	AE004091	6697	60	44M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1201:6607:66324#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:2102:12312:75235#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:1:1106:16061:54950#83	0	AE004091	7058	60	44M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF	NM:i:1	MD:Z:0T43	AS:i:43	XS:i:0
+HS21_09876:1:2101:14032:85058#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2111:11125:6617#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG	HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF	NM:i:1	MD:Z:27T14	AS:i:37	XS:i:0
+HS21_09876:1:2202:3163:76297#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2205:20175:3703#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2205:6527:34286#83	0	AE004091	9250	60	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:1201:10071:48582#83	0	AE004091	9265	60	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2107:20205:78513#83	0	AE004091	9269	60	6S38M	*	0	0	GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD	NM:i:0	MD:Z:38	AS:i:38	XS:i:0
+HS21_09876:1:2207:12005:97464#83	0	AE004091	9265	60	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:1208:12319:4648#83	0	AE004091	9274	60	2S42M	*	0	0	CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC	AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E	NM:i:0	MD:Z:42	AS:i:42	XS:i:0
+HS21_09876:1:2209:14024:59451#83	0	AE004091	9390	60	44M	*	0	0	CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA	FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF	NM:i:2	MD:Z:0G11T31	AS:i:38	XS:i:0
+HS21_09876:2:1211:5990:82312#83	0	AE004091	3184	60	44M	*	0	0	TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC	HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE	NM:i:1	MD:Z:0G43	AS:i:43	XS:i:0
+HS21_09876:2:2103:19946:55809#83	0	AE004091	3957	60	44M	*	0	0	GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC	HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:1104:10740:37072#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:2201:4547:41892#83	0	AE004091	7025	60	44M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE	NM:i:1	MD:Z:0A43	AS:i:43	XS:i:0
+HS21_09876:2:2213:12056:100809#83	0	AE004091	7058	60	44M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF	NM:i:1	MD:Z:0T43	AS:i:43	XS:i:0
diff --git a/t/data/RunTradisTaglessBWA/notags.fastq b/t/data/RunTradisTaglessBWA/notags.fastq
new file mode 100644
index 0000000..ed95c28
--- /dev/null
+++ b/t/data/RunTradisTaglessBWA/notags.fastq
@@ -0,0 +1,92 @@
+@HS21_09876:1:1105:9650:48712#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF
+@HS21_09876:1:1106:8638:38957#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD
+@HS21_09876:1:1204:19746:42237#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF
+@HS21_09876:1:2210:2408:11148#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF
+@HS21_09876:1:2210:16541:84795#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE
+@HS21_09876:1:1201:6607:66324#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD
+@HS21_09876:1:2102:12312:75235#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE
+@HS21_09876:1:1106:16061:54950#83
+GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF
+@HS21_09876:1:2101:14032:85058#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF
+@HS21_09876:1:2111:11125:6617#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG
++
+HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF
+@HS21_09876:1:2202:3163:76297#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF
+@HS21_09876:1:2205:20175:3703#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE
+@HS21_09876:1:2205:6527:34286#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF
+@HS21_09876:1:1201:10071:48582#83
+GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE
+@HS21_09876:1:2107:20205:78513#83
+GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD
+@HS21_09876:1:2207:12005:97464#83
+GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D
+@HS21_09876:1:1208:12319:4648#83
+CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC
++
+AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E
+@HS21_09876:1:2209:14024:59451#83
+CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA
++
+FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF
+@HS21_09876:2:1211:5990:82312#83
+TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC
++
+HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE
+@HS21_09876:2:2103:19946:55809#83
+GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC
++
+HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE
+@HS21_09876:2:1104:10740:37072#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C
+@HS21_09876:2:2201:4547:41892#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE
+@HS21_09876:2:2213:12056:100809#83
+GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF
diff --git a/t/data/RunTradisTaglessBWA/smallref.fa b/t/data/RunTradisTaglessBWA/smallref.fa
new file mode 100644
index 0000000..58dcfe9
--- /dev/null
+++ b/t/data/RunTradisTaglessBWA/smallref.fa
@@ -0,0 +1,165 @@
+>AE004091 AE004091.2 Pseudomonas aeruginosa PAO1, complete genome.
+tttaaagagaccggcgattctagtgaaatcgaacgggcaggtcaatttccaaccagcgat
+gacgtaatagatagatacaaggaagtcatttttcttttaaaggatagaaacggttaatgc
+tcttgggacggcgcttttctgtgcataactcgatgaagcccagcaattgcgtgtttctcc
+ggcaggcaaaaggttgtcgagaaccggtgtcgaggctgtttccttcctgagcgaagcctg
+gggatgaacgagatggttatccacagcggttttttccacacggctgtgcgcagggatgta
+cccccttcaaagcaagggttatccacaaagtccaggacgaccgtccgtcggcctgcctgc
+ttttattaaggtcttgatttgcttggggcctcagcgcatcggcatgtggataagtccggc
+ccgtccggctacaataggcgcttatttcgttgtgccgcctttccaatctttgggggatat
+ccgtgtccgtggaactttggcagcagtgcgtggatcttctccgcgatgagctgccgtccc
+aacaattcaacacctggatccgtcccttgcaggtcgaagccgaaggcgacgaattgcgtg
+tgtatgcacccaaccgtttcgtcctcgattgggtgaacgagaaatacctcggtcggcttc
+tggaactgctcggtgaacgcggcgagggtcagttgcccgcgctttccttattaataggca
+gcaagcgtagccgtacgccgcgcgccgccatcgtcccatcgcagacccacgtggctcccc
+cgcctccggttgctccgccgccggcgccagtgcagccggtatcggccgcgcccgtggtag
+tgccacgtgaagagctgccgccagtgacgacggctcccagcgtgtcgagcgatccctacg
+agccggaagaacccagcatcgatccgctggccgccgccatgccggctggagcagcgcctg
+cggtgcgcaccgagcgcaacgtccaggtcgaaggtgcgctgaagcacaccagctatctca
+accgtaccttcaccttcgagaacttcgtcgagggcaagtccaaccagttggcccgcgccg
+ccgcctggcaggtggcggacaacctcaagcacggctacaacccgctgttcctctacggtg
+gcgtcggtctgggcaagacccacctgatgcatgcggtgggcaaccacctgctgaagaaga
+acccgaacgccaaggtggtctacctgcattcggaacgtttcgtcgcggacatggtgaagg
+ccttgcagctcaacgccatcaacgaattcaagcgcttctaccgctcggtggacgcactgt
+tgatcgacgacatccagttcttcgcccgtaaggagcgctcccaggaggagttcttccaca
+ccttcaatgcccttctcgaaggcggccagcaggtgatcctcaccagcgaccgctatccga
+aggaaatcgaaggcctggaagagcggctgaaatcccgcttcggctggggcctgacggtgg
+ccgtcgagccgccggaactggaaacccgggtggcgatcctgatgaagaaggccgagcagg
+cgaagatcgagctgccgcacgatgcggccttcttcatcgcccagcgcatccgttccaacg
+tgcgtgaactggaaggtgcgctgaagcgggtgatcgcccactcgcacttcatgggccggc
+cgatcaccatcgagctgattcgcgagtcgctgaaggacctgttggcccttcaggacaagc
+tggtcagcatcgacaacatccagcgcaccgtcgccgagtactacaagatcaagatatccg
+atctgttgtccaagcggcgttcgcgctcggtggcgcgcccgcgccaggtggccatggcgc
+tctccaaggagctgaccaaccacagcctgccggagatcggcgtggccttcggcggtcggg
+atcacaccacggtgttgcacgcctgtcgtaagatcgctcaacttagggaatccgacgcgg
+atatccgcgaggactacaagaacctgctgcgtaccctgacaacctgacgcagcccacgag
+gcaagggactagaccatgcatttcaccattcaacgcgaagccctgttgaaaccgctgcaa
+ctggtcgccggcgtcgtggaacgccgccagacattgccggttctctccaacgtcctgctg
+gtggtcgaaggccagcaactgtcgctgaccggcaccgacctcgaagtcgagctggttggt
+cgcgtggtactggaagatgccgccgaacccggcgagatcaccgtaccggcgcgcaagctg
+atggacatctgcaagagcctgccgaacgacgtgctgatcgacatccgtgtcgaagagcag
+aaacttctggtgaaggccgggcgtagccgcttcaccctgtccaccctgccggccaacgat
+ttccccaccgtagaggaaggtcccggctcgctgaacttcagcattgcccagagcaagctg
+cgtcgcctgatcgaccgcaccagcttcgccatggcccagcaggacgtgcgttactacctc
+aacggcatgctgctggaagtgaacggcggcaccctgcgctccgtcgccaccgacggccac
+cgactggccatgtgctcgctggatgcgcagatcccgtcgcaggaccgccaccaggtgatc
+gtgccgcgcaaaggcatcctcgaactggctcgtctgctcaccgagcaggacggcgaagtc
+ggcatcgtcctgggccagcaccatatccgtgccaccactggcgaattcaccttcacttcg
+aagctggtggacggcaagttcccggactacgagcgtgtactgccgcgcggtggcgacaag
+ctggtggtcggtgaccgccagcaactgcgcgaagccttcagccgtaccgcgatcctctcc
+aacgagaagtaccgcggcattcgcctgcagctttccaacggtttgctgaaaatccaggcg
+aacaacccggagcaggaagaggccgaggaagaagtgcaggtcgagtacaacggcggcaac
+ctggagataggcttcaacgtcagttacctgctcgacgtgctgggtgtgatcggtaccgag
+caggtccgcttcatcctttccgattccaacagcagcgccctggtccacgaggccgacaat
+gacgattctgcctatgtcgtcatgccgatgcgcctctaaacatactgaatgtccctgacc
+cgcgtttcggtcaccgcggtgcgcaacctgcacccggtgaccctctccccctccccccgc
+atcaacatcctctacggcgacaacggcagcggcaagaccagcgtgctcgaagccatccac
+ctgctgggcctggcgcgttcattccgcagtgcgcgcttgcagccggtgatccagtatgag
+gaagcggcctgcaccgtattcggccaggtgatgttggccaacggcatcgccagcaacctg
+gggatttcccgtgagcgccagggcgagttcaccatccgcatcgatgggcagaacgcccgg
+agtgcggctcaattggcggaaactctcccactgcaactgatcaacccggacagctttcgg
+ttgctcgagggagcgccgaagatccggcgacagttcctcgattggggagtgttccacgtg
+gaacctcggtttctgcccgtctggcagcgcctgcagaaggcgctgcgccagcggaactcc
+tggctccggcatggtaaactggaccccgcgtcgcaagcggcctgggaccgggaattgagc
+ctggccagcgatgagatcgatgcctaccgcagaagctatatccaggcgttgaaaccggta
+ttcgaggaaacactcgccgaattggtttcactggatgacctgacccttagctactaccga
+ggctgggacaaggaccgggacctcctggaggttctggcttccagcctgttgcgcgaccag
+cagatgggccacacccaggcgggaccgcagcgtgcggatcttcgcatacggttggcaggt
+cataacgccgcggagattctctcgcgcggtcagcagaagctggtggtatgcgccctgcgc
+atcgcccaaggccatctgatcaatcgcgccaagcgcggacagtgcgtctacctggtggac
+gacctgccctcggaactggatgagcagcatcgaatggctctttgccgcttgcttgaagat
+ttgggttgccaggtattcatcacctgcgtggacccgcaactattgaaagacggctggcgc
+acggatacgccggtatccatgttccacgtggaacatggaaaagtctctcagaccacgacc
+atcgggagtgaagcatgagcgagaacaacacgtacgactcttccagcatcaaggtgctga
+aggggctggatgccgtacgcaagcgccccggcatgtacatcggcgacaccgacgatggca
+ccggtctgcaccacatggtgttcgaggtggtggataactccatcgacgaagcgctggccg
+gttactgcagcgaaatcagcatcaccatccatacggatgagtcgatcactgtccgcgaca
+atggacgcggtattccggtggatatccacaaggaagaaggggtttctgcggcggaagtga
+tcatgaccgtcctccacgccggcggcaagttcgacgacaacacctacaaggtgtccggcg
+gcttgcacggtgtgggcgtctcggtggtgaacgcgctgtcccatgaactacgcctgacca
+tccgtcgccacaacaaggtctgggaacaggtctaccaccacggcgttccgcagttcccac
+tgcgcgaagtgggcgagaccgatggctccggcaccgaagttcacttcaagccgtccccgg
+agaccttcagcaacatccacttcagttgggacatcctggccaagcgcatccgcgagctgt
+ccttcctcaactccggcgtcggcatcctgctgcgcgacgagcgtaccggcaaggaggagc
+tgttcaagtacgaaggcggtctgaaggccttcgtcgagtacctgaacaccaacaagaccg
+cggtgaacgaggtattccacttcaacgtccagcgtgaagaggacggcgtgggtgtggaag
+tcgccttgcagtggaacgacagcttcaacgagaacctgctctgcttcaccaacaacatcc
+cgcagcgtgacggcggcacccacctggccggtttccgttcggcgctgacgcgtaacctga
+acaactacatcgaggccgaaggcctggcgaagaagttcaagatcgccaccaccggcgacg
+atgcccgcgaaggcctcaccgcgatcatctcggtgaaggtaccggacccgaagttcagct
+cgcagaccaaggacaagctggtctcctccgaggtgaagactgcggtggaacaggagatgg
+gcaagtacttcgccgacttcctgctggagaatcccaacgaagccaaggccgtggtcggca
+agatgatcgacgccgcccgtgcccgcgaggccgcgcgcaaggcgcgcgagatgacccgcc
+gcaagggcgcgctggacatcgccggcctgcccggcaaactggccgattgccaggaaaagg
+acccggcgctctccgaactgtacatcgtggagggtgactccgcgggcggttccgccaagc
+agggccgcaatcgccggacccaggcgatcctgccgctcaagggcaagatcctcaacgtcg
+aaaaggcgcgcttcgacaagatgctctcctcccaggaggtcggtacgctgatcaccgccc
+tgggctgtggcatcggccgcgaggaatacaacatcgacaagctgcgctaccacaacatca
+tcatcatgaccgatgctgacgtcgacggttcgcacatccgcaccctgctgttgaccttct
+tcttccgccagatgcccgagctgatcgagcgtggctacatctacatcgcccagcccccgt
+tgtacaaggtcaagcgcggcaagcaggagcagtacatcaaggacgaccaggccatggaag
+agtacatgacccagtcggccctggaagacgccagcctgcacgtcaacgagcacgctccgg
+gcctgtccggggcggcgctggagaaactggtcaacgagtatcgcggggtgatcgccaccc
+tcaagcgcctgtcgcgcctgtacccccaggagctgaccgagcacttcatctacctgccta
+ccgtgtcggtggacgacctggctaacgagtcggccatgcagggctggttggagaagttcc
+aggcgcgcctgaccgccgccgagaagtccggcctgacctacaaggccagcctgcgcgaag
+accgcgagcgccacctgtggctgcccgaggtggaactggtggcccacggcctgtccagct
+acgtcaccttcaaccgtgacttcttcgccagcaatgactaccgctcggtgtcgctgctcg
+gcgaccagctgaacagcctgctggaagacggcgcctacgtgcagaagggtgagcgcaagc
+gcccgatcagcgccttcaaggacggcctggactggctgatggccgaaggtaccaagcgcc
+acagcatccagcgatacaaggggctgggcgagatgaaccctgagcagctgtgggaaacca
+ccatggatccgaacgtccggcgcatgctcaaggtgaccatcgaggatgccatcgccgccg
+accagatcttcaacaccctgatgggcgatgccgtggagccgcgccgcgacttcatcgaaa
+gcaacgcgctggcggtgtcgaacctggacgtgtgacaggtcggcagaccgaccctcatgg
+aaaccccggcctggcgccggggttttctttttgcgccaggtagcctggatacgggcgcca
+ggggtgccttgccaaggtgtggccgagccccggttactcgccggcattggcaccctggac
+ccgggcctcctggcggcgtggcaccgcttctgtgggcagcggtcgccggtcggttcggtc
+gatcgttgccagccggccttgctttgcgcctcgcgtgaaaacaagaagccccgctatggc
+ggggcttcttttatcgaatcggcgcacagtacgccttgcagggggctttgcggcccttca
+cgagaccaccgacggctccggatggctgacccgctgctggatggggctgatctcggccat
+ggtctcgctgacccaggcttcggcgcgctggtttagctcggcgatggcgcgcgggccttc
+gccttcggcgtgcatggccgggccgatcaccacctggatggtgcccgggtacttggccca
+gccggccttgggccaatactgcccggcgttgtgggcgatcggcagtaccggtagcccggc
+gttgaccgccagggcggtgccgccgcgggagaacttgcccatctgccccaccggaatacg
+cgtgccttccgggaagatcagcacccaggcgcctttcttcaggcactcgtcgccctgctt
+ggccagttgcttgagggccagcttgggctggctgcggtcgatggcgatgggcttgagcag
+ggccagggcccagccgaagaacggcacgtagagcagctcgcgcttgagtacctggctgag
+tggctcgaagaagccggagaggaagaaggtttcccaggtgctctggtgcttggagaggat
+cacgcagggcttttccgggatgttctccagtccgcgcacctcgtagcggatgccggcgac
+cacgcgggtcagccagatcgcgaagcggcaccagttctgtaccacgaagcggtagcgggc
+gcggaacggcaggatcggcgcgatgaagaagctgagggtgccccagacgaacgcgctggc
+ggacagcagcaggtaaaagaggacggttctgatggcctgcactgtcgacatgtattctga
+ccttactgaagtaatgcgctggcgactgccgccagatcgtcgaatatcagggtgccctct
+ggcaagggcttgcccagcgtacgtacaccttttccggtctttaccaataccggctgacaa
+tcgacggcccgcgccgcctccaggtcaccgatgctgtcgccgacgaaccagatacccgac
+agatcgaccccgtagtgctcgccgatctgccgcagcatacccggcttcggcttgcggcag
+tcgcaaccgtcgtccggtccatgcggacaatagacgatgaggccgacctcgccgccctgc
+tccgcgaccagttcgcgcaagcgcgcatgcatggcctcgagcactgccaggtcgtaatag
+ccacgggcgatgccggactggttggtagccaccgcgacggtccagccggcctggctcagg
+cgggcgatggcctcgatcgagctggggatggggatccactcgtcgagggtcttgatgtaa
+tcgtcggagtcgaggttgatgactccatcgcggtcgagaatcagcagggaacgggacatc
+gatgcgcagttggccatgaacggaaaggatcgattctacctcagccagccggagcatcgc
+ggatggatcgacgagccccctacgctggacaatctgtactagattcaataatggcaatgg
+aatggcaatcccaggccagggagtcatttggcacgcagcagtgggtgtctcggagtacgt
+gcgaaccccttggcgggtggatcaccggagtaacgcagtaagcgcctatcgcatgccagc
+acggccgaccggccgtgtttccaccacaggtggagcgggcgtgacgacggggagttccgg
+ggcgtctgcccgttcccaaggacggtaaccgtgaaacgcctgaaaaagacactgcacctt
+tcaagcttgtccctcgcttccctggctctttcttccgccgccctggcggccgctccggtc
+atgctcgaccagggcaaggaatggaccgaaagccaccgccaggacttctacagccgcgac
+cagggctcgcaggtgatgcccctgccctggctcaaggcgttgcgacagccggatggaacg
+cctttcctcgccgacagcctggcccgctacggctatttgcccaaccccaaggcgcccgcg
+gaaggcctgccggtgggcttcaccgtagccggcacgggcgcccggcagatggtcggcatg
+acctgttcggcctgccatacccggcagatcgaggtgaagggcactgcctatcggatcgac
+ggcggtccggcgatcgtcgacttccaggcattcctcgccgacctcgatcgggccgtggga
+ccgctgaccagcgatgacgccgccttcgacgccttcgccaagccgatcctcggggccaat
+ccgcctcccggtgcgcgcgacgctctgctcgcggcggtgaaggaatggtacgagccctat
+cacacgctgatcgagcgcgcgctgcccaaggacacctggggaccggcgcggctggacgcg
+gtatcgatgatcttcaaccgccttaccgggctggatatcggcaccgcgccgccctacctg
+attcccgacaacatcaaggcggccgatgcgccggtgcgctatccgttcctgtggaacgcg
+gcgcggcagaacaagacccagtggcccggcttcgccgccaacggcaacgacctgctcggc
+ctggcgcgcaatgtcggcgaggtctacggggtgttcgccaccttccacccgcagaagagc
+aagttccacctgctgggcatggactacctgaagatcaactcggccaacttccacgggctg
+ggcaagctggaagacctgatcaagaagatcggcccgccgaagtggccctgggcggtggac
+aagcacctggccaggaaaggcgcgctgatcttcgcccgcaagaccgacgaaggtggctgc
+gtggagtgccacggcatccggatcaaggacctggtgctttgggacactccgctgagggac
+gtcggcagcgacagccgccagcacgccatcctcgatggccaggtgcagaccggcgtgatg
diff --git a/t/data/RunTradisTaglessSmalt/expected.plot.gz b/t/data/RunTradisTaglessSmalt/expected.plot.gz
new file mode 100644
index 0000000..ca5111c
Binary files /dev/null and b/t/data/RunTradisTaglessSmalt/expected.plot.gz differ
diff --git a/t/data/RunTradisTaglessSmalt/mapped.sam b/t/data/RunTradisTaglessSmalt/mapped.sam
new file mode 100644
index 0000000..527cc1f
--- /dev/null
+++ b/t/data/RunTradisTaglessSmalt/mapped.sam
@@ -0,0 +1,26 @@
+@HD	VN:1.3	SO:unknown
+@SQ	SN:AE004091	LN:9840
+@PG	ID:smalt	PN:smalt	VN:0.7.4	CL:smalt map -x -r -1 -y 0.96 ref.index /Users/cc21/Development/repos/Bio-Tradis/t/data/RunTradis/notags.fastq
+HS21_09876:1:1105:9650:48712#83	0	AE004091	6698	54	1S43M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF	NM:i:0	AS:i:43
+HS21_09876:1:1106:8638:38957#83	0	AE004091	6698	54	1S43M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD	NM:i:0	AS:i:43
+HS21_09876:1:1204:19746:42237#83	0	AE004091	6698	54	1S43M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF	NM:i:0	AS:i:43
+HS21_09876:1:2210:2408:11148#83	0	AE004091	6698	54	1S43M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF	NM:i:0	AS:i:43
+HS21_09876:1:2210:16541:84795#83	0	AE004091	6698	54	1S43M	*	0	0	GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG	FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE	NM:i:0	AS:i:43
+HS21_09876:1:1201:6607:66324#83	0	AE004091	7026	54	1S43M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD	NM:i:0	AS:i:43
+HS21_09876:1:2102:12312:75235#83	0	AE004091	7026	54	1S43M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE	NM:i:0	AS:i:43
+HS21_09876:1:1106:16061:54950#83	0	AE004091	7059	54	1S43M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF	NM:i:0	AS:i:43
+HS21_09876:1:2101:14032:85058#83	0	AE004091	9250	54	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF	NM:i:0	AS:i:42
+HS21_09876:1:2111:11125:6617#83	4	*	0	0	*	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG	HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF	NM:i:0	AS:i:0
+HS21_09876:1:2202:3163:76297#83	0	AE004091	9250	54	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF	NM:i:0	AS:i:42
+HS21_09876:1:2205:20175:3703#83	0	AE004091	9250	54	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE	NM:i:0	AS:i:42
+HS21_09876:1:2205:6527:34286#83	0	AE004091	9250	54	2S42M	*	0	0	GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG	HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF	NM:i:0	AS:i:42
+HS21_09876:1:1201:10071:48582#83	0	AE004091	9265	54	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE	NM:i:0	AS:i:42
+HS21_09876:1:2107:20205:78513#83	4	*	0	0	*	*	0	0	GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD	NM:i:0	AS:i:0
+HS21_09876:1:2207:12005:97464#83	0	AE004091	9265	54	2S42M	*	0	0	GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG	HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D	NM:i:0	AS:i:42
+HS21_09876:1:1208:12319:4648#83	0	AE004091	9274	54	2S42M	*	0	0	CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC	AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E	NM:i:0	AS:i:42
+HS21_09876:1:2209:14024:59451#83	0	AE004091	9391	54	1S43M	*	0	0	CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA	FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF	NM:i:1	AS:i:40
+HS21_09876:2:1211:5990:82312#83	0	AE004091	3185	54	1S43M	*	0	0	TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC	HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE	NM:i:0	AS:i:43
+HS21_09876:2:2103:19946:55809#83	0	AE004091	3958	54	1S43M	*	0	0	GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC	HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE	NM:i:0	AS:i:43
+HS21_09876:2:1104:10740:37072#83	0	AE004091	7026	54	1S43M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C	NM:i:0	AS:i:43
+HS21_09876:2:2201:4547:41892#83	0	AE004091	7026	54	1S43M	*	0	0	CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT	GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE	NM:i:0	AS:i:43
+HS21_09876:2:2213:12056:100809#83	0	AE004091	7059	54	1S43M	*	0	0	GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC	BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF	NM:i:0	AS:i:43
diff --git a/t/data/RunTradisTaglessSmalt/notags.fastq b/t/data/RunTradisTaglessSmalt/notags.fastq
new file mode 100644
index 0000000..ed95c28
--- /dev/null
+++ b/t/data/RunTradisTaglessSmalt/notags.fastq
@@ -0,0 +1,92 @@
+@HS21_09876:1:1105:9650:48712#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF
+@HS21_09876:1:1106:8638:38957#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD
+@HS21_09876:1:1204:19746:42237#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF
+@HS21_09876:1:2210:2408:11148#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+HHCBF,GGFF<FEHFFEGFGFEEEGFGGGFGFFFGGGFHGFEFF
+@HS21_09876:1:2210:16541:84795#83
+GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG
++
+FDB@F%GEFDCFGHE<FD>GEEEGFFGGFFGFFBG8FGFGFEEE
+@HS21_09876:1:1201:6607:66324#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHCDF8EHFEGFAGIFEDEGFEFFGFEGFEGFGFGEGGHGFEFD
+@HS21_09876:1:2102:12312:75235#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHCDH8EHFFGFAGDFIEEEGEFFGFFGFFGFFEGEFFFGFEFE
+@HS21_09876:1:1106:16061:54950#83
+GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+FHCBD4GHFFGFEEC<FCGEFEGHGFFEGFGFFFGDFGDGFDFF
+@HS21_09876:1:2101:14032:85058#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HHCEH5GHFFFFGEDC;GHFFEHGGFFGFEGFFJGDGFHGFGFF
+@HS21_09876:1:2111:11125:6617#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCCGGGGACCGGCGCGG
++
+HG2BH8HEFGFFGH;EFGHFGEGGGFEGGFGFFGGDGEHGFEFF
+@HS21_09876:1:2202:3163:76297#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HHCEH8EGFEGFGEIFDGHFGEHECFFGGFGFFDGEGGHGFEFF
+@HS21_09876:1:2205:20175:3703#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+H>8BI2A<FEFFGCE<EDFDDEHH?F=GFFGF3FGEGGHGDDFE
+@HS21_09876:1:2205:6527:34286#83
+GAATCGAGCGCGCGCTGCCCAAGGACACCTGGGGACCGGCGCGG
++
+HGBDH4HHFGFFGFDFDGHEGEHGGFEGFJGFGGGEGFHGFFFF
+@HS21_09876:1:1201:10071:48582#83
+GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HHCDI8EHFGFFGEFFFGGFGEFGGFFGGFGFG8G8ECFGFFAE
+@HS21_09876:1:2107:20205:78513#83
+GCCCCGAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HHCEI%EGFFEFEGIFGDGFE>GDGFFGFEBFGDGEGEH;EFDD
+@HS21_09876:1:2207:12005:97464#83
+GCCCCAAGGACACCTGGGGACCGGCGCGGCTGGACGCGGTATCG
++
+HGBBH0EG?<FFEHCBGEE>DEDF?FFGFE1FE89EEGD;;@?D
+@HS21_09876:1:1208:12319:4648#83
+CAACCTGGGGACCGGCGCGGCTGGACGCGGTATCGATGATCTTC
++
+AA>EF8EIFFGFGEC<F;FEEEG3?FFG/E=F?DG89C=GAD?E
+@HS21_09876:1:2209:14024:59451#83
+CCCGGTGCGCTACCCGTTCCTGTGGAACGCGGCGCGGCAGAACA
++
+FHCBF.E<FEFFGHHGE;H>GEFHFFFGFFGFFFGEFGFGFGFF
+@HS21_09876:2:1211:5990:82312#83
+TTTTCGGTCACCGCGGTGCGCAACCTGCACCCGGTGACCCTCTC
++
+HGFEH0FFDDDGCF7GFD1GCFGFGGFGFFGHEFF?FFFEEDEE
+@HS21_09876:2:2103:19946:55809#83
+GGGTCATAACGCCGCGGAGATTCTCTCGCGCGGTCAGCAGAAGC
++
+HHEAE'EFFEGGGFHEFAHGFHG@GEFHFEGFGFFF<FGEEDCE
+@HS21_09876:2:1104:10740:37072#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+HHFAE,FIGDEG;FHFFHH>FAGGFFF;><GHA9<F<FGE=F@C
+@HS21_09876:2:2201:4547:41892#83
+CCCACCGACGGCTCCGGATGGCTGACCCGCTGCTGGATGGGGCT
++
+GGEEE7EFGEDGEDHGGAHFGHGFDGFCFEGFAFFFDFBEEEDE
+@HS21_09876:2:2213:12056:100809#83
+GGGATGGGGCTGATCTCGGCCATGGTCTCGCTGACCCAGGCTTC
++
+BFEE?,B>DFG=EDF:GHHEG6GGDGFFFFGGF6FFEFGC1BFF
diff --git a/t/data/RunTradisTaglessSmalt/smallref.fa b/t/data/RunTradisTaglessSmalt/smallref.fa
new file mode 100644
index 0000000..58dcfe9
--- /dev/null
+++ b/t/data/RunTradisTaglessSmalt/smallref.fa
@@ -0,0 +1,165 @@
+>AE004091 AE004091.2 Pseudomonas aeruginosa PAO1, complete genome.
+tttaaagagaccggcgattctagtgaaatcgaacgggcaggtcaatttccaaccagcgat
+gacgtaatagatagatacaaggaagtcatttttcttttaaaggatagaaacggttaatgc
+tcttgggacggcgcttttctgtgcataactcgatgaagcccagcaattgcgtgtttctcc
+ggcaggcaaaaggttgtcgagaaccggtgtcgaggctgtttccttcctgagcgaagcctg
+gggatgaacgagatggttatccacagcggttttttccacacggctgtgcgcagggatgta
+cccccttcaaagcaagggttatccacaaagtccaggacgaccgtccgtcggcctgcctgc
+ttttattaaggtcttgatttgcttggggcctcagcgcatcggcatgtggataagtccggc
+ccgtccggctacaataggcgcttatttcgttgtgccgcctttccaatctttgggggatat
+ccgtgtccgtggaactttggcagcagtgcgtggatcttctccgcgatgagctgccgtccc
+aacaattcaacacctggatccgtcccttgcaggtcgaagccgaaggcgacgaattgcgtg
+tgtatgcacccaaccgtttcgtcctcgattgggtgaacgagaaatacctcggtcggcttc
+tggaactgctcggtgaacgcggcgagggtcagttgcccgcgctttccttattaataggca
+gcaagcgtagccgtacgccgcgcgccgccatcgtcccatcgcagacccacgtggctcccc
+cgcctccggttgctccgccgccggcgccagtgcagccggtatcggccgcgcccgtggtag
+tgccacgtgaagagctgccgccagtgacgacggctcccagcgtgtcgagcgatccctacg
+agccggaagaacccagcatcgatccgctggccgccgccatgccggctggagcagcgcctg
+cggtgcgcaccgagcgcaacgtccaggtcgaaggtgcgctgaagcacaccagctatctca
+accgtaccttcaccttcgagaacttcgtcgagggcaagtccaaccagttggcccgcgccg
+ccgcctggcaggtggcggacaacctcaagcacggctacaacccgctgttcctctacggtg
+gcgtcggtctgggcaagacccacctgatgcatgcggtgggcaaccacctgctgaagaaga
+acccgaacgccaaggtggtctacctgcattcggaacgtttcgtcgcggacatggtgaagg
+ccttgcagctcaacgccatcaacgaattcaagcgcttctaccgctcggtggacgcactgt
+tgatcgacgacatccagttcttcgcccgtaaggagcgctcccaggaggagttcttccaca
+ccttcaatgcccttctcgaaggcggccagcaggtgatcctcaccagcgaccgctatccga
+aggaaatcgaaggcctggaagagcggctgaaatcccgcttcggctggggcctgacggtgg
+ccgtcgagccgccggaactggaaacccgggtggcgatcctgatgaagaaggccgagcagg
+cgaagatcgagctgccgcacgatgcggccttcttcatcgcccagcgcatccgttccaacg
+tgcgtgaactggaaggtgcgctgaagcgggtgatcgcccactcgcacttcatgggccggc
+cgatcaccatcgagctgattcgcgagtcgctgaaggacctgttggcccttcaggacaagc
+tggtcagcatcgacaacatccagcgcaccgtcgccgagtactacaagatcaagatatccg
+atctgttgtccaagcggcgttcgcgctcggtggcgcgcccgcgccaggtggccatggcgc
+tctccaaggagctgaccaaccacagcctgccggagatcggcgtggccttcggcggtcggg
+atcacaccacggtgttgcacgcctgtcgtaagatcgctcaacttagggaatccgacgcgg
+atatccgcgaggactacaagaacctgctgcgtaccctgacaacctgacgcagcccacgag
+gcaagggactagaccatgcatttcaccattcaacgcgaagccctgttgaaaccgctgcaa
+ctggtcgccggcgtcgtggaacgccgccagacattgccggttctctccaacgtcctgctg
+gtggtcgaaggccagcaactgtcgctgaccggcaccgacctcgaagtcgagctggttggt
+cgcgtggtactggaagatgccgccgaacccggcgagatcaccgtaccggcgcgcaagctg
+atggacatctgcaagagcctgccgaacgacgtgctgatcgacatccgtgtcgaagagcag
+aaacttctggtgaaggccgggcgtagccgcttcaccctgtccaccctgccggccaacgat
+ttccccaccgtagaggaaggtcccggctcgctgaacttcagcattgcccagagcaagctg
+cgtcgcctgatcgaccgcaccagcttcgccatggcccagcaggacgtgcgttactacctc
+aacggcatgctgctggaagtgaacggcggcaccctgcgctccgtcgccaccgacggccac
+cgactggccatgtgctcgctggatgcgcagatcccgtcgcaggaccgccaccaggtgatc
+gtgccgcgcaaaggcatcctcgaactggctcgtctgctcaccgagcaggacggcgaagtc
+ggcatcgtcctgggccagcaccatatccgtgccaccactggcgaattcaccttcacttcg
+aagctggtggacggcaagttcccggactacgagcgtgtactgccgcgcggtggcgacaag
+ctggtggtcggtgaccgccagcaactgcgcgaagccttcagccgtaccgcgatcctctcc
+aacgagaagtaccgcggcattcgcctgcagctttccaacggtttgctgaaaatccaggcg
+aacaacccggagcaggaagaggccgaggaagaagtgcaggtcgagtacaacggcggcaac
+ctggagataggcttcaacgtcagttacctgctcgacgtgctgggtgtgatcggtaccgag
+caggtccgcttcatcctttccgattccaacagcagcgccctggtccacgaggccgacaat
+gacgattctgcctatgtcgtcatgccgatgcgcctctaaacatactgaatgtccctgacc
+cgcgtttcggtcaccgcggtgcgcaacctgcacccggtgaccctctccccctccccccgc
+atcaacatcctctacggcgacaacggcagcggcaagaccagcgtgctcgaagccatccac
+ctgctgggcctggcgcgttcattccgcagtgcgcgcttgcagccggtgatccagtatgag
+gaagcggcctgcaccgtattcggccaggtgatgttggccaacggcatcgccagcaacctg
+gggatttcccgtgagcgccagggcgagttcaccatccgcatcgatgggcagaacgcccgg
+agtgcggctcaattggcggaaactctcccactgcaactgatcaacccggacagctttcgg
+ttgctcgagggagcgccgaagatccggcgacagttcctcgattggggagtgttccacgtg
+gaacctcggtttctgcccgtctggcagcgcctgcagaaggcgctgcgccagcggaactcc
+tggctccggcatggtaaactggaccccgcgtcgcaagcggcctgggaccgggaattgagc
+ctggccagcgatgagatcgatgcctaccgcagaagctatatccaggcgttgaaaccggta
+ttcgaggaaacactcgccgaattggtttcactggatgacctgacccttagctactaccga
+ggctgggacaaggaccgggacctcctggaggttctggcttccagcctgttgcgcgaccag
+cagatgggccacacccaggcgggaccgcagcgtgcggatcttcgcatacggttggcaggt
+cataacgccgcggagattctctcgcgcggtcagcagaagctggtggtatgcgccctgcgc
+atcgcccaaggccatctgatcaatcgcgccaagcgcggacagtgcgtctacctggtggac
+gacctgccctcggaactggatgagcagcatcgaatggctctttgccgcttgcttgaagat
+ttgggttgccaggtattcatcacctgcgtggacccgcaactattgaaagacggctggcgc
+acggatacgccggtatccatgttccacgtggaacatggaaaagtctctcagaccacgacc
+atcgggagtgaagcatgagcgagaacaacacgtacgactcttccagcatcaaggtgctga
+aggggctggatgccgtacgcaagcgccccggcatgtacatcggcgacaccgacgatggca
+ccggtctgcaccacatggtgttcgaggtggtggataactccatcgacgaagcgctggccg
+gttactgcagcgaaatcagcatcaccatccatacggatgagtcgatcactgtccgcgaca
+atggacgcggtattccggtggatatccacaaggaagaaggggtttctgcggcggaagtga
+tcatgaccgtcctccacgccggcggcaagttcgacgacaacacctacaaggtgtccggcg
+gcttgcacggtgtgggcgtctcggtggtgaacgcgctgtcccatgaactacgcctgacca
+tccgtcgccacaacaaggtctgggaacaggtctaccaccacggcgttccgcagttcccac
+tgcgcgaagtgggcgagaccgatggctccggcaccgaagttcacttcaagccgtccccgg
+agaccttcagcaacatccacttcagttgggacatcctggccaagcgcatccgcgagctgt
+ccttcctcaactccggcgtcggcatcctgctgcgcgacgagcgtaccggcaaggaggagc
+tgttcaagtacgaaggcggtctgaaggccttcgtcgagtacctgaacaccaacaagaccg
+cggtgaacgaggtattccacttcaacgtccagcgtgaagaggacggcgtgggtgtggaag
+tcgccttgcagtggaacgacagcttcaacgagaacctgctctgcttcaccaacaacatcc
+cgcagcgtgacggcggcacccacctggccggtttccgttcggcgctgacgcgtaacctga
+acaactacatcgaggccgaaggcctggcgaagaagttcaagatcgccaccaccggcgacg
+atgcccgcgaaggcctcaccgcgatcatctcggtgaaggtaccggacccgaagttcagct
+cgcagaccaaggacaagctggtctcctccgaggtgaagactgcggtggaacaggagatgg
+gcaagtacttcgccgacttcctgctggagaatcccaacgaagccaaggccgtggtcggca
+agatgatcgacgccgcccgtgcccgcgaggccgcgcgcaaggcgcgcgagatgacccgcc
+gcaagggcgcgctggacatcgccggcctgcccggcaaactggccgattgccaggaaaagg
+acccggcgctctccgaactgtacatcgtggagggtgactccgcgggcggttccgccaagc
+agggccgcaatcgccggacccaggcgatcctgccgctcaagggcaagatcctcaacgtcg
+aaaaggcgcgcttcgacaagatgctctcctcccaggaggtcggtacgctgatcaccgccc
+tgggctgtggcatcggccgcgaggaatacaacatcgacaagctgcgctaccacaacatca
+tcatcatgaccgatgctgacgtcgacggttcgcacatccgcaccctgctgttgaccttct
+tcttccgccagatgcccgagctgatcgagcgtggctacatctacatcgcccagcccccgt
+tgtacaaggtcaagcgcggcaagcaggagcagtacatcaaggacgaccaggccatggaag
+agtacatgacccagtcggccctggaagacgccagcctgcacgtcaacgagcacgctccgg
+gcctgtccggggcggcgctggagaaactggtcaacgagtatcgcggggtgatcgccaccc
+tcaagcgcctgtcgcgcctgtacccccaggagctgaccgagcacttcatctacctgccta
+ccgtgtcggtggacgacctggctaacgagtcggccatgcagggctggttggagaagttcc
+aggcgcgcctgaccgccgccgagaagtccggcctgacctacaaggccagcctgcgcgaag
+accgcgagcgccacctgtggctgcccgaggtggaactggtggcccacggcctgtccagct
+acgtcaccttcaaccgtgacttcttcgccagcaatgactaccgctcggtgtcgctgctcg
+gcgaccagctgaacagcctgctggaagacggcgcctacgtgcagaagggtgagcgcaagc
+gcccgatcagcgccttcaaggacggcctggactggctgatggccgaaggtaccaagcgcc
+acagcatccagcgatacaaggggctgggcgagatgaaccctgagcagctgtgggaaacca
+ccatggatccgaacgtccggcgcatgctcaaggtgaccatcgaggatgccatcgccgccg
+accagatcttcaacaccctgatgggcgatgccgtggagccgcgccgcgacttcatcgaaa
+gcaacgcgctggcggtgtcgaacctggacgtgtgacaggtcggcagaccgaccctcatgg
+aaaccccggcctggcgccggggttttctttttgcgccaggtagcctggatacgggcgcca
+ggggtgccttgccaaggtgtggccgagccccggttactcgccggcattggcaccctggac
+ccgggcctcctggcggcgtggcaccgcttctgtgggcagcggtcgccggtcggttcggtc
+gatcgttgccagccggccttgctttgcgcctcgcgtgaaaacaagaagccccgctatggc
+ggggcttcttttatcgaatcggcgcacagtacgccttgcagggggctttgcggcccttca
+cgagaccaccgacggctccggatggctgacccgctgctggatggggctgatctcggccat
+ggtctcgctgacccaggcttcggcgcgctggtttagctcggcgatggcgcgcgggccttc
+gccttcggcgtgcatggccgggccgatcaccacctggatggtgcccgggtacttggccca
+gccggccttgggccaatactgcccggcgttgtgggcgatcggcagtaccggtagcccggc
+gttgaccgccagggcggtgccgccgcgggagaacttgcccatctgccccaccggaatacg
+cgtgccttccgggaagatcagcacccaggcgcctttcttcaggcactcgtcgccctgctt
+ggccagttgcttgagggccagcttgggctggctgcggtcgatggcgatgggcttgagcag
+ggccagggcccagccgaagaacggcacgtagagcagctcgcgcttgagtacctggctgag
+tggctcgaagaagccggagaggaagaaggtttcccaggtgctctggtgcttggagaggat
+cacgcagggcttttccgggatgttctccagtccgcgcacctcgtagcggatgccggcgac
+cacgcgggtcagccagatcgcgaagcggcaccagttctgtaccacgaagcggtagcgggc
+gcggaacggcaggatcggcgcgatgaagaagctgagggtgccccagacgaacgcgctggc
+ggacagcagcaggtaaaagaggacggttctgatggcctgcactgtcgacatgtattctga
+ccttactgaagtaatgcgctggcgactgccgccagatcgtcgaatatcagggtgccctct
+ggcaagggcttgcccagcgtacgtacaccttttccggtctttaccaataccggctgacaa
+tcgacggcccgcgccgcctccaggtcaccgatgctgtcgccgacgaaccagatacccgac
+agatcgaccccgtagtgctcgccgatctgccgcagcatacccggcttcggcttgcggcag
+tcgcaaccgtcgtccggtccatgcggacaatagacgatgaggccgacctcgccgccctgc
+tccgcgaccagttcgcgcaagcgcgcatgcatggcctcgagcactgccaggtcgtaatag
+ccacgggcgatgccggactggttggtagccaccgcgacggtccagccggcctggctcagg
+cgggcgatggcctcgatcgagctggggatggggatccactcgtcgagggtcttgatgtaa
+tcgtcggagtcgaggttgatgactccatcgcggtcgagaatcagcagggaacgggacatc
+gatgcgcagttggccatgaacggaaaggatcgattctacctcagccagccggagcatcgc
+ggatggatcgacgagccccctacgctggacaatctgtactagattcaataatggcaatgg
+aatggcaatcccaggccagggagtcatttggcacgcagcagtgggtgtctcggagtacgt
+gcgaaccccttggcgggtggatcaccggagtaacgcagtaagcgcctatcgcatgccagc
+acggccgaccggccgtgtttccaccacaggtggagcgggcgtgacgacggggagttccgg
+ggcgtctgcccgttcccaaggacggtaaccgtgaaacgcctgaaaaagacactgcacctt
+tcaagcttgtccctcgcttccctggctctttcttccgccgccctggcggccgctccggtc
+atgctcgaccagggcaaggaatggaccgaaagccaccgccaggacttctacagccgcgac
+cagggctcgcaggtgatgcccctgccctggctcaaggcgttgcgacagccggatggaacg
+cctttcctcgccgacagcctggcccgctacggctatttgcccaaccccaaggcgcccgcg
+gaaggcctgccggtgggcttcaccgtagccggcacgggcgcccggcagatggtcggcatg
+acctgttcggcctgccatacccggcagatcgaggtgaagggcactgcctatcggatcgac
+ggcggtccggcgatcgtcgacttccaggcattcctcgccgacctcgatcgggccgtggga
+ccgctgaccagcgatgacgccgccttcgacgccttcgccaagccgatcctcggggccaat
+ccgcctcccggtgcgcgcgacgctctgctcgcggcggtgaaggaatggtacgagccctat
+cacacgctgatcgagcgcgcgctgcccaaggacacctggggaccggcgcggctggacgcg
+gtatcgatgatcttcaaccgccttaccgggctggatatcggcaccgcgccgccctacctg
+attcccgacaacatcaaggcggccgatgcgccggtgcgctatccgttcctgtggaacgcg
+gcgcggcagaacaagacccagtggcccggcttcgccgccaacggcaacgacctgctcggc
+ctggcgcgcaatgtcggcgaggtctacggggtgttcgccaccttccacccgcagaagagc
+aagttccacctgctgggcatggactacctgaagatcaactcggccaacttccacgggctg
+ggcaagctggaagacctgatcaagaagatcggcccgccgaagtggccctgggcggtggac
+aagcacctggccaggaaaggcgcgctgatcttcgcccgcaagaccgacgaaggtggctgc
+gtggagtgccacggcatccggatcaaggacctggtgctttgggacactccgctgagggac
+gtcggcagcgacagccgccagcacgccatcctcgatggccaggtgcagaccggcgtgatg