diff --git a/Makefile.in b/Makefile.in
new file mode 100644
index 0000000..7e4d1ef
--- /dev/null
+++ b/Makefile.in
@@ -0,0 +1,1115 @@
+# Makefile.in generated by automake 1.16.5 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2021 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+@SET_MAKE@
+
+
+
+VPATH = @srcdir@
+am__is_gnu_make = { \
+  if test -z '$(MAKELEVEL)'; then \
+    false; \
+  elif test -n '$(MAKE_HOST)'; then \
+    true; \
+  elif test -n '$(MAKE_VERSION)' && test -n '$(CURDIR)'; then \
+    true; \
+  else \
+    false; \
+  fi; \
+}
+am__make_running_with_option = \
+  case $${target_option-} in \
+      ?) ;; \
+      *) echo "am__make_running_with_option: internal error: invalid" \
+              "target option '$${target_option-}' specified" >&2; \
+         exit 1;; \
+  esac; \
+  has_opt=no; \
+  sane_makeflags=$$MAKEFLAGS; \
+  if $(am__is_gnu_make); then \
+    sane_makeflags=$$MFLAGS; \
+  else \
+    case $$MAKEFLAGS in \
+      *\\[\ \	]*) \
+        bs=\\; \
+        sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+          | sed "s/$$bs$$bs[$$bs $$bs	]*//g"`;; \
+    esac; \
+  fi; \
+  skip_next=no; \
+  strip_trailopt () \
+  { \
+    flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+  }; \
+  for flg in $$sane_makeflags; do \
+    test $$skip_next = yes && { skip_next=no; continue; }; \
+    case $$flg in \
+      *=*|--*) continue;; \
+        -*I) strip_trailopt 'I'; skip_next=yes;; \
+      -*I?*) strip_trailopt 'I';; \
+        -*O) strip_trailopt 'O'; skip_next=yes;; \
+      -*O?*) strip_trailopt 'O';; \
+        -*l) strip_trailopt 'l'; skip_next=yes;; \
+      -*l?*) strip_trailopt 'l';; \
+      -[dEDm]) skip_next=yes;; \
+      -[JT]) skip_next=yes;; \
+    esac; \
+    case $$flg in \
+      *$$target_option*) has_opt=yes; break;; \
+    esac; \
+  done; \
+  test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+build_triplet = @build@
+host_triplet = @host@
+bin_PROGRAMS = nttest$(EXEEXT)
+subdir = .
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+	$(ACLOCAL_M4)
+DIST_COMMON = $(srcdir)/Makefile.am $(top_srcdir)/configure \
+	$(am__configure_deps) $(dist_doc_DATA) $(noinst_HEADERS) \
+	$(am__DIST_COMMON)
+am__CONFIG_DISTCLEAN_FILES = config.status config.cache config.log \
+ configure.lineno config.status.lineno
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+am__installdirs = "$(DESTDIR)$(bindir)" "$(DESTDIR)$(docdir)"
+PROGRAMS = $(bin_PROGRAMS)
+am__dirstamp = $(am__leading_dot)dirstamp
+am_nttest_OBJECTS = lib/nttest-city.$(OBJEXT) \
+	lib/nttest-seedgen.$(OBJEXT) lib/nttest-xxhash.$(OBJEXT) \
+	nttest-nttest.$(OBJEXT)
+nttest_OBJECTS = $(am_nttest_OBJECTS)
+nttest_LDADD = $(LDADD)
+AM_V_P = $(am__v_P_@AM_V@)
+am__v_P_ = $(am__v_P_@AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_@AM_V@)
+am__v_GEN_ = $(am__v_GEN_@AM_DEFAULT_V@)
+am__v_GEN_0 = @echo "  GEN     " $@;
+am__v_GEN_1 = 
+AM_V_at = $(am__v_at_@AM_V@)
+am__v_at_ = $(am__v_at_@AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 = 
+DEFAULT_INCLUDES = -I.@am__isrc@
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__maybe_remake_depfiles = depfiles
+am__depfiles_remade = ./$(DEPDIR)/nttest-nttest.Po \
+	lib/$(DEPDIR)/nttest-city.Po lib/$(DEPDIR)/nttest-seedgen.Po \
+	lib/$(DEPDIR)/nttest-xxhash.Po
+am__mv = mv -f
+AM_V_lt = $(am__v_lt_@AM_V@)
+am__v_lt_ = $(am__v_lt_@AM_DEFAULT_V@)
+am__v_lt_0 = --silent
+am__v_lt_1 = 
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+	$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+AM_V_CC = $(am__v_CC_@AM_V@)
+am__v_CC_ = $(am__v_CC_@AM_DEFAULT_V@)
+am__v_CC_0 = @echo "  CC      " $@;
+am__v_CC_1 = 
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_CCLD = $(am__v_CCLD_@AM_V@)
+am__v_CCLD_ = $(am__v_CCLD_@AM_DEFAULT_V@)
+am__v_CCLD_0 = @echo "  CCLD    " $@;
+am__v_CCLD_1 = 
+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
+	$(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
+AM_V_CXX = $(am__v_CXX_@AM_V@)
+am__v_CXX_ = $(am__v_CXX_@AM_DEFAULT_V@)
+am__v_CXX_0 = @echo "  CXX     " $@;
+am__v_CXX_1 = 
+CXXLD = $(CXX)
+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
+	-o $@
+AM_V_CXXLD = $(am__v_CXXLD_@AM_V@)
+am__v_CXXLD_ = $(am__v_CXXLD_@AM_DEFAULT_V@)
+am__v_CXXLD_0 = @echo "  CXXLD   " $@;
+am__v_CXXLD_1 = 
+SOURCES = $(nttest_SOURCES)
+DIST_SOURCES = $(nttest_SOURCES)
+RECURSIVE_TARGETS = all-recursive check-recursive cscopelist-recursive \
+	ctags-recursive dvi-recursive html-recursive info-recursive \
+	install-data-recursive install-dvi-recursive \
+	install-exec-recursive install-html-recursive \
+	install-info-recursive install-pdf-recursive \
+	install-ps-recursive install-recursive installcheck-recursive \
+	installdirs-recursive pdf-recursive ps-recursive \
+	tags-recursive uninstall-recursive
+am__can_run_installinfo = \
+  case $$AM_UPDATE_INFO_DIR in \
+    n|no|NO) false;; \
+    *) (install-info --version) >/dev/null 2>&1;; \
+  esac
+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
+am__vpath_adj = case $$p in \
+    $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
+    *) f=$$p;; \
+  esac;
+am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
+am__install_max = 40
+am__nobase_strip_setup = \
+  srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
+am__nobase_strip = \
+  for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
+am__nobase_list = $(am__nobase_strip_setup); \
+  for p in $$list; do echo "$$p $$p"; done | \
+  sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
+  $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
+    if (++n[$$2] == $(am__install_max)) \
+      { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
+    END { for (dir in files) print dir, files[dir] }'
+am__base_list = \
+  sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
+  sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
+am__uninstall_files_from_dir = { \
+  test -z "$$files" \
+    || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
+    || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
+         $(am__cd) "$$dir" && rm -f $$files; }; \
+  }
+DATA = $(dist_doc_DATA)
+HEADERS = $(noinst_HEADERS)
+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive	\
+  distclean-recursive maintainer-clean-recursive
+am__recursive_targets = \
+  $(RECURSIVE_TARGETS) \
+  $(RECURSIVE_CLEAN_TARGETS) \
+  $(am__extra_recursive_targets)
+AM_RECURSIVE_TARGETS = $(am__recursive_targets:-recursive=) TAGS CTAGS \
+	cscope distdir distdir-am dist dist-all distcheck
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP) \
+	config.h.in
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates.  Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+  BEGIN { nonempty = 0; } \
+  { items[$$0] = 1; nonempty = 1; } \
+  END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique.  This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+  list='$(am__tagged_files)'; \
+  unique=`for i in $$list; do \
+    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+  done | $(am__uniquify_input)`
+DIST_SUBDIRS = $(SUBDIRS)
+am__DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/config.h.in \
+	ChangeLog README.md compile config.guess config.sub depcomp \
+	install-sh missing
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+distdir = $(PACKAGE)-$(VERSION)
+top_distdir = $(distdir)
+am__remove_distdir = \
+  if test -d "$(distdir)"; then \
+    find "$(distdir)" -type d ! -perm -200 -exec chmod u+w {} ';' \
+      && rm -rf "$(distdir)" \
+      || { sleep 5 && rm -rf "$(distdir)"; }; \
+  else :; fi
+am__post_remove_distdir = $(am__remove_distdir)
+am__relativize = \
+  dir0=`pwd`; \
+  sed_first='s,^\([^/]*\)/.*$$,\1,'; \
+  sed_rest='s,^[^/]*/*,,'; \
+  sed_last='s,^.*/\([^/]*\)$$,\1,'; \
+  sed_butlast='s,/*[^/]*$$,,'; \
+  while test -n "$$dir1"; do \
+    first=`echo "$$dir1" | sed -e "$$sed_first"`; \
+    if test "$$first" != "."; then \
+      if test "$$first" = ".."; then \
+        dir2=`echo "$$dir0" | sed -e "$$sed_last"`/"$$dir2"; \
+        dir0=`echo "$$dir0" | sed -e "$$sed_butlast"`; \
+      else \
+        first2=`echo "$$dir2" | sed -e "$$sed_first"`; \
+        if test "$$first2" = "$$first"; then \
+          dir2=`echo "$$dir2" | sed -e "$$sed_rest"`; \
+        else \
+          dir2="../$$dir2"; \
+        fi; \
+        dir0="$$dir0"/"$$first"; \
+      fi; \
+    fi; \
+    dir1=`echo "$$dir1" | sed -e "$$sed_rest"`; \
+  done; \
+  reldir="$$dir2"
+DIST_ARCHIVES = $(distdir).tar.gz
+GZIP_ENV = --best
+DIST_TARGETS = dist-gzip
+# Exists only to be overridden by the user if desired.
+AM_DISTCHECK_DVI_TARGET = dvi
+distuninstallcheck_listfiles = find . -type f -print
+am__distuninstallcheck_listfiles = $(distuninstallcheck_listfiles) \
+  | sed 's|^\./|$(prefix)/|' | grep -v '$(infodir)/dir$$'
+distcleancheck_listfiles = find . -type f -print
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_CXXFLAGS = @AM_CXXFLAGS@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CSCOPE = @CSCOPE@
+CTAGS = @CTAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+ETAGS = @ETAGS@
+EXEEXT = @EXEEXT@
+GREP = @GREP@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build = @build@
+build_alias = @build_alias@
+build_cpu = @build_cpu@
+build_os = @build_os@
+build_vendor = @build_vendor@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host = @host@
+host_alias = @host_alias@
+host_cpu = @host_cpu@
+host_os = @host_os@
+host_vendor = @host_vendor@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+runstatedir = @runstatedir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+nttest_CPPFLAGS = -I$(top_srcdir)/lib
+nttest_SOURCES = \
+	lib/BloomFilter.hpp \
+	lib/city.cc \
+	lib/city.h \
+	lib/murmur.hpp \
+	lib/seedgen.cpp \
+	lib/seqgen.hpp \
+	lib/xxhash.c \
+	lib/xxhash.h \
+	nthash.hpp \
+	ntHashIterator.hpp \
+	nttest.cpp
+
+dist_doc_DATA = \
+	ChangeLog \
+	CITATION.bib \
+	LICENSE \
+	README.md
+
+EXTRA_DIST = autogen.sh
+noinst_HEADERS = stHashIterator.hpp
+SUBDIRS = \
+	unittest \
+	vendor
+
+all: config.h
+	$(MAKE) $(AM_MAKEFLAGS) all-recursive
+
+.SUFFIXES:
+.SUFFIXES: .c .cc .cpp .o .obj
+am--refresh: Makefile
+	@:
+$(srcdir)/Makefile.in:  $(srcdir)/Makefile.am  $(am__configure_deps)
+	@for dep in $?; do \
+	  case '$(am__configure_deps)' in \
+	    *$$dep*) \
+	      echo ' cd $(srcdir) && $(AUTOMAKE) --foreign'; \
+	      $(am__cd) $(srcdir) && $(AUTOMAKE) --foreign \
+		&& exit 0; \
+	      exit 1;; \
+	  esac; \
+	done; \
+	echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Makefile'; \
+	$(am__cd) $(top_srcdir) && \
+	  $(AUTOMAKE) --foreign Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+	@case '$?' in \
+	  *config.status*) \
+	    echo ' $(SHELL) ./config.status'; \
+	    $(SHELL) ./config.status;; \
+	  *) \
+	    echo ' cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__maybe_remake_depfiles)'; \
+	    cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__maybe_remake_depfiles);; \
+	esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+	$(SHELL) ./config.status --recheck
+
+$(top_srcdir)/configure:  $(am__configure_deps)
+	$(am__cd) $(srcdir) && $(AUTOCONF)
+$(ACLOCAL_M4):  $(am__aclocal_m4_deps)
+	$(am__cd) $(srcdir) && $(ACLOCAL) $(ACLOCAL_AMFLAGS)
+$(am__aclocal_m4_deps):
+
+config.h: stamp-h1
+	@test -f $@ || rm -f stamp-h1
+	@test -f $@ || $(MAKE) $(AM_MAKEFLAGS) stamp-h1
+
+stamp-h1: $(srcdir)/config.h.in $(top_builddir)/config.status
+	@rm -f stamp-h1
+	cd $(top_builddir) && $(SHELL) ./config.status config.h
+$(srcdir)/config.h.in:  $(am__configure_deps) 
+	($(am__cd) $(top_srcdir) && $(AUTOHEADER))
+	rm -f stamp-h1
+	touch $@
+
+distclean-hdr:
+	-rm -f config.h stamp-h1
+install-binPROGRAMS: $(bin_PROGRAMS)
+	@$(NORMAL_INSTALL)
+	@list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
+	fi; \
+	for p in $$list; do echo "$$p $$p"; done | \
+	sed 's/$(EXEEXT)$$//' | \
+	while read p p1; do if test -f $$p \
+	  ; then echo "$$p"; echo "$$p"; else :; fi; \
+	done | \
+	sed -e 'p;s,.*/,,;n;h' \
+	    -e 's|.*|.|' \
+	    -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
+	sed 'N;N;N;s,\n, ,g' | \
+	$(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
+	  { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
+	    if ($$2 == $$4) files[d] = files[d] " " $$1; \
+	    else { print "f", $$3 "/" $$4, $$1; } } \
+	  END { for (d in files) print "f", d, files[d] }' | \
+	while read type dir files; do \
+	    if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
+	    test -z "$$files" || { \
+	      echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
+	      $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
+	    } \
+	; done
+
+uninstall-binPROGRAMS:
+	@$(NORMAL_UNINSTALL)
+	@list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
+	files=`for p in $$list; do echo "$$p"; done | \
+	  sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
+	      -e 's/$$/$(EXEEXT)/' \
+	`; \
+	test -n "$$list" || exit 0; \
+	echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
+	cd "$(DESTDIR)$(bindir)" && rm -f $$files
+
+clean-binPROGRAMS:
+	-test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
+lib/$(am__dirstamp):
+	@$(MKDIR_P) lib
+	@: > lib/$(am__dirstamp)
+lib/$(DEPDIR)/$(am__dirstamp):
+	@$(MKDIR_P) lib/$(DEPDIR)
+	@: > lib/$(DEPDIR)/$(am__dirstamp)
+lib/nttest-city.$(OBJEXT): lib/$(am__dirstamp) \
+	lib/$(DEPDIR)/$(am__dirstamp)
+lib/nttest-seedgen.$(OBJEXT): lib/$(am__dirstamp) \
+	lib/$(DEPDIR)/$(am__dirstamp)
+lib/nttest-xxhash.$(OBJEXT): lib/$(am__dirstamp) \
+	lib/$(DEPDIR)/$(am__dirstamp)
+
+nttest$(EXEEXT): $(nttest_OBJECTS) $(nttest_DEPENDENCIES) $(EXTRA_nttest_DEPENDENCIES) 
+	@rm -f nttest$(EXEEXT)
+	$(AM_V_CXXLD)$(CXXLINK) $(nttest_OBJECTS) $(nttest_LDADD) $(LIBS)
+
+mostlyclean-compile:
+	-rm -f *.$(OBJEXT)
+	-rm -f lib/*.$(OBJEXT)
+
+distclean-compile:
+	-rm -f *.tab.c
+
+@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/nttest-nttest.Po@am__quote@ # am--include-marker
+@AMDEP_TRUE@@am__include@ @am__quote@lib/$(DEPDIR)/nttest-city.Po@am__quote@ # am--include-marker
+@AMDEP_TRUE@@am__include@ @am__quote@lib/$(DEPDIR)/nttest-seedgen.Po@am__quote@ # am--include-marker
+@AMDEP_TRUE@@am__include@ @am__quote@lib/$(DEPDIR)/nttest-xxhash.Po@am__quote@ # am--include-marker
+
+$(am__depfiles_remade):
+	@$(MKDIR_P) $(@D)
+	@echo '# dummy' >$@-t && $(am__mv) $@-t $@
+
+am--depfiles: $(am__depfiles_remade)
+
+.c.o:
+@am__fastdepCC_TRUE@	$(AM_V_CC)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.o$$||'`;\
+@am__fastdepCC_TRUE@	$(COMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
+@am__fastdepCC_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	$(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCC_FALSE@	$(AM_V_CC@am__nodep@)$(COMPILE) -c -o $@ $<
+
+.c.obj:
+@am__fastdepCC_TRUE@	$(AM_V_CC)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.obj$$||'`;\
+@am__fastdepCC_TRUE@	$(COMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ `$(CYGPATH_W) '$<'` &&\
+@am__fastdepCC_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	$(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCC_FALSE@	$(AM_V_CC@am__nodep@)$(COMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+lib/nttest-xxhash.o: lib/xxhash.c
+@am__fastdepCC_TRUE@	$(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -MT lib/nttest-xxhash.o -MD -MP -MF lib/$(DEPDIR)/nttest-xxhash.Tpo -c -o lib/nttest-xxhash.o `test -f 'lib/xxhash.c' || echo '$(srcdir)/'`lib/xxhash.c
+@am__fastdepCC_TRUE@	$(AM_V_at)$(am__mv) lib/$(DEPDIR)/nttest-xxhash.Tpo lib/$(DEPDIR)/nttest-xxhash.Po
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	$(AM_V_CC)source='lib/xxhash.c' object='lib/nttest-xxhash.o' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCC_FALSE@	$(AM_V_CC@am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -c -o lib/nttest-xxhash.o `test -f 'lib/xxhash.c' || echo '$(srcdir)/'`lib/xxhash.c
+
+lib/nttest-xxhash.obj: lib/xxhash.c
+@am__fastdepCC_TRUE@	$(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -MT lib/nttest-xxhash.obj -MD -MP -MF lib/$(DEPDIR)/nttest-xxhash.Tpo -c -o lib/nttest-xxhash.obj `if test -f 'lib/xxhash.c'; then $(CYGPATH_W) 'lib/xxhash.c'; else $(CYGPATH_W) '$(srcdir)/lib/xxhash.c'; fi`
+@am__fastdepCC_TRUE@	$(AM_V_at)$(am__mv) lib/$(DEPDIR)/nttest-xxhash.Tpo lib/$(DEPDIR)/nttest-xxhash.Po
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	$(AM_V_CC)source='lib/xxhash.c' object='lib/nttest-xxhash.obj' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCC_FALSE@	DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCC_FALSE@	$(AM_V_CC@am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -c -o lib/nttest-xxhash.obj `if test -f 'lib/xxhash.c'; then $(CYGPATH_W) 'lib/xxhash.c'; else $(CYGPATH_W) '$(srcdir)/lib/xxhash.c'; fi`
+
+.cc.o:
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.o$$||'`;\
+@am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
+@am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXXCOMPILE) -c -o $@ $<
+
+.cc.obj:
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.obj$$||'`;\
+@am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ `$(CYGPATH_W) '$<'` &&\
+@am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+lib/nttest-city.o: lib/city.cc
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT lib/nttest-city.o -MD -MP -MF lib/$(DEPDIR)/nttest-city.Tpo -c -o lib/nttest-city.o `test -f 'lib/city.cc' || echo '$(srcdir)/'`lib/city.cc
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) lib/$(DEPDIR)/nttest-city.Tpo lib/$(DEPDIR)/nttest-city.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='lib/city.cc' object='lib/nttest-city.o' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o lib/nttest-city.o `test -f 'lib/city.cc' || echo '$(srcdir)/'`lib/city.cc
+
+lib/nttest-city.obj: lib/city.cc
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT lib/nttest-city.obj -MD -MP -MF lib/$(DEPDIR)/nttest-city.Tpo -c -o lib/nttest-city.obj `if test -f 'lib/city.cc'; then $(CYGPATH_W) 'lib/city.cc'; else $(CYGPATH_W) '$(srcdir)/lib/city.cc'; fi`
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) lib/$(DEPDIR)/nttest-city.Tpo lib/$(DEPDIR)/nttest-city.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='lib/city.cc' object='lib/nttest-city.obj' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o lib/nttest-city.obj `if test -f 'lib/city.cc'; then $(CYGPATH_W) 'lib/city.cc'; else $(CYGPATH_W) '$(srcdir)/lib/city.cc'; fi`
+
+lib/nttest-seedgen.o: lib/seedgen.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT lib/nttest-seedgen.o -MD -MP -MF lib/$(DEPDIR)/nttest-seedgen.Tpo -c -o lib/nttest-seedgen.o `test -f 'lib/seedgen.cpp' || echo '$(srcdir)/'`lib/seedgen.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) lib/$(DEPDIR)/nttest-seedgen.Tpo lib/$(DEPDIR)/nttest-seedgen.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='lib/seedgen.cpp' object='lib/nttest-seedgen.o' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o lib/nttest-seedgen.o `test -f 'lib/seedgen.cpp' || echo '$(srcdir)/'`lib/seedgen.cpp
+
+lib/nttest-seedgen.obj: lib/seedgen.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT lib/nttest-seedgen.obj -MD -MP -MF lib/$(DEPDIR)/nttest-seedgen.Tpo -c -o lib/nttest-seedgen.obj `if test -f 'lib/seedgen.cpp'; then $(CYGPATH_W) 'lib/seedgen.cpp'; else $(CYGPATH_W) '$(srcdir)/lib/seedgen.cpp'; fi`
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) lib/$(DEPDIR)/nttest-seedgen.Tpo lib/$(DEPDIR)/nttest-seedgen.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='lib/seedgen.cpp' object='lib/nttest-seedgen.obj' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o lib/nttest-seedgen.obj `if test -f 'lib/seedgen.cpp'; then $(CYGPATH_W) 'lib/seedgen.cpp'; else $(CYGPATH_W) '$(srcdir)/lib/seedgen.cpp'; fi`
+
+nttest-nttest.o: nttest.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT nttest-nttest.o -MD -MP -MF $(DEPDIR)/nttest-nttest.Tpo -c -o nttest-nttest.o `test -f 'nttest.cpp' || echo '$(srcdir)/'`nttest.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) $(DEPDIR)/nttest-nttest.Tpo $(DEPDIR)/nttest-nttest.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='nttest.cpp' object='nttest-nttest.o' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o nttest-nttest.o `test -f 'nttest.cpp' || echo '$(srcdir)/'`nttest.cpp
+
+nttest-nttest.obj: nttest.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT nttest-nttest.obj -MD -MP -MF $(DEPDIR)/nttest-nttest.Tpo -c -o nttest-nttest.obj `if test -f 'nttest.cpp'; then $(CYGPATH_W) 'nttest.cpp'; else $(CYGPATH_W) '$(srcdir)/nttest.cpp'; fi`
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) $(DEPDIR)/nttest-nttest.Tpo $(DEPDIR)/nttest-nttest.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='nttest.cpp' object='nttest-nttest.obj' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(nttest_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o nttest-nttest.obj `if test -f 'nttest.cpp'; then $(CYGPATH_W) 'nttest.cpp'; else $(CYGPATH_W) '$(srcdir)/nttest.cpp'; fi`
+
+.cpp.o:
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.o$$||'`;\
+@am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
+@am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXXCOMPILE) -c -o $@ $<
+
+.cpp.obj:
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.obj$$||'`;\
+@am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ `$(CYGPATH_W) '$<'` &&\
+@am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+install-dist_docDATA: $(dist_doc_DATA)
+	@$(NORMAL_INSTALL)
+	@list='$(dist_doc_DATA)'; test -n "$(docdir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(docdir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(docdir)" || exit 1; \
+	fi; \
+	for p in $$list; do \
+	  if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+	  echo "$$d$$p"; \
+	done | $(am__base_list) | \
+	while read files; do \
+	  echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(docdir)'"; \
+	  $(INSTALL_DATA) $$files "$(DESTDIR)$(docdir)" || exit $$?; \
+	done
+
+uninstall-dist_docDATA:
+	@$(NORMAL_UNINSTALL)
+	@list='$(dist_doc_DATA)'; test -n "$(docdir)" || list=; \
+	files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
+	dir='$(DESTDIR)$(docdir)'; $(am__uninstall_files_from_dir)
+
+# This directory's subdirectories are mostly independent; you can cd
+# into them and run 'make' without going through this Makefile.
+# To change the values of 'make' variables: instead of editing Makefiles,
+# (1) if the variable is set in 'config.status', edit 'config.status'
+#     (which will cause the Makefiles to be regenerated when you run 'make');
+# (2) otherwise, pass the desired values on the 'make' command line.
+$(am__recursive_targets):
+	@fail=; \
+	if $(am__make_keepgoing); then \
+	  failcom='fail=yes'; \
+	else \
+	  failcom='exit 1'; \
+	fi; \
+	dot_seen=no; \
+	target=`echo $@ | sed s/-recursive//`; \
+	case "$@" in \
+	  distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \
+	  *) list='$(SUBDIRS)' ;; \
+	esac; \
+	for subdir in $$list; do \
+	  echo "Making $$target in $$subdir"; \
+	  if test "$$subdir" = "."; then \
+	    dot_seen=yes; \
+	    local_target="$$target-am"; \
+	  else \
+	    local_target="$$target"; \
+	  fi; \
+	  ($(am__cd) $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \
+	  || eval $$failcom; \
+	done; \
+	if test "$$dot_seen" = "no"; then \
+	  $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \
+	fi; test -z "$$fail"
+
+ID: $(am__tagged_files)
+	$(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-recursive
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+	set x; \
+	here=`pwd`; \
+	if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \
+	  include_option=--etags-include; \
+	  empty_fix=.; \
+	else \
+	  include_option=--include; \
+	  empty_fix=; \
+	fi; \
+	list='$(SUBDIRS)'; for subdir in $$list; do \
+	  if test "$$subdir" = .; then :; else \
+	    test ! -f $$subdir/TAGS || \
+	      set "$$@" "$$include_option=$$here/$$subdir/TAGS"; \
+	  fi; \
+	done; \
+	$(am__define_uniq_tagged_files); \
+	shift; \
+	if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+	  test -n "$$unique" || unique=$$empty_fix; \
+	  if test $$# -gt 0; then \
+	    $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	      "$$@" $$unique; \
+	  else \
+	    $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	      $$unique; \
+	  fi; \
+	fi
+ctags: ctags-recursive
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+	$(am__define_uniq_tagged_files); \
+	test -z "$(CTAGS_ARGS)$$unique" \
+	  || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+	     $$unique
+
+GTAGS:
+	here=`$(am__cd) $(top_builddir) && pwd` \
+	  && $(am__cd) $(top_srcdir) \
+	  && gtags -i $(GTAGS_ARGS) "$$here"
+cscope: cscope.files
+	test ! -s cscope.files \
+	  || $(CSCOPE) -b -q $(AM_CSCOPEFLAGS) $(CSCOPEFLAGS) -i cscope.files $(CSCOPE_ARGS)
+clean-cscope:
+	-rm -f cscope.files
+cscope.files: clean-cscope cscopelist
+cscopelist: cscopelist-recursive
+
+cscopelist-am: $(am__tagged_files)
+	list='$(am__tagged_files)'; \
+	case "$(srcdir)" in \
+	  [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+	  *) sdir=$(subdir)/$(srcdir) ;; \
+	esac; \
+	for i in $$list; do \
+	  if test -f "$$i"; then \
+	    echo "$(subdir)/$$i"; \
+	  else \
+	    echo "$$sdir/$$i"; \
+	  fi; \
+	done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+	-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+	-rm -f cscope.out cscope.in.out cscope.po.out cscope.files
+distdir: $(BUILT_SOURCES)
+	$(MAKE) $(AM_MAKEFLAGS) distdir-am
+
+distdir-am: $(DISTFILES)
+	$(am__remove_distdir)
+	test -d "$(distdir)" || mkdir "$(distdir)"
+	@srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	list='$(DISTFILES)'; \
+	  dist_files=`for file in $$list; do echo $$file; done | \
+	  sed -e "s|^$$srcdirstrip/||;t" \
+	      -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+	case $$dist_files in \
+	  */*) $(MKDIR_P) `echo "$$dist_files" | \
+			   sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+			   sort -u` ;; \
+	esac; \
+	for file in $$dist_files; do \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  if test -d $$d/$$file; then \
+	    dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+	    if test -d "$(distdir)/$$file"; then \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+	  else \
+	    test -f "$(distdir)/$$file" \
+	    || cp -p $$d/$$file "$(distdir)/$$file" \
+	    || exit 1; \
+	  fi; \
+	done
+	@list='$(DIST_SUBDIRS)'; for subdir in $$list; do \
+	  if test "$$subdir" = .; then :; else \
+	    $(am__make_dryrun) \
+	      || test -d "$(distdir)/$$subdir" \
+	      || $(MKDIR_P) "$(distdir)/$$subdir" \
+	      || exit 1; \
+	    dir1=$$subdir; dir2="$(distdir)/$$subdir"; \
+	    $(am__relativize); \
+	    new_distdir=$$reldir; \
+	    dir1=$$subdir; dir2="$(top_distdir)"; \
+	    $(am__relativize); \
+	    new_top_distdir=$$reldir; \
+	    echo " (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) top_distdir="$$new_top_distdir" distdir="$$new_distdir" \\"; \
+	    echo "     am__remove_distdir=: am__skip_length_check=: am__skip_mode_fix=: distdir)"; \
+	    ($(am__cd) $$subdir && \
+	      $(MAKE) $(AM_MAKEFLAGS) \
+	        top_distdir="$$new_top_distdir" \
+	        distdir="$$new_distdir" \
+		am__remove_distdir=: \
+		am__skip_length_check=: \
+		am__skip_mode_fix=: \
+	        distdir) \
+	      || exit 1; \
+	  fi; \
+	done
+	-test -n "$(am__skip_mode_fix)" \
+	|| find "$(distdir)" -type d ! -perm -755 \
+		-exec chmod u+rwx,go+rx {} \; -o \
+	  ! -type d ! -perm -444 -links 1 -exec chmod a+r {} \; -o \
+	  ! -type d ! -perm -400 -exec chmod a+r {} \; -o \
+	  ! -type d ! -perm -444 -exec $(install_sh) -c -m a+r {} {} \; \
+	|| chmod -R a+r "$(distdir)"
+dist-gzip: distdir
+	tardir=$(distdir) && $(am__tar) | eval GZIP= gzip $(GZIP_ENV) -c >$(distdir).tar.gz
+	$(am__post_remove_distdir)
+
+dist-bzip2: distdir
+	tardir=$(distdir) && $(am__tar) | BZIP2=$${BZIP2--9} bzip2 -c >$(distdir).tar.bz2
+	$(am__post_remove_distdir)
+
+dist-lzip: distdir
+	tardir=$(distdir) && $(am__tar) | lzip -c $${LZIP_OPT--9} >$(distdir).tar.lz
+	$(am__post_remove_distdir)
+
+dist-xz: distdir
+	tardir=$(distdir) && $(am__tar) | XZ_OPT=$${XZ_OPT--e} xz -c >$(distdir).tar.xz
+	$(am__post_remove_distdir)
+
+dist-zstd: distdir
+	tardir=$(distdir) && $(am__tar) | zstd -c $${ZSTD_CLEVEL-$${ZSTD_OPT--19}} >$(distdir).tar.zst
+	$(am__post_remove_distdir)
+
+dist-tarZ: distdir
+	@echo WARNING: "Support for distribution archives compressed with" \
+		       "legacy program 'compress' is deprecated." >&2
+	@echo WARNING: "It will be removed altogether in Automake 2.0" >&2
+	tardir=$(distdir) && $(am__tar) | compress -c >$(distdir).tar.Z
+	$(am__post_remove_distdir)
+
+dist-shar: distdir
+	@echo WARNING: "Support for shar distribution archives is" \
+	               "deprecated." >&2
+	@echo WARNING: "It will be removed altogether in Automake 2.0" >&2
+	shar $(distdir) | eval GZIP= gzip $(GZIP_ENV) -c >$(distdir).shar.gz
+	$(am__post_remove_distdir)
+
+dist-zip: distdir
+	-rm -f $(distdir).zip
+	zip -rq $(distdir).zip $(distdir)
+	$(am__post_remove_distdir)
+
+dist dist-all:
+	$(MAKE) $(AM_MAKEFLAGS) $(DIST_TARGETS) am__post_remove_distdir='@:'
+	$(am__post_remove_distdir)
+
+# This target untars the dist file and tries a VPATH configuration.  Then
+# it guarantees that the distribution is self-contained by making another
+# tarfile.
+distcheck: dist
+	case '$(DIST_ARCHIVES)' in \
+	*.tar.gz*) \
+	  eval GZIP= gzip $(GZIP_ENV) -dc $(distdir).tar.gz | $(am__untar) ;;\
+	*.tar.bz2*) \
+	  bzip2 -dc $(distdir).tar.bz2 | $(am__untar) ;;\
+	*.tar.lz*) \
+	  lzip -dc $(distdir).tar.lz | $(am__untar) ;;\
+	*.tar.xz*) \
+	  xz -dc $(distdir).tar.xz | $(am__untar) ;;\
+	*.tar.Z*) \
+	  uncompress -c $(distdir).tar.Z | $(am__untar) ;;\
+	*.shar.gz*) \
+	  eval GZIP= gzip $(GZIP_ENV) -dc $(distdir).shar.gz | unshar ;;\
+	*.zip*) \
+	  unzip $(distdir).zip ;;\
+	*.tar.zst*) \
+	  zstd -dc $(distdir).tar.zst | $(am__untar) ;;\
+	esac
+	chmod -R a-w $(distdir)
+	chmod u+w $(distdir)
+	mkdir $(distdir)/_build $(distdir)/_build/sub $(distdir)/_inst
+	chmod a-w $(distdir)
+	test -d $(distdir)/_build || exit 0; \
+	dc_install_base=`$(am__cd) $(distdir)/_inst && pwd | sed -e 's,^[^:\\/]:[\\/],/,'` \
+	  && dc_destdir="$${TMPDIR-/tmp}/am-dc-$$$$/" \
+	  && am__cwd=`pwd` \
+	  && $(am__cd) $(distdir)/_build/sub \
+	  && ../../configure \
+	    $(AM_DISTCHECK_CONFIGURE_FLAGS) \
+	    $(DISTCHECK_CONFIGURE_FLAGS) \
+	    --srcdir=../.. --prefix="$$dc_install_base" \
+	  && $(MAKE) $(AM_MAKEFLAGS) \
+	  && $(MAKE) $(AM_MAKEFLAGS) $(AM_DISTCHECK_DVI_TARGET) \
+	  && $(MAKE) $(AM_MAKEFLAGS) check \
+	  && $(MAKE) $(AM_MAKEFLAGS) install \
+	  && $(MAKE) $(AM_MAKEFLAGS) installcheck \
+	  && $(MAKE) $(AM_MAKEFLAGS) uninstall \
+	  && $(MAKE) $(AM_MAKEFLAGS) distuninstallcheck_dir="$$dc_install_base" \
+	        distuninstallcheck \
+	  && chmod -R a-w "$$dc_install_base" \
+	  && ({ \
+	       (cd ../.. && umask 077 && mkdir "$$dc_destdir") \
+	       && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" install \
+	       && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" uninstall \
+	       && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" \
+	            distuninstallcheck_dir="$$dc_destdir" distuninstallcheck; \
+	      } || { rm -rf "$$dc_destdir"; exit 1; }) \
+	  && rm -rf "$$dc_destdir" \
+	  && $(MAKE) $(AM_MAKEFLAGS) dist \
+	  && rm -rf $(DIST_ARCHIVES) \
+	  && $(MAKE) $(AM_MAKEFLAGS) distcleancheck \
+	  && cd "$$am__cwd" \
+	  || exit 1
+	$(am__post_remove_distdir)
+	@(echo "$(distdir) archives ready for distribution: "; \
+	  list='$(DIST_ARCHIVES)'; for i in $$list; do echo $$i; done) | \
+	  sed -e 1h -e 1s/./=/g -e 1p -e 1x -e '$$p' -e '$$x'
+distuninstallcheck:
+	@test -n '$(distuninstallcheck_dir)' || { \
+	  echo 'ERROR: trying to run $@ with an empty' \
+	       '$$(distuninstallcheck_dir)' >&2; \
+	  exit 1; \
+	}; \
+	$(am__cd) '$(distuninstallcheck_dir)' || { \
+	  echo 'ERROR: cannot chdir into $(distuninstallcheck_dir)' >&2; \
+	  exit 1; \
+	}; \
+	test `$(am__distuninstallcheck_listfiles) | wc -l` -eq 0 \
+	   || { echo "ERROR: files left after uninstall:" ; \
+	        if test -n "$(DESTDIR)"; then \
+	          echo "  (check DESTDIR support)"; \
+	        fi ; \
+	        $(distuninstallcheck_listfiles) ; \
+	        exit 1; } >&2
+distcleancheck: distclean
+	@if test '$(srcdir)' = . ; then \
+	  echo "ERROR: distcleancheck can only run from a VPATH build" ; \
+	  exit 1 ; \
+	fi
+	@test `$(distcleancheck_listfiles) | wc -l` -eq 0 \
+	  || { echo "ERROR: files left in build directory after distclean:" ; \
+	       $(distcleancheck_listfiles) ; \
+	       exit 1; } >&2
+check-am: all-am
+check: check-recursive
+all-am: Makefile $(PROGRAMS) $(DATA) $(HEADERS) config.h
+installdirs: installdirs-recursive
+installdirs-am:
+	for dir in "$(DESTDIR)$(bindir)" "$(DESTDIR)$(docdir)"; do \
+	  test -z "$$dir" || $(MKDIR_P) "$$dir"; \
+	done
+install: install-recursive
+install-exec: install-exec-recursive
+install-data: install-data-recursive
+uninstall: uninstall-recursive
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-recursive
+install-strip:
+	if test -z '$(STRIP)'; then \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	      install; \
+	else \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	    "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+	fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+	-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+	-test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+	-rm -f lib/$(DEPDIR)/$(am__dirstamp)
+	-rm -f lib/$(am__dirstamp)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-recursive
+
+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
+
+distclean: distclean-recursive
+	-rm -f $(am__CONFIG_DISTCLEAN_FILES)
+		-rm -f ./$(DEPDIR)/nttest-nttest.Po
+	-rm -f lib/$(DEPDIR)/nttest-city.Po
+	-rm -f lib/$(DEPDIR)/nttest-seedgen.Po
+	-rm -f lib/$(DEPDIR)/nttest-xxhash.Po
+	-rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+	distclean-hdr distclean-tags
+
+dvi: dvi-recursive
+
+dvi-am:
+
+html: html-recursive
+
+html-am:
+
+info: info-recursive
+
+info-am:
+
+install-data-am: install-dist_docDATA
+
+install-dvi: install-dvi-recursive
+
+install-dvi-am:
+
+install-exec-am: install-binPROGRAMS
+
+install-html: install-html-recursive
+
+install-html-am:
+
+install-info: install-info-recursive
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-recursive
+
+install-pdf-am:
+
+install-ps: install-ps-recursive
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-recursive
+	-rm -f $(am__CONFIG_DISTCLEAN_FILES)
+	-rm -rf $(top_srcdir)/autom4te.cache
+		-rm -f ./$(DEPDIR)/nttest-nttest.Po
+	-rm -f lib/$(DEPDIR)/nttest-city.Po
+	-rm -f lib/$(DEPDIR)/nttest-seedgen.Po
+	-rm -f lib/$(DEPDIR)/nttest-xxhash.Po
+	-rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-recursive
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-recursive
+
+pdf-am:
+
+ps: ps-recursive
+
+ps-am:
+
+uninstall-am: uninstall-binPROGRAMS uninstall-dist_docDATA
+
+.MAKE: $(am__recursive_targets) all install-am install-strip
+
+.PHONY: $(am__recursive_targets) CTAGS GTAGS TAGS all all-am \
+	am--depfiles am--refresh check check-am clean \
+	clean-binPROGRAMS clean-cscope clean-generic cscope \
+	cscopelist-am ctags ctags-am dist dist-all dist-bzip2 \
+	dist-gzip dist-lzip dist-shar dist-tarZ dist-xz dist-zip \
+	dist-zstd distcheck distclean distclean-compile \
+	distclean-generic distclean-hdr distclean-tags distcleancheck \
+	distdir distuninstallcheck dvi dvi-am html html-am info \
+	info-am install install-am install-binPROGRAMS install-data \
+	install-data-am install-dist_docDATA install-dvi \
+	install-dvi-am install-exec install-exec-am install-html \
+	install-html-am install-info install-info-am install-man \
+	install-pdf install-pdf-am install-ps install-ps-am \
+	install-strip installcheck installcheck-am installdirs \
+	installdirs-am maintainer-clean maintainer-clean-generic \
+	mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
+	ps ps-am tags tags-am uninstall uninstall-am \
+	uninstall-binPROGRAMS uninstall-dist_docDATA
+
+.PRECIOUS: Makefile
+
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000..2154e6d
--- /dev/null
+++ b/aclocal.m4
@@ -0,0 +1,1150 @@
+# generated automatically by aclocal 1.16.5 -*- Autoconf -*-
+
+# Copyright (C) 1996-2021 Free Software Foundation, Inc.
+
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
+m4_ifndef([AC_AUTOCONF_VERSION],
+  [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
+m4_if(m4_defn([AC_AUTOCONF_VERSION]), [2.71],,
+[m4_warning([this file was generated for autoconf 2.71.
+You have another version of autoconf.  It may work, but is not guaranteed to.
+If you have problems, you may need to regenerate the build system entirely.
+To do so, use the procedure documented by the package, typically 'autoreconf'.])])
+
+# Copyright (C) 2002-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_AUTOMAKE_VERSION(VERSION)
+# ----------------------------
+# Automake X.Y traces this macro to ensure aclocal.m4 has been
+# generated from the m4 files accompanying Automake X.Y.
+# (This private macro should not be called outside this file.)
+AC_DEFUN([AM_AUTOMAKE_VERSION],
+[am__api_version='1.16'
+dnl Some users find AM_AUTOMAKE_VERSION and mistake it for a way to
+dnl require some minimum version.  Point them to the right macro.
+m4_if([$1], [1.16.5], [],
+      [AC_FATAL([Do not call $0, use AM_INIT_AUTOMAKE([$1]).])])dnl
+])
+
+# _AM_AUTOCONF_VERSION(VERSION)
+# -----------------------------
+# aclocal traces this macro to find the Autoconf version.
+# This is a private macro too.  Using m4_define simplifies
+# the logic in aclocal, which can simply ignore this definition.
+m4_define([_AM_AUTOCONF_VERSION], [])
+
+# AM_SET_CURRENT_AUTOMAKE_VERSION
+# -------------------------------
+# Call AM_AUTOMAKE_VERSION and AM_AUTOMAKE_VERSION so they can be traced.
+# This function is AC_REQUIREd by AM_INIT_AUTOMAKE.
+AC_DEFUN([AM_SET_CURRENT_AUTOMAKE_VERSION],
+[AM_AUTOMAKE_VERSION([1.16.5])dnl
+m4_ifndef([AC_AUTOCONF_VERSION],
+  [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
+_AM_AUTOCONF_VERSION(m4_defn([AC_AUTOCONF_VERSION]))])
+
+# AM_AUX_DIR_EXPAND                                         -*- Autoconf -*-
+
+# Copyright (C) 2001-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# For projects using AC_CONFIG_AUX_DIR([foo]), Autoconf sets
+# $ac_aux_dir to '$srcdir/foo'.  In other projects, it is set to
+# '$srcdir', '$srcdir/..', or '$srcdir/../..'.
+#
+# Of course, Automake must honor this variable whenever it calls a
+# tool from the auxiliary directory.  The problem is that $srcdir (and
+# therefore $ac_aux_dir as well) can be either absolute or relative,
+# depending on how configure is run.  This is pretty annoying, since
+# it makes $ac_aux_dir quite unusable in subdirectories: in the top
+# source directory, any form will work fine, but in subdirectories a
+# relative path needs to be adjusted first.
+#
+# $ac_aux_dir/missing
+#    fails when called from a subdirectory if $ac_aux_dir is relative
+# $top_srcdir/$ac_aux_dir/missing
+#    fails if $ac_aux_dir is absolute,
+#    fails when called from a subdirectory in a VPATH build with
+#          a relative $ac_aux_dir
+#
+# The reason of the latter failure is that $top_srcdir and $ac_aux_dir
+# are both prefixed by $srcdir.  In an in-source build this is usually
+# harmless because $srcdir is '.', but things will broke when you
+# start a VPATH build or use an absolute $srcdir.
+#
+# So we could use something similar to $top_srcdir/$ac_aux_dir/missing,
+# iff we strip the leading $srcdir from $ac_aux_dir.  That would be:
+#   am_aux_dir='\$(top_srcdir)/'`expr "$ac_aux_dir" : "$srcdir//*\(.*\)"`
+# and then we would define $MISSING as
+#   MISSING="\${SHELL} $am_aux_dir/missing"
+# This will work as long as MISSING is not called from configure, because
+# unfortunately $(top_srcdir) has no meaning in configure.
+# However there are other variables, like CC, which are often used in
+# configure, and could therefore not use this "fixed" $ac_aux_dir.
+#
+# Another solution, used here, is to always expand $ac_aux_dir to an
+# absolute PATH.  The drawback is that using absolute paths prevent a
+# configured tree to be moved without reconfiguration.
+
+AC_DEFUN([AM_AUX_DIR_EXPAND],
+[AC_REQUIRE([AC_CONFIG_AUX_DIR_DEFAULT])dnl
+# Expand $ac_aux_dir to an absolute path.
+am_aux_dir=`cd "$ac_aux_dir" && pwd`
+])
+
+# AM_CONDITIONAL                                            -*- Autoconf -*-
+
+# Copyright (C) 1997-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_CONDITIONAL(NAME, SHELL-CONDITION)
+# -------------------------------------
+# Define a conditional.
+AC_DEFUN([AM_CONDITIONAL],
+[AC_PREREQ([2.52])dnl
+ m4_if([$1], [TRUE],  [AC_FATAL([$0: invalid condition: $1])],
+       [$1], [FALSE], [AC_FATAL([$0: invalid condition: $1])])dnl
+AC_SUBST([$1_TRUE])dnl
+AC_SUBST([$1_FALSE])dnl
+_AM_SUBST_NOTMAKE([$1_TRUE])dnl
+_AM_SUBST_NOTMAKE([$1_FALSE])dnl
+m4_define([_AM_COND_VALUE_$1], [$2])dnl
+if $2; then
+  $1_TRUE=
+  $1_FALSE='#'
+else
+  $1_TRUE='#'
+  $1_FALSE=
+fi
+AC_CONFIG_COMMANDS_PRE(
+[if test -z "${$1_TRUE}" && test -z "${$1_FALSE}"; then
+  AC_MSG_ERROR([[conditional "$1" was never defined.
+Usually this means the macro was only invoked conditionally.]])
+fi])])
+
+# Copyright (C) 1999-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+
+# There are a few dirty hacks below to avoid letting 'AC_PROG_CC' be
+# written in clear, in which case automake, when reading aclocal.m4,
+# will think it sees a *use*, and therefore will trigger all it's
+# C support machinery.  Also note that it means that autoscan, seeing
+# CC etc. in the Makefile, will ask for an AC_PROG_CC use...
+
+
+# _AM_DEPENDENCIES(NAME)
+# ----------------------
+# See how the compiler implements dependency checking.
+# NAME is "CC", "CXX", "OBJC", "OBJCXX", "UPC", or "GJC".
+# We try a few techniques and use that to set a single cache variable.
+#
+# We don't AC_REQUIRE the corresponding AC_PROG_CC since the latter was
+# modified to invoke _AM_DEPENDENCIES(CC); we would have a circular
+# dependency, and given that the user is not expected to run this macro,
+# just rely on AC_PROG_CC.
+AC_DEFUN([_AM_DEPENDENCIES],
+[AC_REQUIRE([AM_SET_DEPDIR])dnl
+AC_REQUIRE([AM_OUTPUT_DEPENDENCY_COMMANDS])dnl
+AC_REQUIRE([AM_MAKE_INCLUDE])dnl
+AC_REQUIRE([AM_DEP_TRACK])dnl
+
+m4_if([$1], [CC],   [depcc="$CC"   am_compiler_list=],
+      [$1], [CXX],  [depcc="$CXX"  am_compiler_list=],
+      [$1], [OBJC], [depcc="$OBJC" am_compiler_list='gcc3 gcc'],
+      [$1], [OBJCXX], [depcc="$OBJCXX" am_compiler_list='gcc3 gcc'],
+      [$1], [UPC],  [depcc="$UPC"  am_compiler_list=],
+      [$1], [GCJ],  [depcc="$GCJ"  am_compiler_list='gcc3 gcc'],
+                    [depcc="$$1"   am_compiler_list=])
+
+AC_CACHE_CHECK([dependency style of $depcc],
+               [am_cv_$1_dependencies_compiler_type],
+[if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named 'D' -- because '-MD' means "put the output
+  # in D".
+  rm -rf conftest.dir
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+  # We will build objects and dependencies in a subdirectory because
+  # it helps to detect inapplicable dependency modes.  For instance
+  # both Tru64's cc and ICC support -MD to output dependencies as a
+  # side effect of compilation, but ICC will put the dependencies in
+  # the current directory while Tru64 will put them in the object
+  # directory.
+  mkdir sub
+
+  am_cv_$1_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n ['s/^#*\([a-zA-Z0-9]*\))$/\1/p'] < ./depcomp`
+  fi
+  am__universal=false
+  m4_case([$1], [CC],
+    [case " $depcc " in #(
+     *\ -arch\ *\ -arch\ *) am__universal=true ;;
+     esac],
+    [CXX],
+    [case " $depcc " in #(
+     *\ -arch\ *\ -arch\ *) am__universal=true ;;
+     esac])
+
+  for depmode in $am_compiler_list; do
+    # Setup a source with many dependencies, because some compilers
+    # like to wrap large dependency lists on column 80 (with \), and
+    # we should not choose a depcomp mode which is confused by this.
+    #
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    : > sub/conftest.c
+    for i in 1 2 3 4 5 6; do
+      echo '#include "conftst'$i'.h"' >> sub/conftest.c
+      # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
+      # Solaris 10 /bin/sh.
+      echo '/* dummy */' > sub/conftst$i.h
+    done
+    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+
+    # We check with '-c' and '-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle '-M -o', and we need to detect this.  Also, some Intel
+    # versions had trouble with output in subdirs.
+    am__obj=sub/conftest.${OBJEXT-o}
+    am__minus_obj="-o $am__obj"
+    case $depmode in
+    gcc)
+      # This depmode causes a compiler race in universal mode.
+      test "$am__universal" = false || continue
+      ;;
+    nosideeffect)
+      # After this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested.
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+      # This compiler won't grok '-c -o', but also, the minuso test has
+      # not run yet.  These depmodes are late enough in the game, and
+      # so weak that their functioning should not be impacted.
+      am__obj=conftest.${OBJEXT-o}
+      am__minus_obj=
+      ;;
+    none) break ;;
+    esac
+    if depmode=$depmode \
+       source=sub/conftest.c object=$am__obj \
+       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # or remarks (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored or not supported.
+      # When given -MP, icc 7.0 and 7.1 complain thusly:
+      #   icc: Command line warning: ignoring option '-M'; no argument required
+      # The diagnosis changed in icc 8.0:
+      #   icc: Command line remark: option '-MP' not supported
+      if (grep 'ignoring option' conftest.err ||
+          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+        am_cv_$1_dependencies_compiler_type=$depmode
+        break
+      fi
+    fi
+  done
+
+  cd ..
+  rm -rf conftest.dir
+else
+  am_cv_$1_dependencies_compiler_type=none
+fi
+])
+AC_SUBST([$1DEPMODE], [depmode=$am_cv_$1_dependencies_compiler_type])
+AM_CONDITIONAL([am__fastdep$1], [
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_$1_dependencies_compiler_type" = gcc3])
+])
+
+
+# AM_SET_DEPDIR
+# -------------
+# Choose a directory name for dependency files.
+# This macro is AC_REQUIREd in _AM_DEPENDENCIES.
+AC_DEFUN([AM_SET_DEPDIR],
+[AC_REQUIRE([AM_SET_LEADING_DOT])dnl
+AC_SUBST([DEPDIR], ["${am__leading_dot}deps"])dnl
+])
+
+
+# AM_DEP_TRACK
+# ------------
+AC_DEFUN([AM_DEP_TRACK],
+[AC_ARG_ENABLE([dependency-tracking], [dnl
+AS_HELP_STRING(
+  [--enable-dependency-tracking],
+  [do not reject slow dependency extractors])
+AS_HELP_STRING(
+  [--disable-dependency-tracking],
+  [speeds up one-time build])])
+if test "x$enable_dependency_tracking" != xno; then
+  am_depcomp="$ac_aux_dir/depcomp"
+  AMDEPBACKSLASH='\'
+  am__nodep='_no'
+fi
+AM_CONDITIONAL([AMDEP], [test "x$enable_dependency_tracking" != xno])
+AC_SUBST([AMDEPBACKSLASH])dnl
+_AM_SUBST_NOTMAKE([AMDEPBACKSLASH])dnl
+AC_SUBST([am__nodep])dnl
+_AM_SUBST_NOTMAKE([am__nodep])dnl
+])
+
+# Generate code to set up dependency tracking.              -*- Autoconf -*-
+
+# Copyright (C) 1999-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_OUTPUT_DEPENDENCY_COMMANDS
+# ------------------------------
+AC_DEFUN([_AM_OUTPUT_DEPENDENCY_COMMANDS],
+[{
+  # Older Autoconf quotes --file arguments for eval, but not when files
+  # are listed without --file.  Let's play safe and only enable the eval
+  # if we detect the quoting.
+  # TODO: see whether this extra hack can be removed once we start
+  # requiring Autoconf 2.70 or later.
+  AS_CASE([$CONFIG_FILES],
+          [*\'*], [eval set x "$CONFIG_FILES"],
+          [*], [set x $CONFIG_FILES])
+  shift
+  # Used to flag and report bootstrapping failures.
+  am_rc=0
+  for am_mf
+  do
+    # Strip MF so we end up with the name of the file.
+    am_mf=`AS_ECHO(["$am_mf"]) | sed -e 's/:.*$//'`
+    # Check whether this is an Automake generated Makefile which includes
+    # dependency-tracking related rules and includes.
+    # Grep'ing the whole file directly is not great: AIX grep has a line
+    # limit of 2048, but all sed's we know have understand at least 4000.
+    sed -n 's,^am--depfiles:.*,X,p' "$am_mf" | grep X >/dev/null 2>&1 \
+      || continue
+    am_dirpart=`AS_DIRNAME(["$am_mf"])`
+    am_filepart=`AS_BASENAME(["$am_mf"])`
+    AM_RUN_LOG([cd "$am_dirpart" \
+      && sed -e '/# am--include-marker/d' "$am_filepart" \
+        | $MAKE -f - am--depfiles]) || am_rc=$?
+  done
+  if test $am_rc -ne 0; then
+    AC_MSG_FAILURE([Something went wrong bootstrapping makefile fragments
+    for automatic dependency tracking.  If GNU make was not used, consider
+    re-running the configure script with MAKE="gmake" (or whatever is
+    necessary).  You can also try re-running configure with the
+    '--disable-dependency-tracking' option to at least be able to build
+    the package (albeit without support for automatic dependency tracking).])
+  fi
+  AS_UNSET([am_dirpart])
+  AS_UNSET([am_filepart])
+  AS_UNSET([am_mf])
+  AS_UNSET([am_rc])
+  rm -f conftest-deps.mk
+}
+])# _AM_OUTPUT_DEPENDENCY_COMMANDS
+
+
+# AM_OUTPUT_DEPENDENCY_COMMANDS
+# -----------------------------
+# This macro should only be invoked once -- use via AC_REQUIRE.
+#
+# This code is only required when automatic dependency tracking is enabled.
+# This creates each '.Po' and '.Plo' makefile fragment that we'll need in
+# order to bootstrap the dependency handling code.
+AC_DEFUN([AM_OUTPUT_DEPENDENCY_COMMANDS],
+[AC_CONFIG_COMMANDS([depfiles],
+     [test x"$AMDEP_TRUE" != x"" || _AM_OUTPUT_DEPENDENCY_COMMANDS],
+     [AMDEP_TRUE="$AMDEP_TRUE" MAKE="${MAKE-make}"])])
+
+# Do all the work for Automake.                             -*- Autoconf -*-
+
+# Copyright (C) 1996-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This macro actually does too much.  Some checks are only needed if
+# your package does certain things.  But this isn't really a big deal.
+
+dnl Redefine AC_PROG_CC to automatically invoke _AM_PROG_CC_C_O.
+m4_define([AC_PROG_CC],
+m4_defn([AC_PROG_CC])
+[_AM_PROG_CC_C_O
+])
+
+# AM_INIT_AUTOMAKE(PACKAGE, VERSION, [NO-DEFINE])
+# AM_INIT_AUTOMAKE([OPTIONS])
+# -----------------------------------------------
+# The call with PACKAGE and VERSION arguments is the old style
+# call (pre autoconf-2.50), which is being phased out.  PACKAGE
+# and VERSION should now be passed to AC_INIT and removed from
+# the call to AM_INIT_AUTOMAKE.
+# We support both call styles for the transition.  After
+# the next Automake release, Autoconf can make the AC_INIT
+# arguments mandatory, and then we can depend on a new Autoconf
+# release and drop the old call support.
+AC_DEFUN([AM_INIT_AUTOMAKE],
+[AC_PREREQ([2.65])dnl
+m4_ifdef([_$0_ALREADY_INIT],
+  [m4_fatal([$0 expanded multiple times
+]m4_defn([_$0_ALREADY_INIT]))],
+  [m4_define([_$0_ALREADY_INIT], m4_expansion_stack)])dnl
+dnl Autoconf wants to disallow AM_ names.  We explicitly allow
+dnl the ones we care about.
+m4_pattern_allow([^AM_[A-Z]+FLAGS$])dnl
+AC_REQUIRE([AM_SET_CURRENT_AUTOMAKE_VERSION])dnl
+AC_REQUIRE([AC_PROG_INSTALL])dnl
+if test "`cd $srcdir && pwd`" != "`pwd`"; then
+  # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
+  # is not polluted with repeated "-I."
+  AC_SUBST([am__isrc], [' -I$(srcdir)'])_AM_SUBST_NOTMAKE([am__isrc])dnl
+  # test to see if srcdir already configured
+  if test -f $srcdir/config.status; then
+    AC_MSG_ERROR([source directory already configured; run "make distclean" there first])
+  fi
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+  if (cygpath --version) >/dev/null 2>/dev/null; then
+    CYGPATH_W='cygpath -w'
+  else
+    CYGPATH_W=echo
+  fi
+fi
+AC_SUBST([CYGPATH_W])
+
+# Define the identity of the package.
+dnl Distinguish between old-style and new-style calls.
+m4_ifval([$2],
+[AC_DIAGNOSE([obsolete],
+             [$0: two- and three-arguments forms are deprecated.])
+m4_ifval([$3], [_AM_SET_OPTION([no-define])])dnl
+ AC_SUBST([PACKAGE], [$1])dnl
+ AC_SUBST([VERSION], [$2])],
+[_AM_SET_OPTIONS([$1])dnl
+dnl Diagnose old-style AC_INIT with new-style AM_AUTOMAKE_INIT.
+m4_if(
+  m4_ifset([AC_PACKAGE_NAME], [ok]):m4_ifset([AC_PACKAGE_VERSION], [ok]),
+  [ok:ok],,
+  [m4_fatal([AC_INIT should be called with package and version arguments])])dnl
+ AC_SUBST([PACKAGE], ['AC_PACKAGE_TARNAME'])dnl
+ AC_SUBST([VERSION], ['AC_PACKAGE_VERSION'])])dnl
+
+_AM_IF_OPTION([no-define],,
+[AC_DEFINE_UNQUOTED([PACKAGE], ["$PACKAGE"], [Name of package])
+ AC_DEFINE_UNQUOTED([VERSION], ["$VERSION"], [Version number of package])])dnl
+
+# Some tools Automake needs.
+AC_REQUIRE([AM_SANITY_CHECK])dnl
+AC_REQUIRE([AC_ARG_PROGRAM])dnl
+AM_MISSING_PROG([ACLOCAL], [aclocal-${am__api_version}])
+AM_MISSING_PROG([AUTOCONF], [autoconf])
+AM_MISSING_PROG([AUTOMAKE], [automake-${am__api_version}])
+AM_MISSING_PROG([AUTOHEADER], [autoheader])
+AM_MISSING_PROG([MAKEINFO], [makeinfo])
+AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
+AC_REQUIRE([AM_PROG_INSTALL_STRIP])dnl
+AC_REQUIRE([AC_PROG_MKDIR_P])dnl
+# For better backward compatibility.  To be removed once Automake 1.9.x
+# dies out for good.  For more background, see:
+# <https://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
+# <https://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
+AC_SUBST([mkdir_p], ['$(MKDIR_P)'])
+# We need awk for the "check" target (and possibly the TAP driver).  The
+# system "awk" is bad on some platforms.
+AC_REQUIRE([AC_PROG_AWK])dnl
+AC_REQUIRE([AC_PROG_MAKE_SET])dnl
+AC_REQUIRE([AM_SET_LEADING_DOT])dnl
+_AM_IF_OPTION([tar-ustar], [_AM_PROG_TAR([ustar])],
+	      [_AM_IF_OPTION([tar-pax], [_AM_PROG_TAR([pax])],
+			     [_AM_PROG_TAR([v7])])])
+_AM_IF_OPTION([no-dependencies],,
+[AC_PROVIDE_IFELSE([AC_PROG_CC],
+		  [_AM_DEPENDENCIES([CC])],
+		  [m4_define([AC_PROG_CC],
+			     m4_defn([AC_PROG_CC])[_AM_DEPENDENCIES([CC])])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_CXX],
+		  [_AM_DEPENDENCIES([CXX])],
+		  [m4_define([AC_PROG_CXX],
+			     m4_defn([AC_PROG_CXX])[_AM_DEPENDENCIES([CXX])])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_OBJC],
+		  [_AM_DEPENDENCIES([OBJC])],
+		  [m4_define([AC_PROG_OBJC],
+			     m4_defn([AC_PROG_OBJC])[_AM_DEPENDENCIES([OBJC])])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_OBJCXX],
+		  [_AM_DEPENDENCIES([OBJCXX])],
+		  [m4_define([AC_PROG_OBJCXX],
+			     m4_defn([AC_PROG_OBJCXX])[_AM_DEPENDENCIES([OBJCXX])])])dnl
+])
+# Variables for tags utilities; see am/tags.am
+if test -z "$CTAGS"; then
+  CTAGS=ctags
+fi
+AC_SUBST([CTAGS])
+if test -z "$ETAGS"; then
+  ETAGS=etags
+fi
+AC_SUBST([ETAGS])
+if test -z "$CSCOPE"; then
+  CSCOPE=cscope
+fi
+AC_SUBST([CSCOPE])
+
+AC_REQUIRE([AM_SILENT_RULES])dnl
+dnl The testsuite driver may need to know about EXEEXT, so add the
+dnl 'am__EXEEXT' conditional if _AM_COMPILER_EXEEXT was seen.  This
+dnl macro is hooked onto _AC_COMPILER_EXEEXT early, see below.
+AC_CONFIG_COMMANDS_PRE(dnl
+[m4_provide_if([_AM_COMPILER_EXEEXT],
+  [AM_CONDITIONAL([am__EXEEXT], [test -n "$EXEEXT"])])])dnl
+
+# POSIX will say in a future version that running "rm -f" with no argument
+# is OK; and we want to be able to make that assumption in our Makefile
+# recipes.  So use an aggressive probe to check that the usage we want is
+# actually supported "in the wild" to an acceptable degree.
+# See automake bug#10828.
+# To make any issue more visible, cause the running configure to be aborted
+# by default if the 'rm' program in use doesn't match our expectations; the
+# user can still override this though.
+if rm -f && rm -fr && rm -rf; then : OK; else
+  cat >&2 <<'END'
+Oops!
+
+Your 'rm' program seems unable to run without file operands specified
+on the command line, even when the '-f' option is present.  This is contrary
+to the behaviour of most rm programs out there, and not conforming with
+the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
+
+Please tell bug-automake@gnu.org about your system, including the value
+of your $PATH and any error possibly output before this message.  This
+can help us improve future automake versions.
+
+END
+  if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
+    echo 'Configuration will proceed anyway, since you have set the' >&2
+    echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
+    echo >&2
+  else
+    cat >&2 <<'END'
+Aborting the configuration process, to ensure you take notice of the issue.
+
+You can download and install GNU coreutils to get an 'rm' implementation
+that behaves properly: <https://www.gnu.org/software/coreutils/>.
+
+If you want to complete the configuration process using your problematic
+'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
+to "yes", and re-run configure.
+
+END
+    AC_MSG_ERROR([Your 'rm' program is bad, sorry.])
+  fi
+fi
+dnl The trailing newline in this macro's definition is deliberate, for
+dnl backward compatibility and to allow trailing 'dnl'-style comments
+dnl after the AM_INIT_AUTOMAKE invocation. See automake bug#16841.
+])
+
+dnl Hook into '_AC_COMPILER_EXEEXT' early to learn its expansion.  Do not
+dnl add the conditional right here, as _AC_COMPILER_EXEEXT may be further
+dnl mangled by Autoconf and run in a shell conditional statement.
+m4_define([_AC_COMPILER_EXEEXT],
+m4_defn([_AC_COMPILER_EXEEXT])[m4_provide([_AM_COMPILER_EXEEXT])])
+
+# When config.status generates a header, we must update the stamp-h file.
+# This file resides in the same directory as the config header
+# that is generated.  The stamp files are numbered to have different names.
+
+# Autoconf calls _AC_AM_CONFIG_HEADER_HOOK (when defined) in the
+# loop where config.status creates the headers, so we can generate
+# our stamp files there.
+AC_DEFUN([_AC_AM_CONFIG_HEADER_HOOK],
+[# Compute $1's index in $config_headers.
+_am_arg=$1
+_am_stamp_count=1
+for _am_header in $config_headers :; do
+  case $_am_header in
+    $_am_arg | $_am_arg:* )
+      break ;;
+    * )
+      _am_stamp_count=`expr $_am_stamp_count + 1` ;;
+  esac
+done
+echo "timestamp for $_am_arg" >`AS_DIRNAME(["$_am_arg"])`/stamp-h[]$_am_stamp_count])
+
+# Copyright (C) 2001-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_PROG_INSTALL_SH
+# ------------------
+# Define $install_sh.
+AC_DEFUN([AM_PROG_INSTALL_SH],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+if test x"${install_sh+set}" != xset; then
+  case $am_aux_dir in
+  *\ * | *\	*)
+    install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
+  *)
+    install_sh="\${SHELL} $am_aux_dir/install-sh"
+  esac
+fi
+AC_SUBST([install_sh])])
+
+# Copyright (C) 2003-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# Check whether the underlying file-system supports filenames
+# with a leading dot.  For instance MS-DOS doesn't.
+AC_DEFUN([AM_SET_LEADING_DOT],
+[rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+  am__leading_dot=.
+else
+  am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+AC_SUBST([am__leading_dot])])
+
+# Check to see how 'make' treats includes.	            -*- Autoconf -*-
+
+# Copyright (C) 2001-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_MAKE_INCLUDE()
+# -----------------
+# Check whether make has an 'include' directive that can support all
+# the idioms we need for our automatic dependency tracking code.
+AC_DEFUN([AM_MAKE_INCLUDE],
+[AC_MSG_CHECKING([whether ${MAKE-make} supports the include directive])
+cat > confinc.mk << 'END'
+am__doit:
+	@echo this is the am__doit target >confinc.out
+.PHONY: am__doit
+END
+am__include="#"
+am__quote=
+# BSD make does it like this.
+echo '.include "confinc.mk" # ignored' > confmf.BSD
+# Other make implementations (GNU, Solaris 10, AIX) do it like this.
+echo 'include confinc.mk # ignored' > confmf.GNU
+_am_result=no
+for s in GNU BSD; do
+  AM_RUN_LOG([${MAKE-make} -f confmf.$s && cat confinc.out])
+  AS_CASE([$?:`cat confinc.out 2>/dev/null`],
+      ['0:this is the am__doit target'],
+      [AS_CASE([$s],
+          [BSD], [am__include='.include' am__quote='"'],
+          [am__include='include' am__quote=''])])
+  if test "$am__include" != "#"; then
+    _am_result="yes ($s style)"
+    break
+  fi
+done
+rm -f confinc.* confmf.*
+AC_MSG_RESULT([${_am_result}])
+AC_SUBST([am__include])])
+AC_SUBST([am__quote])])
+
+# Fake the existence of programs that GNU maintainers use.  -*- Autoconf -*-
+
+# Copyright (C) 1997-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_MISSING_PROG(NAME, PROGRAM)
+# ------------------------------
+AC_DEFUN([AM_MISSING_PROG],
+[AC_REQUIRE([AM_MISSING_HAS_RUN])
+$1=${$1-"${am_missing_run}$2"}
+AC_SUBST($1)])
+
+# AM_MISSING_HAS_RUN
+# ------------------
+# Define MISSING if not defined so far and test if it is modern enough.
+# If it is, set am_missing_run to use it, otherwise, to nothing.
+AC_DEFUN([AM_MISSING_HAS_RUN],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+AC_REQUIRE_AUX_FILE([missing])dnl
+if test x"${MISSING+set}" != xset; then
+  MISSING="\${SHELL} '$am_aux_dir/missing'"
+fi
+# Use eval to expand $SHELL
+if eval "$MISSING --is-lightweight"; then
+  am_missing_run="$MISSING "
+else
+  am_missing_run=
+  AC_MSG_WARN(['missing' script is too old or missing])
+fi
+])
+
+# Helper functions for option handling.                     -*- Autoconf -*-
+
+# Copyright (C) 2001-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_MANGLE_OPTION(NAME)
+# -----------------------
+AC_DEFUN([_AM_MANGLE_OPTION],
+[[_AM_OPTION_]m4_bpatsubst($1, [[^a-zA-Z0-9_]], [_])])
+
+# _AM_SET_OPTION(NAME)
+# --------------------
+# Set option NAME.  Presently that only means defining a flag for this option.
+AC_DEFUN([_AM_SET_OPTION],
+[m4_define(_AM_MANGLE_OPTION([$1]), [1])])
+
+# _AM_SET_OPTIONS(OPTIONS)
+# ------------------------
+# OPTIONS is a space-separated list of Automake options.
+AC_DEFUN([_AM_SET_OPTIONS],
+[m4_foreach_w([_AM_Option], [$1], [_AM_SET_OPTION(_AM_Option)])])
+
+# _AM_IF_OPTION(OPTION, IF-SET, [IF-NOT-SET])
+# -------------------------------------------
+# Execute IF-SET if OPTION is set, IF-NOT-SET otherwise.
+AC_DEFUN([_AM_IF_OPTION],
+[m4_ifset(_AM_MANGLE_OPTION([$1]), [$2], [$3])])
+
+# Copyright (C) 1999-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_PROG_CC_C_O
+# ---------------
+# Like AC_PROG_CC_C_O, but changed for automake.  We rewrite AC_PROG_CC
+# to automatically call this.
+AC_DEFUN([_AM_PROG_CC_C_O],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+AC_REQUIRE_AUX_FILE([compile])dnl
+AC_LANG_PUSH([C])dnl
+AC_CACHE_CHECK(
+  [whether $CC understands -c and -o together],
+  [am_cv_prog_cc_c_o],
+  [AC_LANG_CONFTEST([AC_LANG_PROGRAM([])])
+  # Make sure it works both with $CC and with simple cc.
+  # Following AC_PROG_CC_C_O, we do the test twice because some
+  # compilers refuse to overwrite an existing .o file with -o,
+  # though they will create one.
+  am_cv_prog_cc_c_o=yes
+  for am_i in 1 2; do
+    if AM_RUN_LOG([$CC -c conftest.$ac_ext -o conftest2.$ac_objext]) \
+         && test -f conftest2.$ac_objext; then
+      : OK
+    else
+      am_cv_prog_cc_c_o=no
+      break
+    fi
+  done
+  rm -f core conftest*
+  unset am_i])
+if test "$am_cv_prog_cc_c_o" != yes; then
+   # Losing compiler, so override with the script.
+   # FIXME: It is wrong to rewrite CC.
+   # But if we don't then we get into trouble of one sort or another.
+   # A longer-term fix would be to have automake use am__CC in this case,
+   # and then we could set am__CC="\$(top_srcdir)/compile \$(CC)"
+   CC="$am_aux_dir/compile $CC"
+fi
+AC_LANG_POP([C])])
+
+# For backward compatibility.
+AC_DEFUN_ONCE([AM_PROG_CC_C_O], [AC_REQUIRE([AC_PROG_CC])])
+
+# Copyright (C) 2001-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_RUN_LOG(COMMAND)
+# -------------------
+# Run COMMAND, save the exit status in ac_status, and log it.
+# (This has been adapted from Autoconf's _AC_RUN_LOG macro.)
+AC_DEFUN([AM_RUN_LOG],
+[{ echo "$as_me:$LINENO: $1" >&AS_MESSAGE_LOG_FD
+   ($1) >&AS_MESSAGE_LOG_FD 2>&AS_MESSAGE_LOG_FD
+   ac_status=$?
+   echo "$as_me:$LINENO: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
+   (exit $ac_status); }])
+
+# Check to make sure that the build environment is sane.    -*- Autoconf -*-
+
+# Copyright (C) 1996-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_SANITY_CHECK
+# ---------------
+AC_DEFUN([AM_SANITY_CHECK],
+[AC_MSG_CHECKING([whether build environment is sane])
+# Reject unsafe characters in $srcdir or the absolute working directory
+# name.  Accept space and tab only in the latter.
+am_lf='
+'
+case `pwd` in
+  *[[\\\"\#\$\&\'\`$am_lf]]*)
+    AC_MSG_ERROR([unsafe absolute working directory name]);;
+esac
+case $srcdir in
+  *[[\\\"\#\$\&\'\`$am_lf\ \	]]*)
+    AC_MSG_ERROR([unsafe srcdir value: '$srcdir']);;
+esac
+
+# Do 'set' in a subshell so we don't clobber the current shell's
+# arguments.  Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+   am_has_slept=no
+   for am_try in 1 2; do
+     echo "timestamp, slept: $am_has_slept" > conftest.file
+     set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
+     if test "$[*]" = "X"; then
+	# -L didn't work.
+	set X `ls -t "$srcdir/configure" conftest.file`
+     fi
+     if test "$[*]" != "X $srcdir/configure conftest.file" \
+	&& test "$[*]" != "X conftest.file $srcdir/configure"; then
+
+	# If neither matched, then we have a broken ls.  This can happen
+	# if, for instance, CONFIG_SHELL is bash and it inherits a
+	# broken ls alias from the environment.  This has actually
+	# happened.  Such a system could not be considered "sane".
+	AC_MSG_ERROR([ls -t appears to fail.  Make sure there is not a broken
+  alias in your environment])
+     fi
+     if test "$[2]" = conftest.file || test $am_try -eq 2; then
+       break
+     fi
+     # Just in case.
+     sleep 1
+     am_has_slept=yes
+   done
+   test "$[2]" = conftest.file
+   )
+then
+   # Ok.
+   :
+else
+   AC_MSG_ERROR([newly created file is older than distributed files!
+Check your system clock])
+fi
+AC_MSG_RESULT([yes])
+# If we didn't sleep, we still need to ensure time stamps of config.status and
+# generated files are strictly newer.
+am_sleep_pid=
+if grep 'slept: no' conftest.file >/dev/null 2>&1; then
+  ( sleep 1 ) &
+  am_sleep_pid=$!
+fi
+AC_CONFIG_COMMANDS_PRE(
+  [AC_MSG_CHECKING([that generated files are newer than configure])
+   if test -n "$am_sleep_pid"; then
+     # Hide warnings about reused PIDs.
+     wait $am_sleep_pid 2>/dev/null
+   fi
+   AC_MSG_RESULT([done])])
+rm -f conftest.file
+])
+
+# Copyright (C) 2009-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_SILENT_RULES([DEFAULT])
+# --------------------------
+# Enable less verbose build rules; with the default set to DEFAULT
+# ("yes" being less verbose, "no" or empty being verbose).
+AC_DEFUN([AM_SILENT_RULES],
+[AC_ARG_ENABLE([silent-rules], [dnl
+AS_HELP_STRING(
+  [--enable-silent-rules],
+  [less verbose build output (undo: "make V=1")])
+AS_HELP_STRING(
+  [--disable-silent-rules],
+  [verbose build output (undo: "make V=0")])dnl
+])
+case $enable_silent_rules in @%:@ (((
+  yes) AM_DEFAULT_VERBOSITY=0;;
+   no) AM_DEFAULT_VERBOSITY=1;;
+    *) AM_DEFAULT_VERBOSITY=m4_if([$1], [yes], [0], [1]);;
+esac
+dnl
+dnl A few 'make' implementations (e.g., NonStop OS and NextStep)
+dnl do not support nested variable expansions.
+dnl See automake bug#9928 and bug#10237.
+am_make=${MAKE-make}
+AC_CACHE_CHECK([whether $am_make supports nested variables],
+   [am_cv_make_support_nested_variables],
+   [if AS_ECHO([['TRUE=$(BAR$(V))
+BAR0=false
+BAR1=true
+V=1
+am__doit:
+	@$(TRUE)
+.PHONY: am__doit']]) | $am_make -f - >/dev/null 2>&1; then
+  am_cv_make_support_nested_variables=yes
+else
+  am_cv_make_support_nested_variables=no
+fi])
+if test $am_cv_make_support_nested_variables = yes; then
+  dnl Using '$V' instead of '$(V)' breaks IRIX make.
+  AM_V='$(V)'
+  AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
+else
+  AM_V=$AM_DEFAULT_VERBOSITY
+  AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
+fi
+AC_SUBST([AM_V])dnl
+AM_SUBST_NOTMAKE([AM_V])dnl
+AC_SUBST([AM_DEFAULT_V])dnl
+AM_SUBST_NOTMAKE([AM_DEFAULT_V])dnl
+AC_SUBST([AM_DEFAULT_VERBOSITY])dnl
+AM_BACKSLASH='\'
+AC_SUBST([AM_BACKSLASH])dnl
+_AM_SUBST_NOTMAKE([AM_BACKSLASH])dnl
+])
+
+# Copyright (C) 2001-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_PROG_INSTALL_STRIP
+# ---------------------
+# One issue with vendor 'install' (even GNU) is that you can't
+# specify the program used to strip binaries.  This is especially
+# annoying in cross-compiling environments, where the build's strip
+# is unlikely to handle the host's binaries.
+# Fortunately install-sh will honor a STRIPPROG variable, so we
+# always use install-sh in "make install-strip", and initialize
+# STRIPPROG with the value of the STRIP variable (set by the user).
+AC_DEFUN([AM_PROG_INSTALL_STRIP],
+[AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
+# Installed binaries are usually stripped using 'strip' when the user
+# run "make install-strip".  However 'strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the 'STRIP' environment variable to overrule this program.
+dnl Don't test for $cross_compiling = yes, because it might be 'maybe'.
+if test "$cross_compiling" != no; then
+  AC_CHECK_TOOL([STRIP], [strip], :)
+fi
+INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
+AC_SUBST([INSTALL_STRIP_PROGRAM])])
+
+# Copyright (C) 2006-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_SUBST_NOTMAKE(VARIABLE)
+# ---------------------------
+# Prevent Automake from outputting VARIABLE = @VARIABLE@ in Makefile.in.
+# This macro is traced by Automake.
+AC_DEFUN([_AM_SUBST_NOTMAKE])
+
+# AM_SUBST_NOTMAKE(VARIABLE)
+# --------------------------
+# Public sister of _AM_SUBST_NOTMAKE.
+AC_DEFUN([AM_SUBST_NOTMAKE], [_AM_SUBST_NOTMAKE($@)])
+
+# Check how to create a tarball.                            -*- Autoconf -*-
+
+# Copyright (C) 2004-2021 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_PROG_TAR(FORMAT)
+# --------------------
+# Check how to create a tarball in format FORMAT.
+# FORMAT should be one of 'v7', 'ustar', or 'pax'.
+#
+# Substitute a variable $(am__tar) that is a command
+# writing to stdout a FORMAT-tarball containing the directory
+# $tardir.
+#     tardir=directory && $(am__tar) > result.tar
+#
+# Substitute a variable $(am__untar) that extract such
+# a tarball read from stdin.
+#     $(am__untar) < result.tar
+#
+AC_DEFUN([_AM_PROG_TAR],
+[# Always define AMTAR for backward compatibility.  Yes, it's still used
+# in the wild :-(  We should find a proper way to deprecate it ...
+AC_SUBST([AMTAR], ['$${TAR-tar}'])
+
+# We'll loop over all known methods to create a tar archive until one works.
+_am_tools='gnutar m4_if([$1], [ustar], [plaintar]) pax cpio none'
+
+m4_if([$1], [v7],
+  [am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'],
+
+  [m4_case([$1],
+    [ustar],
+     [# The POSIX 1988 'ustar' format is defined with fixed-size fields.
+      # There is notably a 21 bits limit for the UID and the GID.  In fact,
+      # the 'pax' utility can hang on bigger UID/GID (see automake bug#8343
+      # and bug#13588).
+      am_max_uid=2097151 # 2^21 - 1
+      am_max_gid=$am_max_uid
+      # The $UID and $GID variables are not portable, so we need to resort
+      # to the POSIX-mandated id(1) utility.  Errors in the 'id' calls
+      # below are definitely unexpected, so allow the users to see them
+      # (that is, avoid stderr redirection).
+      am_uid=`id -u || echo unknown`
+      am_gid=`id -g || echo unknown`
+      AC_MSG_CHECKING([whether UID '$am_uid' is supported by ustar format])
+      if test $am_uid -le $am_max_uid; then
+         AC_MSG_RESULT([yes])
+      else
+         AC_MSG_RESULT([no])
+         _am_tools=none
+      fi
+      AC_MSG_CHECKING([whether GID '$am_gid' is supported by ustar format])
+      if test $am_gid -le $am_max_gid; then
+         AC_MSG_RESULT([yes])
+      else
+        AC_MSG_RESULT([no])
+        _am_tools=none
+      fi],
+
+  [pax],
+    [],
+
+  [m4_fatal([Unknown tar format])])
+
+  AC_MSG_CHECKING([how to create a $1 tar archive])
+
+  # Go ahead even if we have the value already cached.  We do so because we
+  # need to set the values for the 'am__tar' and 'am__untar' variables.
+  _am_tools=${am_cv_prog_tar_$1-$_am_tools}
+
+  for _am_tool in $_am_tools; do
+    case $_am_tool in
+    gnutar)
+      for _am_tar in tar gnutar gtar; do
+        AM_RUN_LOG([$_am_tar --version]) && break
+      done
+      am__tar="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$$tardir"'
+      am__tar_="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$tardir"'
+      am__untar="$_am_tar -xf -"
+      ;;
+    plaintar)
+      # Must skip GNU tar: if it does not support --format= it doesn't create
+      # ustar tarball either.
+      (tar --version) >/dev/null 2>&1 && continue
+      am__tar='tar chf - "$$tardir"'
+      am__tar_='tar chf - "$tardir"'
+      am__untar='tar xf -'
+      ;;
+    pax)
+      am__tar='pax -L -x $1 -w "$$tardir"'
+      am__tar_='pax -L -x $1 -w "$tardir"'
+      am__untar='pax -r'
+      ;;
+    cpio)
+      am__tar='find "$$tardir" -print | cpio -o -H $1 -L'
+      am__tar_='find "$tardir" -print | cpio -o -H $1 -L'
+      am__untar='cpio -i -H $1 -d'
+      ;;
+    none)
+      am__tar=false
+      am__tar_=false
+      am__untar=false
+      ;;
+    esac
+
+    # If the value was cached, stop now.  We just wanted to have am__tar
+    # and am__untar set.
+    test -n "${am_cv_prog_tar_$1}" && break
+
+    # tar/untar a dummy directory, and stop if the command works.
+    rm -rf conftest.dir
+    mkdir conftest.dir
+    echo GrepMe > conftest.dir/file
+    AM_RUN_LOG([tardir=conftest.dir && eval $am__tar_ >conftest.tar])
+    rm -rf conftest.dir
+    if test -s conftest.tar; then
+      AM_RUN_LOG([$am__untar <conftest.tar])
+      AM_RUN_LOG([cat conftest.dir/file])
+      grep GrepMe conftest.dir/file >/dev/null 2>&1 && break
+    fi
+  done
+  rm -rf conftest.dir
+
+  AC_CACHE_VAL([am_cv_prog_tar_$1], [am_cv_prog_tar_$1=$_am_tool])
+  AC_MSG_RESULT([$am_cv_prog_tar_$1])])
+
+AC_SUBST([am__tar])
+AC_SUBST([am__untar])
+]) # _AM_PROG_TAR
+
diff --git a/azure-pipelines.yml b/azure-pipelines.yml
deleted file mode 100644
index 80d6774..0000000
--- a/azure-pipelines.yml
+++ /dev/null
@@ -1,17 +0,0 @@
-jobs:
-- job: linux
-  pool:
-    vmImage: Ubuntu 16.04
-  steps:
-  - script: |
-      sudo apt-get update -qq
-      sudo apt-get install -qq software-properties-common
-      sudo add-apt-repository -y ppa:ubuntu-toolchain-r/test
-      sudo apt-get update -qq
-      sudo apt-get install -qq autoconf automake gcc g++ make
-    displayName: Install common
-  - script: |
-      ./autogen.sh
-      ./configure
-      make distcheck
-    displayName: Compilation and unit test
diff --git a/compile b/compile
new file mode 100755
index 0000000..df363c8
--- /dev/null
+++ b/compile
@@ -0,0 +1,348 @@
+#! /bin/sh
+# Wrapper for compilers which do not understand '-c -o'.
+
+scriptversion=2018-03-07.03; # UTC
+
+# Copyright (C) 1999-2021 Free Software Foundation, Inc.
+# Written by Tom Tromey <tromey@cygnus.com>.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+#
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# This file is maintained in Automake, please report
+# bugs to <bug-automake@gnu.org> or send patches to
+# <automake-patches@gnu.org>.
+
+nl='
+'
+
+# We need space, tab and new line, in precisely that order.  Quoting is
+# there to prevent tools from complaining about whitespace usage.
+IFS=" ""	$nl"
+
+file_conv=
+
+# func_file_conv build_file lazy
+# Convert a $build file to $host form and store it in $file
+# Currently only supports Windows hosts. If the determined conversion
+# type is listed in (the comma separated) LAZY, no conversion will
+# take place.
+func_file_conv ()
+{
+  file=$1
+  case $file in
+    / | /[!/]*) # absolute file, and not a UNC file
+      if test -z "$file_conv"; then
+	# lazily determine how to convert abs files
+	case `uname -s` in
+	  MINGW*)
+	    file_conv=mingw
+	    ;;
+	  CYGWIN* | MSYS*)
+	    file_conv=cygwin
+	    ;;
+	  *)
+	    file_conv=wine
+	    ;;
+	esac
+      fi
+      case $file_conv/,$2, in
+	*,$file_conv,*)
+	  ;;
+	mingw/*)
+	  file=`cmd //C echo "$file " | sed -e 's/"\(.*\) " *$/\1/'`
+	  ;;
+	cygwin/* | msys/*)
+	  file=`cygpath -m "$file" || echo "$file"`
+	  ;;
+	wine/*)
+	  file=`winepath -w "$file" || echo "$file"`
+	  ;;
+      esac
+      ;;
+  esac
+}
+
+# func_cl_dashL linkdir
+# Make cl look for libraries in LINKDIR
+func_cl_dashL ()
+{
+  func_file_conv "$1"
+  if test -z "$lib_path"; then
+    lib_path=$file
+  else
+    lib_path="$lib_path;$file"
+  fi
+  linker_opts="$linker_opts -LIBPATH:$file"
+}
+
+# func_cl_dashl library
+# Do a library search-path lookup for cl
+func_cl_dashl ()
+{
+  lib=$1
+  found=no
+  save_IFS=$IFS
+  IFS=';'
+  for dir in $lib_path $LIB
+  do
+    IFS=$save_IFS
+    if $shared && test -f "$dir/$lib.dll.lib"; then
+      found=yes
+      lib=$dir/$lib.dll.lib
+      break
+    fi
+    if test -f "$dir/$lib.lib"; then
+      found=yes
+      lib=$dir/$lib.lib
+      break
+    fi
+    if test -f "$dir/lib$lib.a"; then
+      found=yes
+      lib=$dir/lib$lib.a
+      break
+    fi
+  done
+  IFS=$save_IFS
+
+  if test "$found" != yes; then
+    lib=$lib.lib
+  fi
+}
+
+# func_cl_wrapper cl arg...
+# Adjust compile command to suit cl
+func_cl_wrapper ()
+{
+  # Assume a capable shell
+  lib_path=
+  shared=:
+  linker_opts=
+  for arg
+  do
+    if test -n "$eat"; then
+      eat=
+    else
+      case $1 in
+	-o)
+	  # configure might choose to run compile as 'compile cc -o foo foo.c'.
+	  eat=1
+	  case $2 in
+	    *.o | *.[oO][bB][jJ])
+	      func_file_conv "$2"
+	      set x "$@" -Fo"$file"
+	      shift
+	      ;;
+	    *)
+	      func_file_conv "$2"
+	      set x "$@" -Fe"$file"
+	      shift
+	      ;;
+	  esac
+	  ;;
+	-I)
+	  eat=1
+	  func_file_conv "$2" mingw
+	  set x "$@" -I"$file"
+	  shift
+	  ;;
+	-I*)
+	  func_file_conv "${1#-I}" mingw
+	  set x "$@" -I"$file"
+	  shift
+	  ;;
+	-l)
+	  eat=1
+	  func_cl_dashl "$2"
+	  set x "$@" "$lib"
+	  shift
+	  ;;
+	-l*)
+	  func_cl_dashl "${1#-l}"
+	  set x "$@" "$lib"
+	  shift
+	  ;;
+	-L)
+	  eat=1
+	  func_cl_dashL "$2"
+	  ;;
+	-L*)
+	  func_cl_dashL "${1#-L}"
+	  ;;
+	-static)
+	  shared=false
+	  ;;
+	-Wl,*)
+	  arg=${1#-Wl,}
+	  save_ifs="$IFS"; IFS=','
+	  for flag in $arg; do
+	    IFS="$save_ifs"
+	    linker_opts="$linker_opts $flag"
+	  done
+	  IFS="$save_ifs"
+	  ;;
+	-Xlinker)
+	  eat=1
+	  linker_opts="$linker_opts $2"
+	  ;;
+	-*)
+	  set x "$@" "$1"
+	  shift
+	  ;;
+	*.cc | *.CC | *.cxx | *.CXX | *.[cC]++)
+	  func_file_conv "$1"
+	  set x "$@" -Tp"$file"
+	  shift
+	  ;;
+	*.c | *.cpp | *.CPP | *.lib | *.LIB | *.Lib | *.OBJ | *.obj | *.[oO])
+	  func_file_conv "$1" mingw
+	  set x "$@" "$file"
+	  shift
+	  ;;
+	*)
+	  set x "$@" "$1"
+	  shift
+	  ;;
+      esac
+    fi
+    shift
+  done
+  if test -n "$linker_opts"; then
+    linker_opts="-link$linker_opts"
+  fi
+  exec "$@" $linker_opts
+  exit 1
+}
+
+eat=
+
+case $1 in
+  '')
+     echo "$0: No command.  Try '$0 --help' for more information." 1>&2
+     exit 1;
+     ;;
+  -h | --h*)
+    cat <<\EOF
+Usage: compile [--help] [--version] PROGRAM [ARGS]
+
+Wrapper for compilers which do not understand '-c -o'.
+Remove '-o dest.o' from ARGS, run PROGRAM with the remaining
+arguments, and rename the output as expected.
+
+If you are trying to build a whole package this is not the
+right script to run: please start by reading the file 'INSTALL'.
+
+Report bugs to <bug-automake@gnu.org>.
+EOF
+    exit $?
+    ;;
+  -v | --v*)
+    echo "compile $scriptversion"
+    exit $?
+    ;;
+  cl | *[/\\]cl | cl.exe | *[/\\]cl.exe | \
+  icl | *[/\\]icl | icl.exe | *[/\\]icl.exe )
+    func_cl_wrapper "$@"      # Doesn't return...
+    ;;
+esac
+
+ofile=
+cfile=
+
+for arg
+do
+  if test -n "$eat"; then
+    eat=
+  else
+    case $1 in
+      -o)
+	# configure might choose to run compile as 'compile cc -o foo foo.c'.
+	# So we strip '-o arg' only if arg is an object.
+	eat=1
+	case $2 in
+	  *.o | *.obj)
+	    ofile=$2
+	    ;;
+	  *)
+	    set x "$@" -o "$2"
+	    shift
+	    ;;
+	esac
+	;;
+      *.c)
+	cfile=$1
+	set x "$@" "$1"
+	shift
+	;;
+      *)
+	set x "$@" "$1"
+	shift
+	;;
+    esac
+  fi
+  shift
+done
+
+if test -z "$ofile" || test -z "$cfile"; then
+  # If no '-o' option was seen then we might have been invoked from a
+  # pattern rule where we don't need one.  That is ok -- this is a
+  # normal compilation that the losing compiler can handle.  If no
+  # '.c' file was seen then we are probably linking.  That is also
+  # ok.
+  exec "$@"
+fi
+
+# Name of file we expect compiler to create.
+cofile=`echo "$cfile" | sed 's|^.*[\\/]||; s|^[a-zA-Z]:||; s/\.c$/.o/'`
+
+# Create the lock directory.
+# Note: use '[/\\:.-]' here to ensure that we don't use the same name
+# that we are using for the .o file.  Also, base the name on the expected
+# object file name, since that is what matters with a parallel build.
+lockdir=`echo "$cofile" | sed -e 's|[/\\:.-]|_|g'`.d
+while true; do
+  if mkdir "$lockdir" >/dev/null 2>&1; then
+    break
+  fi
+  sleep 1
+done
+# FIXME: race condition here if user kills between mkdir and trap.
+trap "rmdir '$lockdir'; exit 1" 1 2 15
+
+# Run the compile.
+"$@"
+ret=$?
+
+if test -f "$cofile"; then
+  test "$cofile" = "$ofile" || mv "$cofile" "$ofile"
+elif test -f "${cofile}bj"; then
+  test "${cofile}bj" = "$ofile" || mv "${cofile}bj" "$ofile"
+fi
+
+rmdir "$lockdir"
+exit $ret
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC0"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/config.guess b/config.guess
new file mode 100755
index 0000000..7f76b62
--- /dev/null
+++ b/config.guess
@@ -0,0 +1,1754 @@
+#! /bin/sh
+# Attempt to guess a canonical system name.
+#   Copyright 1992-2022 Free Software Foundation, Inc.
+
+# shellcheck disable=SC2006,SC2268 # see below for rationale
+
+timestamp='2022-01-09'
+
+# This file is free software; you can redistribute it and/or modify it
+# under the terms of the GNU General Public License as published by
+# the Free Software Foundation, either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>.
+#
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that
+# program.  This Exception is an additional permission under section 7
+# of the GNU General Public License, version 3 ("GPLv3").
+#
+# Originally written by Per Bothner; maintained since 2000 by Ben Elliston.
+#
+# You can get the latest version of this script from:
+# https://git.savannah.gnu.org/cgit/config.git/plain/config.guess
+#
+# Please send patches to <config-patches@gnu.org>.
+
+
+# The "shellcheck disable" line above the timestamp inhibits complaints
+# about features and limitations of the classic Bourne shell that were
+# superseded or lifted in POSIX.  However, this script identifies a wide
+# variety of pre-POSIX systems that do not have POSIX shells at all, and
+# even some reasonably current systems (Solaris 10 as case-in-point) still
+# have a pre-POSIX /bin/sh.
+
+
+me=`echo "$0" | sed -e 's,.*/,,'`
+
+usage="\
+Usage: $0 [OPTION]
+
+Output the configuration name of the system \`$me' is run on.
+
+Options:
+  -h, --help         print this help, then exit
+  -t, --time-stamp   print date of last modification, then exit
+  -v, --version      print version number, then exit
+
+Report bugs and patches to <config-patches@gnu.org>."
+
+version="\
+GNU config.guess ($timestamp)
+
+Originally written by Per Bothner.
+Copyright 1992-2022 Free Software Foundation, Inc.
+
+This is free software; see the source for copying conditions.  There is NO
+warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."
+
+help="
+Try \`$me --help' for more information."
+
+# Parse command line
+while test $# -gt 0 ; do
+  case $1 in
+    --time-stamp | --time* | -t )
+       echo "$timestamp" ; exit ;;
+    --version | -v )
+       echo "$version" ; exit ;;
+    --help | --h* | -h )
+       echo "$usage"; exit ;;
+    -- )     # Stop option processing
+       shift; break ;;
+    - )	# Use stdin as input.
+       break ;;
+    -* )
+       echo "$me: invalid option $1$help" >&2
+       exit 1 ;;
+    * )
+       break ;;
+  esac
+done
+
+if test $# != 0; then
+  echo "$me: too many arguments$help" >&2
+  exit 1
+fi
+
+# Just in case it came from the environment.
+GUESS=
+
+# CC_FOR_BUILD -- compiler used by this script. Note that the use of a
+# compiler to aid in system detection is discouraged as it requires
+# temporary files to be created and, as you can see below, it is a
+# headache to deal with in a portable fashion.
+
+# Historically, `CC_FOR_BUILD' used to be named `HOST_CC'. We still
+# use `HOST_CC' if defined, but it is deprecated.
+
+# Portable tmp directory creation inspired by the Autoconf team.
+
+tmp=
+# shellcheck disable=SC2172
+trap 'test -z "$tmp" || rm -fr "$tmp"' 0 1 2 13 15
+
+set_cc_for_build() {
+    # prevent multiple calls if $tmp is already set
+    test "$tmp" && return 0
+    : "${TMPDIR=/tmp}"
+    # shellcheck disable=SC2039,SC3028
+    { tmp=`(umask 077 && mktemp -d "$TMPDIR/cgXXXXXX") 2>/dev/null` && test -n "$tmp" && test -d "$tmp" ; } ||
+	{ test -n "$RANDOM" && tmp=$TMPDIR/cg$$-$RANDOM && (umask 077 && mkdir "$tmp" 2>/dev/null) ; } ||
+	{ tmp=$TMPDIR/cg-$$ && (umask 077 && mkdir "$tmp" 2>/dev/null) && echo "Warning: creating insecure temp directory" >&2 ; } ||
+	{ echo "$me: cannot create a temporary directory in $TMPDIR" >&2 ; exit 1 ; }
+    dummy=$tmp/dummy
+    case ${CC_FOR_BUILD-},${HOST_CC-},${CC-} in
+	,,)    echo "int x;" > "$dummy.c"
+	       for driver in cc gcc c89 c99 ; do
+		   if ($driver -c -o "$dummy.o" "$dummy.c") >/dev/null 2>&1 ; then
+		       CC_FOR_BUILD=$driver
+		       break
+		   fi
+	       done
+	       if test x"$CC_FOR_BUILD" = x ; then
+		   CC_FOR_BUILD=no_compiler_found
+	       fi
+	       ;;
+	,,*)   CC_FOR_BUILD=$CC ;;
+	,*,*)  CC_FOR_BUILD=$HOST_CC ;;
+    esac
+}
+
+# This is needed to find uname on a Pyramid OSx when run in the BSD universe.
+# (ghazi@noc.rutgers.edu 1994-08-24)
+if test -f /.attbin/uname ; then
+	PATH=$PATH:/.attbin ; export PATH
+fi
+
+UNAME_MACHINE=`(uname -m) 2>/dev/null` || UNAME_MACHINE=unknown
+UNAME_RELEASE=`(uname -r) 2>/dev/null` || UNAME_RELEASE=unknown
+UNAME_SYSTEM=`(uname -s) 2>/dev/null` || UNAME_SYSTEM=unknown
+UNAME_VERSION=`(uname -v) 2>/dev/null` || UNAME_VERSION=unknown
+
+case $UNAME_SYSTEM in
+Linux|GNU|GNU/*)
+	LIBC=unknown
+
+	set_cc_for_build
+	cat <<-EOF > "$dummy.c"
+	#include <features.h>
+	#if defined(__UCLIBC__)
+	LIBC=uclibc
+	#elif defined(__dietlibc__)
+	LIBC=dietlibc
+	#elif defined(__GLIBC__)
+	LIBC=gnu
+	#else
+	#include <stdarg.h>
+	/* First heuristic to detect musl libc.  */
+	#ifdef __DEFINED_va_list
+	LIBC=musl
+	#endif
+	#endif
+	EOF
+	cc_set_libc=`$CC_FOR_BUILD -E "$dummy.c" 2>/dev/null | grep '^LIBC' | sed 's, ,,g'`
+	eval "$cc_set_libc"
+
+	# Second heuristic to detect musl libc.
+	if [ "$LIBC" = unknown ] &&
+	   command -v ldd >/dev/null &&
+	   ldd --version 2>&1 | grep -q ^musl; then
+		LIBC=musl
+	fi
+
+	# If the system lacks a compiler, then just pick glibc.
+	# We could probably try harder.
+	if [ "$LIBC" = unknown ]; then
+		LIBC=gnu
+	fi
+	;;
+esac
+
+# Note: order is significant - the case branches are not exclusive.
+
+case $UNAME_MACHINE:$UNAME_SYSTEM:$UNAME_RELEASE:$UNAME_VERSION in
+    *:NetBSD:*:*)
+	# NetBSD (nbsd) targets should (where applicable) match one or
+	# more of the tuples: *-*-netbsdelf*, *-*-netbsdaout*,
+	# *-*-netbsdecoff* and *-*-netbsd*.  For targets that recently
+	# switched to ELF, *-*-netbsd* would select the old
+	# object file format.  This provides both forward
+	# compatibility and a consistent mechanism for selecting the
+	# object file format.
+	#
+	# Note: NetBSD doesn't particularly care about the vendor
+	# portion of the name.  We always set it to "unknown".
+	UNAME_MACHINE_ARCH=`(uname -p 2>/dev/null || \
+	    /sbin/sysctl -n hw.machine_arch 2>/dev/null || \
+	    /usr/sbin/sysctl -n hw.machine_arch 2>/dev/null || \
+	    echo unknown)`
+	case $UNAME_MACHINE_ARCH in
+	    aarch64eb) machine=aarch64_be-unknown ;;
+	    armeb) machine=armeb-unknown ;;
+	    arm*) machine=arm-unknown ;;
+	    sh3el) machine=shl-unknown ;;
+	    sh3eb) machine=sh-unknown ;;
+	    sh5el) machine=sh5le-unknown ;;
+	    earmv*)
+		arch=`echo "$UNAME_MACHINE_ARCH" | sed -e 's,^e\(armv[0-9]\).*$,\1,'`
+		endian=`echo "$UNAME_MACHINE_ARCH" | sed -ne 's,^.*\(eb\)$,\1,p'`
+		machine=${arch}${endian}-unknown
+		;;
+	    *) machine=$UNAME_MACHINE_ARCH-unknown ;;
+	esac
+	# The Operating System including object format, if it has switched
+	# to ELF recently (or will in the future) and ABI.
+	case $UNAME_MACHINE_ARCH in
+	    earm*)
+		os=netbsdelf
+		;;
+	    arm*|i386|m68k|ns32k|sh3*|sparc|vax)
+		set_cc_for_build
+		if echo __ELF__ | $CC_FOR_BUILD -E - 2>/dev/null \
+			| grep -q __ELF__
+		then
+		    # Once all utilities can be ECOFF (netbsdecoff) or a.out (netbsdaout).
+		    # Return netbsd for either.  FIX?
+		    os=netbsd
+		else
+		    os=netbsdelf
+		fi
+		;;
+	    *)
+		os=netbsd
+		;;
+	esac
+	# Determine ABI tags.
+	case $UNAME_MACHINE_ARCH in
+	    earm*)
+		expr='s/^earmv[0-9]/-eabi/;s/eb$//'
+		abi=`echo "$UNAME_MACHINE_ARCH" | sed -e "$expr"`
+		;;
+	esac
+	# The OS release
+	# Debian GNU/NetBSD machines have a different userland, and
+	# thus, need a distinct triplet. However, they do not need
+	# kernel version information, so it can be replaced with a
+	# suitable tag, in the style of linux-gnu.
+	case $UNAME_VERSION in
+	    Debian*)
+		release='-gnu'
+		;;
+	    *)
+		release=`echo "$UNAME_RELEASE" | sed -e 's/[-_].*//' | cut -d. -f1,2`
+		;;
+	esac
+	# Since CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM:
+	# contains redundant information, the shorter form:
+	# CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM is used.
+	GUESS=$machine-${os}${release}${abi-}
+	;;
+    *:Bitrig:*:*)
+	UNAME_MACHINE_ARCH=`arch | sed 's/Bitrig.//'`
+	GUESS=$UNAME_MACHINE_ARCH-unknown-bitrig$UNAME_RELEASE
+	;;
+    *:OpenBSD:*:*)
+	UNAME_MACHINE_ARCH=`arch | sed 's/OpenBSD.//'`
+	GUESS=$UNAME_MACHINE_ARCH-unknown-openbsd$UNAME_RELEASE
+	;;
+    *:SecBSD:*:*)
+	UNAME_MACHINE_ARCH=`arch | sed 's/SecBSD.//'`
+	GUESS=$UNAME_MACHINE_ARCH-unknown-secbsd$UNAME_RELEASE
+	;;
+    *:LibertyBSD:*:*)
+	UNAME_MACHINE_ARCH=`arch | sed 's/^.*BSD\.//'`
+	GUESS=$UNAME_MACHINE_ARCH-unknown-libertybsd$UNAME_RELEASE
+	;;
+    *:MidnightBSD:*:*)
+	GUESS=$UNAME_MACHINE-unknown-midnightbsd$UNAME_RELEASE
+	;;
+    *:ekkoBSD:*:*)
+	GUESS=$UNAME_MACHINE-unknown-ekkobsd$UNAME_RELEASE
+	;;
+    *:SolidBSD:*:*)
+	GUESS=$UNAME_MACHINE-unknown-solidbsd$UNAME_RELEASE
+	;;
+    *:OS108:*:*)
+	GUESS=$UNAME_MACHINE-unknown-os108_$UNAME_RELEASE
+	;;
+    macppc:MirBSD:*:*)
+	GUESS=powerpc-unknown-mirbsd$UNAME_RELEASE
+	;;
+    *:MirBSD:*:*)
+	GUESS=$UNAME_MACHINE-unknown-mirbsd$UNAME_RELEASE
+	;;
+    *:Sortix:*:*)
+	GUESS=$UNAME_MACHINE-unknown-sortix
+	;;
+    *:Twizzler:*:*)
+	GUESS=$UNAME_MACHINE-unknown-twizzler
+	;;
+    *:Redox:*:*)
+	GUESS=$UNAME_MACHINE-unknown-redox
+	;;
+    mips:OSF1:*.*)
+	GUESS=mips-dec-osf1
+	;;
+    alpha:OSF1:*:*)
+	# Reset EXIT trap before exiting to avoid spurious non-zero exit code.
+	trap '' 0
+	case $UNAME_RELEASE in
+	*4.0)
+		UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $3}'`
+		;;
+	*5.*)
+		UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $4}'`
+		;;
+	esac
+	# According to Compaq, /usr/sbin/psrinfo has been available on
+	# OSF/1 and Tru64 systems produced since 1995.  I hope that
+	# covers most systems running today.  This code pipes the CPU
+	# types through head -n 1, so we only detect the type of CPU 0.
+	ALPHA_CPU_TYPE=`/usr/sbin/psrinfo -v | sed -n -e 's/^  The alpha \(.*\) processor.*$/\1/p' | head -n 1`
+	case $ALPHA_CPU_TYPE in
+	    "EV4 (21064)")
+		UNAME_MACHINE=alpha ;;
+	    "EV4.5 (21064)")
+		UNAME_MACHINE=alpha ;;
+	    "LCA4 (21066/21068)")
+		UNAME_MACHINE=alpha ;;
+	    "EV5 (21164)")
+		UNAME_MACHINE=alphaev5 ;;
+	    "EV5.6 (21164A)")
+		UNAME_MACHINE=alphaev56 ;;
+	    "EV5.6 (21164PC)")
+		UNAME_MACHINE=alphapca56 ;;
+	    "EV5.7 (21164PC)")
+		UNAME_MACHINE=alphapca57 ;;
+	    "EV6 (21264)")
+		UNAME_MACHINE=alphaev6 ;;
+	    "EV6.7 (21264A)")
+		UNAME_MACHINE=alphaev67 ;;
+	    "EV6.8CB (21264C)")
+		UNAME_MACHINE=alphaev68 ;;
+	    "EV6.8AL (21264B)")
+		UNAME_MACHINE=alphaev68 ;;
+	    "EV6.8CX (21264D)")
+		UNAME_MACHINE=alphaev68 ;;
+	    "EV6.9A (21264/EV69A)")
+		UNAME_MACHINE=alphaev69 ;;
+	    "EV7 (21364)")
+		UNAME_MACHINE=alphaev7 ;;
+	    "EV7.9 (21364A)")
+		UNAME_MACHINE=alphaev79 ;;
+	esac
+	# A Pn.n version is a patched version.
+	# A Vn.n version is a released version.
+	# A Tn.n version is a released field test version.
+	# A Xn.n version is an unreleased experimental baselevel.
+	# 1.2 uses "1.2" for uname -r.
+	OSF_REL=`echo "$UNAME_RELEASE" | sed -e 's/^[PVTX]//' | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz`
+	GUESS=$UNAME_MACHINE-dec-osf$OSF_REL
+	;;
+    Amiga*:UNIX_System_V:4.0:*)
+	GUESS=m68k-unknown-sysv4
+	;;
+    *:[Aa]miga[Oo][Ss]:*:*)
+	GUESS=$UNAME_MACHINE-unknown-amigaos
+	;;
+    *:[Mm]orph[Oo][Ss]:*:*)
+	GUESS=$UNAME_MACHINE-unknown-morphos
+	;;
+    *:OS/390:*:*)
+	GUESS=i370-ibm-openedition
+	;;
+    *:z/VM:*:*)
+	GUESS=s390-ibm-zvmoe
+	;;
+    *:OS400:*:*)
+	GUESS=powerpc-ibm-os400
+	;;
+    arm:RISC*:1.[012]*:*|arm:riscix:1.[012]*:*)
+	GUESS=arm-acorn-riscix$UNAME_RELEASE
+	;;
+    arm*:riscos:*:*|arm*:RISCOS:*:*)
+	GUESS=arm-unknown-riscos
+	;;
+    SR2?01:HI-UX/MPP:*:* | SR8000:HI-UX/MPP:*:*)
+	GUESS=hppa1.1-hitachi-hiuxmpp
+	;;
+    Pyramid*:OSx*:*:* | MIS*:OSx*:*:* | MIS*:SMP_DC-OSx*:*:*)
+	# akee@wpdis03.wpafb.af.mil (Earle F. Ake) contributed MIS and NILE.
+	case `(/bin/universe) 2>/dev/null` in
+	    att) GUESS=pyramid-pyramid-sysv3 ;;
+	    *)   GUESS=pyramid-pyramid-bsd   ;;
+	esac
+	;;
+    NILE*:*:*:dcosx)
+	GUESS=pyramid-pyramid-svr4
+	;;
+    DRS?6000:unix:4.0:6*)
+	GUESS=sparc-icl-nx6
+	;;
+    DRS?6000:UNIX_SV:4.2*:7* | DRS?6000:isis:4.2*:7*)
+	case `/usr/bin/uname -p` in
+	    sparc) GUESS=sparc-icl-nx7 ;;
+	esac
+	;;
+    s390x:SunOS:*:*)
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*//'`
+	GUESS=$UNAME_MACHINE-ibm-solaris2$SUN_REL
+	;;
+    sun4H:SunOS:5.*:*)
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*//'`
+	GUESS=sparc-hal-solaris2$SUN_REL
+	;;
+    sun4*:SunOS:5.*:* | tadpole*:SunOS:5.*:*)
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*//'`
+	GUESS=sparc-sun-solaris2$SUN_REL
+	;;
+    i86pc:AuroraUX:5.*:* | i86xen:AuroraUX:5.*:*)
+	GUESS=i386-pc-auroraux$UNAME_RELEASE
+	;;
+    i86pc:SunOS:5.*:* | i86xen:SunOS:5.*:*)
+	set_cc_for_build
+	SUN_ARCH=i386
+	# If there is a compiler, see if it is configured for 64-bit objects.
+	# Note that the Sun cc does not turn __LP64__ into 1 like gcc does.
+	# This test works for both compilers.
+	if test "$CC_FOR_BUILD" != no_compiler_found; then
+	    if (echo '#ifdef __amd64'; echo IS_64BIT_ARCH; echo '#endif') | \
+		(CCOPTS="" $CC_FOR_BUILD -m64 -E - 2>/dev/null) | \
+		grep IS_64BIT_ARCH >/dev/null
+	    then
+		SUN_ARCH=x86_64
+	    fi
+	fi
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*//'`
+	GUESS=$SUN_ARCH-pc-solaris2$SUN_REL
+	;;
+    sun4*:SunOS:6*:*)
+	# According to config.sub, this is the proper way to canonicalize
+	# SunOS6.  Hard to guess exactly what SunOS6 will be like, but
+	# it's likely to be more like Solaris than SunOS4.
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*//'`
+	GUESS=sparc-sun-solaris3$SUN_REL
+	;;
+    sun4*:SunOS:*:*)
+	case `/usr/bin/arch -k` in
+	    Series*|S4*)
+		UNAME_RELEASE=`uname -v`
+		;;
+	esac
+	# Japanese Language versions have a version number like `4.1.3-JL'.
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/-/_/'`
+	GUESS=sparc-sun-sunos$SUN_REL
+	;;
+    sun3*:SunOS:*:*)
+	GUESS=m68k-sun-sunos$UNAME_RELEASE
+	;;
+    sun*:*:4.2BSD:*)
+	UNAME_RELEASE=`(sed 1q /etc/motd | awk '{print substr($5,1,3)}') 2>/dev/null`
+	test "x$UNAME_RELEASE" = x && UNAME_RELEASE=3
+	case `/bin/arch` in
+	    sun3)
+		GUESS=m68k-sun-sunos$UNAME_RELEASE
+		;;
+	    sun4)
+		GUESS=sparc-sun-sunos$UNAME_RELEASE
+		;;
+	esac
+	;;
+    aushp:SunOS:*:*)
+	GUESS=sparc-auspex-sunos$UNAME_RELEASE
+	;;
+    # The situation for MiNT is a little confusing.  The machine name
+    # can be virtually everything (everything which is not
+    # "atarist" or "atariste" at least should have a processor
+    # > m68000).  The system name ranges from "MiNT" over "FreeMiNT"
+    # to the lowercase version "mint" (or "freemint").  Finally
+    # the system name "TOS" denotes a system which is actually not
+    # MiNT.  But MiNT is downward compatible to TOS, so this should
+    # be no problem.
+    atarist[e]:*MiNT:*:* | atarist[e]:*mint:*:* | atarist[e]:*TOS:*:*)
+	GUESS=m68k-atari-mint$UNAME_RELEASE
+	;;
+    atari*:*MiNT:*:* | atari*:*mint:*:* | atarist[e]:*TOS:*:*)
+	GUESS=m68k-atari-mint$UNAME_RELEASE
+	;;
+    *falcon*:*MiNT:*:* | *falcon*:*mint:*:* | *falcon*:*TOS:*:*)
+	GUESS=m68k-atari-mint$UNAME_RELEASE
+	;;
+    milan*:*MiNT:*:* | milan*:*mint:*:* | *milan*:*TOS:*:*)
+	GUESS=m68k-milan-mint$UNAME_RELEASE
+	;;
+    hades*:*MiNT:*:* | hades*:*mint:*:* | *hades*:*TOS:*:*)
+	GUESS=m68k-hades-mint$UNAME_RELEASE
+	;;
+    *:*MiNT:*:* | *:*mint:*:* | *:*TOS:*:*)
+	GUESS=m68k-unknown-mint$UNAME_RELEASE
+	;;
+    m68k:machten:*:*)
+	GUESS=m68k-apple-machten$UNAME_RELEASE
+	;;
+    powerpc:machten:*:*)
+	GUESS=powerpc-apple-machten$UNAME_RELEASE
+	;;
+    RISC*:Mach:*:*)
+	GUESS=mips-dec-mach_bsd4.3
+	;;
+    RISC*:ULTRIX:*:*)
+	GUESS=mips-dec-ultrix$UNAME_RELEASE
+	;;
+    VAX*:ULTRIX*:*:*)
+	GUESS=vax-dec-ultrix$UNAME_RELEASE
+	;;
+    2020:CLIX:*:* | 2430:CLIX:*:*)
+	GUESS=clipper-intergraph-clix$UNAME_RELEASE
+	;;
+    mips:*:*:UMIPS | mips:*:*:RISCos)
+	set_cc_for_build
+	sed 's/^	//' << EOF > "$dummy.c"
+#ifdef __cplusplus
+#include <stdio.h>  /* for printf() prototype */
+	int main (int argc, char *argv[]) {
+#else
+	int main (argc, argv) int argc; char *argv[]; {
+#endif
+	#if defined (host_mips) && defined (MIPSEB)
+	#if defined (SYSTYPE_SYSV)
+	  printf ("mips-mips-riscos%ssysv\\n", argv[1]); exit (0);
+	#endif
+	#if defined (SYSTYPE_SVR4)
+	  printf ("mips-mips-riscos%ssvr4\\n", argv[1]); exit (0);
+	#endif
+	#if defined (SYSTYPE_BSD43) || defined(SYSTYPE_BSD)
+	  printf ("mips-mips-riscos%sbsd\\n", argv[1]); exit (0);
+	#endif
+	#endif
+	  exit (-1);
+	}
+EOF
+	$CC_FOR_BUILD -o "$dummy" "$dummy.c" &&
+	  dummyarg=`echo "$UNAME_RELEASE" | sed -n 's/\([0-9]*\).*/\1/p'` &&
+	  SYSTEM_NAME=`"$dummy" "$dummyarg"` &&
+	    { echo "$SYSTEM_NAME"; exit; }
+	GUESS=mips-mips-riscos$UNAME_RELEASE
+	;;
+    Motorola:PowerMAX_OS:*:*)
+	GUESS=powerpc-motorola-powermax
+	;;
+    Motorola:*:4.3:PL8-*)
+	GUESS=powerpc-harris-powermax
+	;;
+    Night_Hawk:*:*:PowerMAX_OS | Synergy:PowerMAX_OS:*:*)
+	GUESS=powerpc-harris-powermax
+	;;
+    Night_Hawk:Power_UNIX:*:*)
+	GUESS=powerpc-harris-powerunix
+	;;
+    m88k:CX/UX:7*:*)
+	GUESS=m88k-harris-cxux7
+	;;
+    m88k:*:4*:R4*)
+	GUESS=m88k-motorola-sysv4
+	;;
+    m88k:*:3*:R3*)
+	GUESS=m88k-motorola-sysv3
+	;;
+    AViiON:dgux:*:*)
+	# DG/UX returns AViiON for all architectures
+	UNAME_PROCESSOR=`/usr/bin/uname -p`
+	if test "$UNAME_PROCESSOR" = mc88100 || test "$UNAME_PROCESSOR" = mc88110
+	then
+	    if test "$TARGET_BINARY_INTERFACE"x = m88kdguxelfx || \
+	       test "$TARGET_BINARY_INTERFACE"x = x
+	    then
+		GUESS=m88k-dg-dgux$UNAME_RELEASE
+	    else
+		GUESS=m88k-dg-dguxbcs$UNAME_RELEASE
+	    fi
+	else
+	    GUESS=i586-dg-dgux$UNAME_RELEASE
+	fi
+	;;
+    M88*:DolphinOS:*:*)	# DolphinOS (SVR3)
+	GUESS=m88k-dolphin-sysv3
+	;;
+    M88*:*:R3*:*)
+	# Delta 88k system running SVR3
+	GUESS=m88k-motorola-sysv3
+	;;
+    XD88*:*:*:*) # Tektronix XD88 system running UTekV (SVR3)
+	GUESS=m88k-tektronix-sysv3
+	;;
+    Tek43[0-9][0-9]:UTek:*:*) # Tektronix 4300 system running UTek (BSD)
+	GUESS=m68k-tektronix-bsd
+	;;
+    *:IRIX*:*:*)
+	IRIX_REL=`echo "$UNAME_RELEASE" | sed -e 's/-/_/g'`
+	GUESS=mips-sgi-irix$IRIX_REL
+	;;
+    ????????:AIX?:[12].1:2)   # AIX 2.2.1 or AIX 2.1.1 is RT/PC AIX.
+	GUESS=romp-ibm-aix    # uname -m gives an 8 hex-code CPU id
+	;;                    # Note that: echo "'`uname -s`'" gives 'AIX '
+    i*86:AIX:*:*)
+	GUESS=i386-ibm-aix
+	;;
+    ia64:AIX:*:*)
+	if test -x /usr/bin/oslevel ; then
+		IBM_REV=`/usr/bin/oslevel`
+	else
+		IBM_REV=$UNAME_VERSION.$UNAME_RELEASE
+	fi
+	GUESS=$UNAME_MACHINE-ibm-aix$IBM_REV
+	;;
+    *:AIX:2:3)
+	if grep bos325 /usr/include/stdio.h >/dev/null 2>&1; then
+		set_cc_for_build
+		sed 's/^		//' << EOF > "$dummy.c"
+		#include <sys/systemcfg.h>
+
+		main()
+			{
+			if (!__power_pc())
+				exit(1);
+			puts("powerpc-ibm-aix3.2.5");
+			exit(0);
+			}
+EOF
+		if $CC_FOR_BUILD -o "$dummy" "$dummy.c" && SYSTEM_NAME=`"$dummy"`
+		then
+			GUESS=$SYSTEM_NAME
+		else
+			GUESS=rs6000-ibm-aix3.2.5
+		fi
+	elif grep bos324 /usr/include/stdio.h >/dev/null 2>&1; then
+		GUESS=rs6000-ibm-aix3.2.4
+	else
+		GUESS=rs6000-ibm-aix3.2
+	fi
+	;;
+    *:AIX:*:[4567])
+	IBM_CPU_ID=`/usr/sbin/lsdev -C -c processor -S available | sed 1q | awk '{ print $1 }'`
+	if /usr/sbin/lsattr -El "$IBM_CPU_ID" | grep ' POWER' >/dev/null 2>&1; then
+		IBM_ARCH=rs6000
+	else
+		IBM_ARCH=powerpc
+	fi
+	if test -x /usr/bin/lslpp ; then
+		IBM_REV=`/usr/bin/lslpp -Lqc bos.rte.libc | \
+			   awk -F: '{ print $3 }' | sed s/[0-9]*$/0/`
+	else
+		IBM_REV=$UNAME_VERSION.$UNAME_RELEASE
+	fi
+	GUESS=$IBM_ARCH-ibm-aix$IBM_REV
+	;;
+    *:AIX:*:*)
+	GUESS=rs6000-ibm-aix
+	;;
+    ibmrt:4.4BSD:*|romp-ibm:4.4BSD:*)
+	GUESS=romp-ibm-bsd4.4
+	;;
+    ibmrt:*BSD:*|romp-ibm:BSD:*)            # covers RT/PC BSD and
+	GUESS=romp-ibm-bsd$UNAME_RELEASE    # 4.3 with uname added to
+	;;                                  # report: romp-ibm BSD 4.3
+    *:BOSX:*:*)
+	GUESS=rs6000-bull-bosx
+	;;
+    DPX/2?00:B.O.S.:*:*)
+	GUESS=m68k-bull-sysv3
+	;;
+    9000/[34]??:4.3bsd:1.*:*)
+	GUESS=m68k-hp-bsd
+	;;
+    hp300:4.4BSD:*:* | 9000/[34]??:4.3bsd:2.*:*)
+	GUESS=m68k-hp-bsd4.4
+	;;
+    9000/[34678]??:HP-UX:*:*)
+	HPUX_REV=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*.[0B]*//'`
+	case $UNAME_MACHINE in
+	    9000/31?)            HP_ARCH=m68000 ;;
+	    9000/[34]??)         HP_ARCH=m68k ;;
+	    9000/[678][0-9][0-9])
+		if test -x /usr/bin/getconf; then
+		    sc_cpu_version=`/usr/bin/getconf SC_CPU_VERSION 2>/dev/null`
+		    sc_kernel_bits=`/usr/bin/getconf SC_KERNEL_BITS 2>/dev/null`
+		    case $sc_cpu_version in
+		      523) HP_ARCH=hppa1.0 ;; # CPU_PA_RISC1_0
+		      528) HP_ARCH=hppa1.1 ;; # CPU_PA_RISC1_1
+		      532)                      # CPU_PA_RISC2_0
+			case $sc_kernel_bits in
+			  32) HP_ARCH=hppa2.0n ;;
+			  64) HP_ARCH=hppa2.0w ;;
+			  '') HP_ARCH=hppa2.0 ;;   # HP-UX 10.20
+			esac ;;
+		    esac
+		fi
+		if test "$HP_ARCH" = ""; then
+		    set_cc_for_build
+		    sed 's/^		//' << EOF > "$dummy.c"
+
+		#define _HPUX_SOURCE
+		#include <stdlib.h>
+		#include <unistd.h>
+
+		int main ()
+		{
+		#if defined(_SC_KERNEL_BITS)
+		    long bits = sysconf(_SC_KERNEL_BITS);
+		#endif
+		    long cpu  = sysconf (_SC_CPU_VERSION);
+
+		    switch (cpu)
+			{
+			case CPU_PA_RISC1_0: puts ("hppa1.0"); break;
+			case CPU_PA_RISC1_1: puts ("hppa1.1"); break;
+			case CPU_PA_RISC2_0:
+		#if defined(_SC_KERNEL_BITS)
+			    switch (bits)
+				{
+				case 64: puts ("hppa2.0w"); break;
+				case 32: puts ("hppa2.0n"); break;
+				default: puts ("hppa2.0"); break;
+				} break;
+		#else  /* !defined(_SC_KERNEL_BITS) */
+			    puts ("hppa2.0"); break;
+		#endif
+			default: puts ("hppa1.0"); break;
+			}
+		    exit (0);
+		}
+EOF
+		    (CCOPTS="" $CC_FOR_BUILD -o "$dummy" "$dummy.c" 2>/dev/null) && HP_ARCH=`"$dummy"`
+		    test -z "$HP_ARCH" && HP_ARCH=hppa
+		fi ;;
+	esac
+	if test "$HP_ARCH" = hppa2.0w
+	then
+	    set_cc_for_build
+
+	    # hppa2.0w-hp-hpux* has a 64-bit kernel and a compiler generating
+	    # 32-bit code.  hppa64-hp-hpux* has the same kernel and a compiler
+	    # generating 64-bit code.  GNU and HP use different nomenclature:
+	    #
+	    # $ CC_FOR_BUILD=cc ./config.guess
+	    # => hppa2.0w-hp-hpux11.23
+	    # $ CC_FOR_BUILD="cc +DA2.0w" ./config.guess
+	    # => hppa64-hp-hpux11.23
+
+	    if echo __LP64__ | (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) |
+		grep -q __LP64__
+	    then
+		HP_ARCH=hppa2.0w
+	    else
+		HP_ARCH=hppa64
+	    fi
+	fi
+	GUESS=$HP_ARCH-hp-hpux$HPUX_REV
+	;;
+    ia64:HP-UX:*:*)
+	HPUX_REV=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*.[0B]*//'`
+	GUESS=ia64-hp-hpux$HPUX_REV
+	;;
+    3050*:HI-UX:*:*)
+	set_cc_for_build
+	sed 's/^	//' << EOF > "$dummy.c"
+	#include <unistd.h>
+	int
+	main ()
+	{
+	  long cpu = sysconf (_SC_CPU_VERSION);
+	  /* The order matters, because CPU_IS_HP_MC68K erroneously returns
+	     true for CPU_PA_RISC1_0.  CPU_IS_PA_RISC returns correct
+	     results, however.  */
+	  if (CPU_IS_PA_RISC (cpu))
+	    {
+	      switch (cpu)
+		{
+		  case CPU_PA_RISC1_0: puts ("hppa1.0-hitachi-hiuxwe2"); break;
+		  case CPU_PA_RISC1_1: puts ("hppa1.1-hitachi-hiuxwe2"); break;
+		  case CPU_PA_RISC2_0: puts ("hppa2.0-hitachi-hiuxwe2"); break;
+		  default: puts ("hppa-hitachi-hiuxwe2"); break;
+		}
+	    }
+	  else if (CPU_IS_HP_MC68K (cpu))
+	    puts ("m68k-hitachi-hiuxwe2");
+	  else puts ("unknown-hitachi-hiuxwe2");
+	  exit (0);
+	}
+EOF
+	$CC_FOR_BUILD -o "$dummy" "$dummy.c" && SYSTEM_NAME=`"$dummy"` &&
+		{ echo "$SYSTEM_NAME"; exit; }
+	GUESS=unknown-hitachi-hiuxwe2
+	;;
+    9000/7??:4.3bsd:*:* | 9000/8?[79]:4.3bsd:*:*)
+	GUESS=hppa1.1-hp-bsd
+	;;
+    9000/8??:4.3bsd:*:*)
+	GUESS=hppa1.0-hp-bsd
+	;;
+    *9??*:MPE/iX:*:* | *3000*:MPE/iX:*:*)
+	GUESS=hppa1.0-hp-mpeix
+	;;
+    hp7??:OSF1:*:* | hp8?[79]:OSF1:*:*)
+	GUESS=hppa1.1-hp-osf
+	;;
+    hp8??:OSF1:*:*)
+	GUESS=hppa1.0-hp-osf
+	;;
+    i*86:OSF1:*:*)
+	if test -x /usr/sbin/sysversion ; then
+	    GUESS=$UNAME_MACHINE-unknown-osf1mk
+	else
+	    GUESS=$UNAME_MACHINE-unknown-osf1
+	fi
+	;;
+    parisc*:Lites*:*:*)
+	GUESS=hppa1.1-hp-lites
+	;;
+    C1*:ConvexOS:*:* | convex:ConvexOS:C1*:*)
+	GUESS=c1-convex-bsd
+	;;
+    C2*:ConvexOS:*:* | convex:ConvexOS:C2*:*)
+	if getsysinfo -f scalar_acc
+	then echo c32-convex-bsd
+	else echo c2-convex-bsd
+	fi
+	exit ;;
+    C34*:ConvexOS:*:* | convex:ConvexOS:C34*:*)
+	GUESS=c34-convex-bsd
+	;;
+    C38*:ConvexOS:*:* | convex:ConvexOS:C38*:*)
+	GUESS=c38-convex-bsd
+	;;
+    C4*:ConvexOS:*:* | convex:ConvexOS:C4*:*)
+	GUESS=c4-convex-bsd
+	;;
+    CRAY*Y-MP:*:*:*)
+	CRAY_REL=`echo "$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/'`
+	GUESS=ymp-cray-unicos$CRAY_REL
+	;;
+    CRAY*[A-Z]90:*:*:*)
+	echo "$UNAME_MACHINE"-cray-unicos"$UNAME_RELEASE" \
+	| sed -e 's/CRAY.*\([A-Z]90\)/\1/' \
+	      -e y/ABCDEFGHIJKLMNOPQRSTUVWXYZ/abcdefghijklmnopqrstuvwxyz/ \
+	      -e 's/\.[^.]*$/.X/'
+	exit ;;
+    CRAY*TS:*:*:*)
+	CRAY_REL=`echo "$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/'`
+	GUESS=t90-cray-unicos$CRAY_REL
+	;;
+    CRAY*T3E:*:*:*)
+	CRAY_REL=`echo "$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/'`
+	GUESS=alphaev5-cray-unicosmk$CRAY_REL
+	;;
+    CRAY*SV1:*:*:*)
+	CRAY_REL=`echo "$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/'`
+	GUESS=sv1-cray-unicos$CRAY_REL
+	;;
+    *:UNICOS/mp:*:*)
+	CRAY_REL=`echo "$UNAME_RELEASE" | sed -e 's/\.[^.]*$/.X/'`
+	GUESS=craynv-cray-unicosmp$CRAY_REL
+	;;
+    F30[01]:UNIX_System_V:*:* | F700:UNIX_System_V:*:*)
+	FUJITSU_PROC=`uname -m | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz`
+	FUJITSU_SYS=`uname -p | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz | sed -e 's/\///'`
+	FUJITSU_REL=`echo "$UNAME_RELEASE" | sed -e 's/ /_/'`
+	GUESS=${FUJITSU_PROC}-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}
+	;;
+    5000:UNIX_System_V:4.*:*)
+	FUJITSU_SYS=`uname -p | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz | sed -e 's/\///'`
+	FUJITSU_REL=`echo "$UNAME_RELEASE" | tr ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz | sed -e 's/ /_/'`
+	GUESS=sparc-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}
+	;;
+    i*86:BSD/386:*:* | i*86:BSD/OS:*:* | *:Ascend\ Embedded/OS:*:*)
+	GUESS=$UNAME_MACHINE-pc-bsdi$UNAME_RELEASE
+	;;
+    sparc*:BSD/OS:*:*)
+	GUESS=sparc-unknown-bsdi$UNAME_RELEASE
+	;;
+    *:BSD/OS:*:*)
+	GUESS=$UNAME_MACHINE-unknown-bsdi$UNAME_RELEASE
+	;;
+    arm:FreeBSD:*:*)
+	UNAME_PROCESSOR=`uname -p`
+	set_cc_for_build
+	if echo __ARM_PCS_VFP | $CC_FOR_BUILD -E - 2>/dev/null \
+	    | grep -q __ARM_PCS_VFP
+	then
+	    FREEBSD_REL=`echo "$UNAME_RELEASE" | sed -e 's/[-(].*//'`
+	    GUESS=$UNAME_PROCESSOR-unknown-freebsd$FREEBSD_REL-gnueabi
+	else
+	    FREEBSD_REL=`echo "$UNAME_RELEASE" | sed -e 's/[-(].*//'`
+	    GUESS=$UNAME_PROCESSOR-unknown-freebsd$FREEBSD_REL-gnueabihf
+	fi
+	;;
+    *:FreeBSD:*:*)
+	UNAME_PROCESSOR=`/usr/bin/uname -p`
+	case $UNAME_PROCESSOR in
+	    amd64)
+		UNAME_PROCESSOR=x86_64 ;;
+	    i386)
+		UNAME_PROCESSOR=i586 ;;
+	esac
+	FREEBSD_REL=`echo "$UNAME_RELEASE" | sed -e 's/[-(].*//'`
+	GUESS=$UNAME_PROCESSOR-unknown-freebsd$FREEBSD_REL
+	;;
+    i*:CYGWIN*:*)
+	GUESS=$UNAME_MACHINE-pc-cygwin
+	;;
+    *:MINGW64*:*)
+	GUESS=$UNAME_MACHINE-pc-mingw64
+	;;
+    *:MINGW*:*)
+	GUESS=$UNAME_MACHINE-pc-mingw32
+	;;
+    *:MSYS*:*)
+	GUESS=$UNAME_MACHINE-pc-msys
+	;;
+    i*:PW*:*)
+	GUESS=$UNAME_MACHINE-pc-pw32
+	;;
+    *:SerenityOS:*:*)
+        GUESS=$UNAME_MACHINE-pc-serenity
+        ;;
+    *:Interix*:*)
+	case $UNAME_MACHINE in
+	    x86)
+		GUESS=i586-pc-interix$UNAME_RELEASE
+		;;
+	    authenticamd | genuineintel | EM64T)
+		GUESS=x86_64-unknown-interix$UNAME_RELEASE
+		;;
+	    IA64)
+		GUESS=ia64-unknown-interix$UNAME_RELEASE
+		;;
+	esac ;;
+    i*:UWIN*:*)
+	GUESS=$UNAME_MACHINE-pc-uwin
+	;;
+    amd64:CYGWIN*:*:* | x86_64:CYGWIN*:*:*)
+	GUESS=x86_64-pc-cygwin
+	;;
+    prep*:SunOS:5.*:*)
+	SUN_REL=`echo "$UNAME_RELEASE" | sed -e 's/[^.]*//'`
+	GUESS=powerpcle-unknown-solaris2$SUN_REL
+	;;
+    *:GNU:*:*)
+	# the GNU system
+	GNU_ARCH=`echo "$UNAME_MACHINE" | sed -e 's,[-/].*$,,'`
+	GNU_REL=`echo "$UNAME_RELEASE" | sed -e 's,/.*$,,'`
+	GUESS=$GNU_ARCH-unknown-$LIBC$GNU_REL
+	;;
+    *:GNU/*:*:*)
+	# other systems with GNU libc and userland
+	GNU_SYS=`echo "$UNAME_SYSTEM" | sed 's,^[^/]*/,,' | tr "[:upper:]" "[:lower:]"`
+	GNU_REL=`echo "$UNAME_RELEASE" | sed -e 's/[-(].*//'`
+	GUESS=$UNAME_MACHINE-unknown-$GNU_SYS$GNU_REL-$LIBC
+	;;
+    *:Minix:*:*)
+	GUESS=$UNAME_MACHINE-unknown-minix
+	;;
+    aarch64:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    aarch64_be:Linux:*:*)
+	UNAME_MACHINE=aarch64_be
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    alpha:Linux:*:*)
+	case `sed -n '/^cpu model/s/^.*: \(.*\)/\1/p' /proc/cpuinfo 2>/dev/null` in
+	  EV5)   UNAME_MACHINE=alphaev5 ;;
+	  EV56)  UNAME_MACHINE=alphaev56 ;;
+	  PCA56) UNAME_MACHINE=alphapca56 ;;
+	  PCA57) UNAME_MACHINE=alphapca56 ;;
+	  EV6)   UNAME_MACHINE=alphaev6 ;;
+	  EV67)  UNAME_MACHINE=alphaev67 ;;
+	  EV68*) UNAME_MACHINE=alphaev68 ;;
+	esac
+	objdump --private-headers /bin/sh | grep -q ld.so.1
+	if test "$?" = 0 ; then LIBC=gnulibc1 ; fi
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    arc:Linux:*:* | arceb:Linux:*:* | arc32:Linux:*:* | arc64:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    arm*:Linux:*:*)
+	set_cc_for_build
+	if echo __ARM_EABI__ | $CC_FOR_BUILD -E - 2>/dev/null \
+	    | grep -q __ARM_EABI__
+	then
+	    GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	else
+	    if echo __ARM_PCS_VFP | $CC_FOR_BUILD -E - 2>/dev/null \
+		| grep -q __ARM_PCS_VFP
+	    then
+		GUESS=$UNAME_MACHINE-unknown-linux-${LIBC}eabi
+	    else
+		GUESS=$UNAME_MACHINE-unknown-linux-${LIBC}eabihf
+	    fi
+	fi
+	;;
+    avr32*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    cris:Linux:*:*)
+	GUESS=$UNAME_MACHINE-axis-linux-$LIBC
+	;;
+    crisv32:Linux:*:*)
+	GUESS=$UNAME_MACHINE-axis-linux-$LIBC
+	;;
+    e2k:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    frv:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    hexagon:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    i*86:Linux:*:*)
+	GUESS=$UNAME_MACHINE-pc-linux-$LIBC
+	;;
+    ia64:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    k1om:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    loongarch32:Linux:*:* | loongarch64:Linux:*:* | loongarchx32:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    m32r*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    m68*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    mips:Linux:*:* | mips64:Linux:*:*)
+	set_cc_for_build
+	IS_GLIBC=0
+	test x"${LIBC}" = xgnu && IS_GLIBC=1
+	sed 's/^	//' << EOF > "$dummy.c"
+	#undef CPU
+	#undef mips
+	#undef mipsel
+	#undef mips64
+	#undef mips64el
+	#if ${IS_GLIBC} && defined(_ABI64)
+	LIBCABI=gnuabi64
+	#else
+	#if ${IS_GLIBC} && defined(_ABIN32)
+	LIBCABI=gnuabin32
+	#else
+	LIBCABI=${LIBC}
+	#endif
+	#endif
+
+	#if ${IS_GLIBC} && defined(__mips64) && defined(__mips_isa_rev) && __mips_isa_rev>=6
+	CPU=mipsisa64r6
+	#else
+	#if ${IS_GLIBC} && !defined(__mips64) && defined(__mips_isa_rev) && __mips_isa_rev>=6
+	CPU=mipsisa32r6
+	#else
+	#if defined(__mips64)
+	CPU=mips64
+	#else
+	CPU=mips
+	#endif
+	#endif
+	#endif
+
+	#if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL)
+	MIPS_ENDIAN=el
+	#else
+	#if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB)
+	MIPS_ENDIAN=
+	#else
+	MIPS_ENDIAN=
+	#endif
+	#endif
+EOF
+	cc_set_vars=`$CC_FOR_BUILD -E "$dummy.c" 2>/dev/null | grep '^CPU\|^MIPS_ENDIAN\|^LIBCABI'`
+	eval "$cc_set_vars"
+	test "x$CPU" != x && { echo "$CPU${MIPS_ENDIAN}-unknown-linux-$LIBCABI"; exit; }
+	;;
+    mips64el:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    openrisc*:Linux:*:*)
+	GUESS=or1k-unknown-linux-$LIBC
+	;;
+    or32:Linux:*:* | or1k*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    padre:Linux:*:*)
+	GUESS=sparc-unknown-linux-$LIBC
+	;;
+    parisc64:Linux:*:* | hppa64:Linux:*:*)
+	GUESS=hppa64-unknown-linux-$LIBC
+	;;
+    parisc:Linux:*:* | hppa:Linux:*:*)
+	# Look for CPU level
+	case `grep '^cpu[^a-z]*:' /proc/cpuinfo 2>/dev/null | cut -d' ' -f2` in
+	  PA7*) GUESS=hppa1.1-unknown-linux-$LIBC ;;
+	  PA8*) GUESS=hppa2.0-unknown-linux-$LIBC ;;
+	  *)    GUESS=hppa-unknown-linux-$LIBC ;;
+	esac
+	;;
+    ppc64:Linux:*:*)
+	GUESS=powerpc64-unknown-linux-$LIBC
+	;;
+    ppc:Linux:*:*)
+	GUESS=powerpc-unknown-linux-$LIBC
+	;;
+    ppc64le:Linux:*:*)
+	GUESS=powerpc64le-unknown-linux-$LIBC
+	;;
+    ppcle:Linux:*:*)
+	GUESS=powerpcle-unknown-linux-$LIBC
+	;;
+    riscv32:Linux:*:* | riscv32be:Linux:*:* | riscv64:Linux:*:* | riscv64be:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    s390:Linux:*:* | s390x:Linux:*:*)
+	GUESS=$UNAME_MACHINE-ibm-linux-$LIBC
+	;;
+    sh64*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    sh*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    sparc:Linux:*:* | sparc64:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    tile*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    vax:Linux:*:*)
+	GUESS=$UNAME_MACHINE-dec-linux-$LIBC
+	;;
+    x86_64:Linux:*:*)
+	set_cc_for_build
+	LIBCABI=$LIBC
+	if test "$CC_FOR_BUILD" != no_compiler_found; then
+	    if (echo '#ifdef __ILP32__'; echo IS_X32; echo '#endif') | \
+		(CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \
+		grep IS_X32 >/dev/null
+	    then
+		LIBCABI=${LIBC}x32
+	    fi
+	fi
+	GUESS=$UNAME_MACHINE-pc-linux-$LIBCABI
+	;;
+    xtensa*:Linux:*:*)
+	GUESS=$UNAME_MACHINE-unknown-linux-$LIBC
+	;;
+    i*86:DYNIX/ptx:4*:*)
+	# ptx 4.0 does uname -s correctly, with DYNIX/ptx in there.
+	# earlier versions are messed up and put the nodename in both
+	# sysname and nodename.
+	GUESS=i386-sequent-sysv4
+	;;
+    i*86:UNIX_SV:4.2MP:2.*)
+	# Unixware is an offshoot of SVR4, but it has its own version
+	# number series starting with 2...
+	# I am not positive that other SVR4 systems won't match this,
+	# I just have to hope.  -- rms.
+	# Use sysv4.2uw... so that sysv4* matches it.
+	GUESS=$UNAME_MACHINE-pc-sysv4.2uw$UNAME_VERSION
+	;;
+    i*86:OS/2:*:*)
+	# If we were able to find `uname', then EMX Unix compatibility
+	# is probably installed.
+	GUESS=$UNAME_MACHINE-pc-os2-emx
+	;;
+    i*86:XTS-300:*:STOP)
+	GUESS=$UNAME_MACHINE-unknown-stop
+	;;
+    i*86:atheos:*:*)
+	GUESS=$UNAME_MACHINE-unknown-atheos
+	;;
+    i*86:syllable:*:*)
+	GUESS=$UNAME_MACHINE-pc-syllable
+	;;
+    i*86:LynxOS:2.*:* | i*86:LynxOS:3.[01]*:* | i*86:LynxOS:4.[02]*:*)
+	GUESS=i386-unknown-lynxos$UNAME_RELEASE
+	;;
+    i*86:*DOS:*:*)
+	GUESS=$UNAME_MACHINE-pc-msdosdjgpp
+	;;
+    i*86:*:4.*:*)
+	UNAME_REL=`echo "$UNAME_RELEASE" | sed 's/\/MP$//'`
+	if grep Novell /usr/include/link.h >/dev/null 2>/dev/null; then
+		GUESS=$UNAME_MACHINE-univel-sysv$UNAME_REL
+	else
+		GUESS=$UNAME_MACHINE-pc-sysv$UNAME_REL
+	fi
+	;;
+    i*86:*:5:[678]*)
+	# UnixWare 7.x, OpenUNIX and OpenServer 6.
+	case `/bin/uname -X | grep "^Machine"` in
+	    *486*)	     UNAME_MACHINE=i486 ;;
+	    *Pentium)	     UNAME_MACHINE=i586 ;;
+	    *Pent*|*Celeron) UNAME_MACHINE=i686 ;;
+	esac
+	GUESS=$UNAME_MACHINE-unknown-sysv${UNAME_RELEASE}${UNAME_SYSTEM}${UNAME_VERSION}
+	;;
+    i*86:*:3.2:*)
+	if test -f /usr/options/cb.name; then
+		UNAME_REL=`sed -n 's/.*Version //p' </usr/options/cb.name`
+		GUESS=$UNAME_MACHINE-pc-isc$UNAME_REL
+	elif /bin/uname -X 2>/dev/null >/dev/null ; then
+		UNAME_REL=`(/bin/uname -X|grep Release|sed -e 's/.*= //')`
+		(/bin/uname -X|grep i80486 >/dev/null) && UNAME_MACHINE=i486
+		(/bin/uname -X|grep '^Machine.*Pentium' >/dev/null) \
+			&& UNAME_MACHINE=i586
+		(/bin/uname -X|grep '^Machine.*Pent *II' >/dev/null) \
+			&& UNAME_MACHINE=i686
+		(/bin/uname -X|grep '^Machine.*Pentium Pro' >/dev/null) \
+			&& UNAME_MACHINE=i686
+		GUESS=$UNAME_MACHINE-pc-sco$UNAME_REL
+	else
+		GUESS=$UNAME_MACHINE-pc-sysv32
+	fi
+	;;
+    pc:*:*:*)
+	# Left here for compatibility:
+	# uname -m prints for DJGPP always 'pc', but it prints nothing about
+	# the processor, so we play safe by assuming i586.
+	# Note: whatever this is, it MUST be the same as what config.sub
+	# prints for the "djgpp" host, or else GDB configure will decide that
+	# this is a cross-build.
+	GUESS=i586-pc-msdosdjgpp
+	;;
+    Intel:Mach:3*:*)
+	GUESS=i386-pc-mach3
+	;;
+    paragon:*:*:*)
+	GUESS=i860-intel-osf1
+	;;
+    i860:*:4.*:*) # i860-SVR4
+	if grep Stardent /usr/include/sys/uadmin.h >/dev/null 2>&1 ; then
+	  GUESS=i860-stardent-sysv$UNAME_RELEASE    # Stardent Vistra i860-SVR4
+	else # Add other i860-SVR4 vendors below as they are discovered.
+	  GUESS=i860-unknown-sysv$UNAME_RELEASE     # Unknown i860-SVR4
+	fi
+	;;
+    mini*:CTIX:SYS*5:*)
+	# "miniframe"
+	GUESS=m68010-convergent-sysv
+	;;
+    mc68k:UNIX:SYSTEM5:3.51m)
+	GUESS=m68k-convergent-sysv
+	;;
+    M680?0:D-NIX:5.3:*)
+	GUESS=m68k-diab-dnix
+	;;
+    M68*:*:R3V[5678]*:*)
+	test -r /sysV68 && { echo 'm68k-motorola-sysv'; exit; } ;;
+    3[345]??:*:4.0:3.0 | 3[34]??A:*:4.0:3.0 | 3[34]??,*:*:4.0:3.0 | 3[34]??/*:*:4.0:3.0 | 4400:*:4.0:3.0 | 4850:*:4.0:3.0 | SKA40:*:4.0:3.0 | SDS2:*:4.0:3.0 | SHG2:*:4.0:3.0 | S7501*:*:4.0:3.0)
+	OS_REL=''
+	test -r /etc/.relid \
+	&& OS_REL=.`sed -n 's/[^ ]* [^ ]* \([0-9][0-9]\).*/\1/p' < /etc/.relid`
+	/bin/uname -p 2>/dev/null | grep 86 >/dev/null \
+	  && { echo i486-ncr-sysv4.3"$OS_REL"; exit; }
+	/bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \
+	  && { echo i586-ncr-sysv4.3"$OS_REL"; exit; } ;;
+    3[34]??:*:4.0:* | 3[34]??,*:*:4.0:*)
+	/bin/uname -p 2>/dev/null | grep 86 >/dev/null \
+	  && { echo i486-ncr-sysv4; exit; } ;;
+    NCR*:*:4.2:* | MPRAS*:*:4.2:*)
+	OS_REL='.3'
+	test -r /etc/.relid \
+	    && OS_REL=.`sed -n 's/[^ ]* [^ ]* \([0-9][0-9]\).*/\1/p' < /etc/.relid`
+	/bin/uname -p 2>/dev/null | grep 86 >/dev/null \
+	    && { echo i486-ncr-sysv4.3"$OS_REL"; exit; }
+	/bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \
+	    && { echo i586-ncr-sysv4.3"$OS_REL"; exit; }
+	/bin/uname -p 2>/dev/null | /bin/grep pteron >/dev/null \
+	    && { echo i586-ncr-sysv4.3"$OS_REL"; exit; } ;;
+    m68*:LynxOS:2.*:* | m68*:LynxOS:3.0*:*)
+	GUESS=m68k-unknown-lynxos$UNAME_RELEASE
+	;;
+    mc68030:UNIX_System_V:4.*:*)
+	GUESS=m68k-atari-sysv4
+	;;
+    TSUNAMI:LynxOS:2.*:*)
+	GUESS=sparc-unknown-lynxos$UNAME_RELEASE
+	;;
+    rs6000:LynxOS:2.*:*)
+	GUESS=rs6000-unknown-lynxos$UNAME_RELEASE
+	;;
+    PowerPC:LynxOS:2.*:* | PowerPC:LynxOS:3.[01]*:* | PowerPC:LynxOS:4.[02]*:*)
+	GUESS=powerpc-unknown-lynxos$UNAME_RELEASE
+	;;
+    SM[BE]S:UNIX_SV:*:*)
+	GUESS=mips-dde-sysv$UNAME_RELEASE
+	;;
+    RM*:ReliantUNIX-*:*:*)
+	GUESS=mips-sni-sysv4
+	;;
+    RM*:SINIX-*:*:*)
+	GUESS=mips-sni-sysv4
+	;;
+    *:SINIX-*:*:*)
+	if uname -p 2>/dev/null >/dev/null ; then
+		UNAME_MACHINE=`(uname -p) 2>/dev/null`
+		GUESS=$UNAME_MACHINE-sni-sysv4
+	else
+		GUESS=ns32k-sni-sysv
+	fi
+	;;
+    PENTIUM:*:4.0*:*)	# Unisys `ClearPath HMP IX 4000' SVR4/MP effort
+			# says <Richard.M.Bartel@ccMail.Census.GOV>
+	GUESS=i586-unisys-sysv4
+	;;
+    *:UNIX_System_V:4*:FTX*)
+	# From Gerald Hewes <hewes@openmarket.com>.
+	# How about differentiating between stratus architectures? -djm
+	GUESS=hppa1.1-stratus-sysv4
+	;;
+    *:*:*:FTX*)
+	# From seanf@swdc.stratus.com.
+	GUESS=i860-stratus-sysv4
+	;;
+    i*86:VOS:*:*)
+	# From Paul.Green@stratus.com.
+	GUESS=$UNAME_MACHINE-stratus-vos
+	;;
+    *:VOS:*:*)
+	# From Paul.Green@stratus.com.
+	GUESS=hppa1.1-stratus-vos
+	;;
+    mc68*:A/UX:*:*)
+	GUESS=m68k-apple-aux$UNAME_RELEASE
+	;;
+    news*:NEWS-OS:6*:*)
+	GUESS=mips-sony-newsos6
+	;;
+    R[34]000:*System_V*:*:* | R4000:UNIX_SYSV:*:* | R*000:UNIX_SV:*:*)
+	if test -d /usr/nec; then
+		GUESS=mips-nec-sysv$UNAME_RELEASE
+	else
+		GUESS=mips-unknown-sysv$UNAME_RELEASE
+	fi
+	;;
+    BeBox:BeOS:*:*)	# BeOS running on hardware made by Be, PPC only.
+	GUESS=powerpc-be-beos
+	;;
+    BeMac:BeOS:*:*)	# BeOS running on Mac or Mac clone, PPC only.
+	GUESS=powerpc-apple-beos
+	;;
+    BePC:BeOS:*:*)	# BeOS running on Intel PC compatible.
+	GUESS=i586-pc-beos
+	;;
+    BePC:Haiku:*:*)	# Haiku running on Intel PC compatible.
+	GUESS=i586-pc-haiku
+	;;
+    x86_64:Haiku:*:*)
+	GUESS=x86_64-unknown-haiku
+	;;
+    SX-4:SUPER-UX:*:*)
+	GUESS=sx4-nec-superux$UNAME_RELEASE
+	;;
+    SX-5:SUPER-UX:*:*)
+	GUESS=sx5-nec-superux$UNAME_RELEASE
+	;;
+    SX-6:SUPER-UX:*:*)
+	GUESS=sx6-nec-superux$UNAME_RELEASE
+	;;
+    SX-7:SUPER-UX:*:*)
+	GUESS=sx7-nec-superux$UNAME_RELEASE
+	;;
+    SX-8:SUPER-UX:*:*)
+	GUESS=sx8-nec-superux$UNAME_RELEASE
+	;;
+    SX-8R:SUPER-UX:*:*)
+	GUESS=sx8r-nec-superux$UNAME_RELEASE
+	;;
+    SX-ACE:SUPER-UX:*:*)
+	GUESS=sxace-nec-superux$UNAME_RELEASE
+	;;
+    Power*:Rhapsody:*:*)
+	GUESS=powerpc-apple-rhapsody$UNAME_RELEASE
+	;;
+    *:Rhapsody:*:*)
+	GUESS=$UNAME_MACHINE-apple-rhapsody$UNAME_RELEASE
+	;;
+    arm64:Darwin:*:*)
+	GUESS=aarch64-apple-darwin$UNAME_RELEASE
+	;;
+    *:Darwin:*:*)
+	UNAME_PROCESSOR=`uname -p`
+	case $UNAME_PROCESSOR in
+	    unknown) UNAME_PROCESSOR=powerpc ;;
+	esac
+	if command -v xcode-select > /dev/null 2> /dev/null && \
+		! xcode-select --print-path > /dev/null 2> /dev/null ; then
+	    # Avoid executing cc if there is no toolchain installed as
+	    # cc will be a stub that puts up a graphical alert
+	    # prompting the user to install developer tools.
+	    CC_FOR_BUILD=no_compiler_found
+	else
+	    set_cc_for_build
+	fi
+	if test "$CC_FOR_BUILD" != no_compiler_found; then
+	    if (echo '#ifdef __LP64__'; echo IS_64BIT_ARCH; echo '#endif') | \
+		   (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \
+		   grep IS_64BIT_ARCH >/dev/null
+	    then
+		case $UNAME_PROCESSOR in
+		    i386) UNAME_PROCESSOR=x86_64 ;;
+		    powerpc) UNAME_PROCESSOR=powerpc64 ;;
+		esac
+	    fi
+	    # On 10.4-10.6 one might compile for PowerPC via gcc -arch ppc
+	    if (echo '#ifdef __POWERPC__'; echo IS_PPC; echo '#endif') | \
+		   (CCOPTS="" $CC_FOR_BUILD -E - 2>/dev/null) | \
+		   grep IS_PPC >/dev/null
+	    then
+		UNAME_PROCESSOR=powerpc
+	    fi
+	elif test "$UNAME_PROCESSOR" = i386 ; then
+	    # uname -m returns i386 or x86_64
+	    UNAME_PROCESSOR=$UNAME_MACHINE
+	fi
+	GUESS=$UNAME_PROCESSOR-apple-darwin$UNAME_RELEASE
+	;;
+    *:procnto*:*:* | *:QNX:[0123456789]*:*)
+	UNAME_PROCESSOR=`uname -p`
+	if test "$UNAME_PROCESSOR" = x86; then
+		UNAME_PROCESSOR=i386
+		UNAME_MACHINE=pc
+	fi
+	GUESS=$UNAME_PROCESSOR-$UNAME_MACHINE-nto-qnx$UNAME_RELEASE
+	;;
+    *:QNX:*:4*)
+	GUESS=i386-pc-qnx
+	;;
+    NEO-*:NONSTOP_KERNEL:*:*)
+	GUESS=neo-tandem-nsk$UNAME_RELEASE
+	;;
+    NSE-*:NONSTOP_KERNEL:*:*)
+	GUESS=nse-tandem-nsk$UNAME_RELEASE
+	;;
+    NSR-*:NONSTOP_KERNEL:*:*)
+	GUESS=nsr-tandem-nsk$UNAME_RELEASE
+	;;
+    NSV-*:NONSTOP_KERNEL:*:*)
+	GUESS=nsv-tandem-nsk$UNAME_RELEASE
+	;;
+    NSX-*:NONSTOP_KERNEL:*:*)
+	GUESS=nsx-tandem-nsk$UNAME_RELEASE
+	;;
+    *:NonStop-UX:*:*)
+	GUESS=mips-compaq-nonstopux
+	;;
+    BS2000:POSIX*:*:*)
+	GUESS=bs2000-siemens-sysv
+	;;
+    DS/*:UNIX_System_V:*:*)
+	GUESS=$UNAME_MACHINE-$UNAME_SYSTEM-$UNAME_RELEASE
+	;;
+    *:Plan9:*:*)
+	# "uname -m" is not consistent, so use $cputype instead. 386
+	# is converted to i386 for consistency with other x86
+	# operating systems.
+	if test "${cputype-}" = 386; then
+	    UNAME_MACHINE=i386
+	elif test "x${cputype-}" != x; then
+	    UNAME_MACHINE=$cputype
+	fi
+	GUESS=$UNAME_MACHINE-unknown-plan9
+	;;
+    *:TOPS-10:*:*)
+	GUESS=pdp10-unknown-tops10
+	;;
+    *:TENEX:*:*)
+	GUESS=pdp10-unknown-tenex
+	;;
+    KS10:TOPS-20:*:* | KL10:TOPS-20:*:* | TYPE4:TOPS-20:*:*)
+	GUESS=pdp10-dec-tops20
+	;;
+    XKL-1:TOPS-20:*:* | TYPE5:TOPS-20:*:*)
+	GUESS=pdp10-xkl-tops20
+	;;
+    *:TOPS-20:*:*)
+	GUESS=pdp10-unknown-tops20
+	;;
+    *:ITS:*:*)
+	GUESS=pdp10-unknown-its
+	;;
+    SEI:*:*:SEIUX)
+	GUESS=mips-sei-seiux$UNAME_RELEASE
+	;;
+    *:DragonFly:*:*)
+	DRAGONFLY_REL=`echo "$UNAME_RELEASE" | sed -e 's/[-(].*//'`
+	GUESS=$UNAME_MACHINE-unknown-dragonfly$DRAGONFLY_REL
+	;;
+    *:*VMS:*:*)
+	UNAME_MACHINE=`(uname -p) 2>/dev/null`
+	case $UNAME_MACHINE in
+	    A*) GUESS=alpha-dec-vms ;;
+	    I*) GUESS=ia64-dec-vms ;;
+	    V*) GUESS=vax-dec-vms ;;
+	esac ;;
+    *:XENIX:*:SysV)
+	GUESS=i386-pc-xenix
+	;;
+    i*86:skyos:*:*)
+	SKYOS_REL=`echo "$UNAME_RELEASE" | sed -e 's/ .*$//'`
+	GUESS=$UNAME_MACHINE-pc-skyos$SKYOS_REL
+	;;
+    i*86:rdos:*:*)
+	GUESS=$UNAME_MACHINE-pc-rdos
+	;;
+    i*86:Fiwix:*:*)
+	GUESS=$UNAME_MACHINE-pc-fiwix
+	;;
+    *:AROS:*:*)
+	GUESS=$UNAME_MACHINE-unknown-aros
+	;;
+    x86_64:VMkernel:*:*)
+	GUESS=$UNAME_MACHINE-unknown-esx
+	;;
+    amd64:Isilon\ OneFS:*:*)
+	GUESS=x86_64-unknown-onefs
+	;;
+    *:Unleashed:*:*)
+	GUESS=$UNAME_MACHINE-unknown-unleashed$UNAME_RELEASE
+	;;
+esac
+
+# Do we have a guess based on uname results?
+if test "x$GUESS" != x; then
+    echo "$GUESS"
+    exit
+fi
+
+# No uname command or uname output not recognized.
+set_cc_for_build
+cat > "$dummy.c" <<EOF
+#ifdef _SEQUENT_
+#include <sys/types.h>
+#include <sys/utsname.h>
+#endif
+#if defined(ultrix) || defined(_ultrix) || defined(__ultrix) || defined(__ultrix__)
+#if defined (vax) || defined (__vax) || defined (__vax__) || defined(mips) || defined(__mips) || defined(__mips__) || defined(MIPS) || defined(__MIPS__)
+#include <signal.h>
+#if defined(_SIZE_T_) || defined(SIGLOST)
+#include <sys/utsname.h>
+#endif
+#endif
+#endif
+main ()
+{
+#if defined (sony)
+#if defined (MIPSEB)
+  /* BFD wants "bsd" instead of "newsos".  Perhaps BFD should be changed,
+     I don't know....  */
+  printf ("mips-sony-bsd\n"); exit (0);
+#else
+#include <sys/param.h>
+  printf ("m68k-sony-newsos%s\n",
+#ifdef NEWSOS4
+  "4"
+#else
+  ""
+#endif
+  ); exit (0);
+#endif
+#endif
+
+#if defined (NeXT)
+#if !defined (__ARCHITECTURE__)
+#define __ARCHITECTURE__ "m68k"
+#endif
+  int version;
+  version=`(hostinfo | sed -n 's/.*NeXT Mach \([0-9]*\).*/\1/p') 2>/dev/null`;
+  if (version < 4)
+    printf ("%s-next-nextstep%d\n", __ARCHITECTURE__, version);
+  else
+    printf ("%s-next-openstep%d\n", __ARCHITECTURE__, version);
+  exit (0);
+#endif
+
+#if defined (MULTIMAX) || defined (n16)
+#if defined (UMAXV)
+  printf ("ns32k-encore-sysv\n"); exit (0);
+#else
+#if defined (CMU)
+  printf ("ns32k-encore-mach\n"); exit (0);
+#else
+  printf ("ns32k-encore-bsd\n"); exit (0);
+#endif
+#endif
+#endif
+
+#if defined (__386BSD__)
+  printf ("i386-pc-bsd\n"); exit (0);
+#endif
+
+#if defined (sequent)
+#if defined (i386)
+  printf ("i386-sequent-dynix\n"); exit (0);
+#endif
+#if defined (ns32000)
+  printf ("ns32k-sequent-dynix\n"); exit (0);
+#endif
+#endif
+
+#if defined (_SEQUENT_)
+  struct utsname un;
+
+  uname(&un);
+  if (strncmp(un.version, "V2", 2) == 0) {
+    printf ("i386-sequent-ptx2\n"); exit (0);
+  }
+  if (strncmp(un.version, "V1", 2) == 0) { /* XXX is V1 correct? */
+    printf ("i386-sequent-ptx1\n"); exit (0);
+  }
+  printf ("i386-sequent-ptx\n"); exit (0);
+#endif
+
+#if defined (vax)
+#if !defined (ultrix)
+#include <sys/param.h>
+#if defined (BSD)
+#if BSD == 43
+  printf ("vax-dec-bsd4.3\n"); exit (0);
+#else
+#if BSD == 199006
+  printf ("vax-dec-bsd4.3reno\n"); exit (0);
+#else
+  printf ("vax-dec-bsd\n"); exit (0);
+#endif
+#endif
+#else
+  printf ("vax-dec-bsd\n"); exit (0);
+#endif
+#else
+#if defined(_SIZE_T_) || defined(SIGLOST)
+  struct utsname un;
+  uname (&un);
+  printf ("vax-dec-ultrix%s\n", un.release); exit (0);
+#else
+  printf ("vax-dec-ultrix\n"); exit (0);
+#endif
+#endif
+#endif
+#if defined(ultrix) || defined(_ultrix) || defined(__ultrix) || defined(__ultrix__)
+#if defined(mips) || defined(__mips) || defined(__mips__) || defined(MIPS) || defined(__MIPS__)
+#if defined(_SIZE_T_) || defined(SIGLOST)
+  struct utsname *un;
+  uname (&un);
+  printf ("mips-dec-ultrix%s\n", un.release); exit (0);
+#else
+  printf ("mips-dec-ultrix\n"); exit (0);
+#endif
+#endif
+#endif
+
+#if defined (alliant) && defined (i860)
+  printf ("i860-alliant-bsd\n"); exit (0);
+#endif
+
+  exit (1);
+}
+EOF
+
+$CC_FOR_BUILD -o "$dummy" "$dummy.c" 2>/dev/null && SYSTEM_NAME=`"$dummy"` &&
+	{ echo "$SYSTEM_NAME"; exit; }
+
+# Apollos put the system type in the environment.
+test -d /usr/apollo && { echo "$ISP-apollo-$SYSTYPE"; exit; }
+
+echo "$0: unable to guess system type" >&2
+
+case $UNAME_MACHINE:$UNAME_SYSTEM in
+    mips:Linux | mips64:Linux)
+	# If we got here on MIPS GNU/Linux, output extra information.
+	cat >&2 <<EOF
+
+NOTE: MIPS GNU/Linux systems require a C compiler to fully recognize
+the system type. Please install a C compiler and try again.
+EOF
+	;;
+esac
+
+cat >&2 <<EOF
+
+This script (version $timestamp), has failed to recognize the
+operating system you are using. If your script is old, overwrite *all*
+copies of config.guess and config.sub with the latest versions from:
+
+  https://git.savannah.gnu.org/cgit/config.git/plain/config.guess
+and
+  https://git.savannah.gnu.org/cgit/config.git/plain/config.sub
+EOF
+
+our_year=`echo $timestamp | sed 's,-.*,,'`
+thisyear=`date +%Y`
+# shellcheck disable=SC2003
+script_age=`expr "$thisyear" - "$our_year"`
+if test "$script_age" -lt 3 ; then
+   cat >&2 <<EOF
+
+If $0 has already been updated, send the following data and any
+information you think might be pertinent to config-patches@gnu.org to
+provide the necessary information to handle your system.
+
+config.guess timestamp = $timestamp
+
+uname -m = `(uname -m) 2>/dev/null || echo unknown`
+uname -r = `(uname -r) 2>/dev/null || echo unknown`
+uname -s = `(uname -s) 2>/dev/null || echo unknown`
+uname -v = `(uname -v) 2>/dev/null || echo unknown`
+
+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null`
+/bin/uname -X     = `(/bin/uname -X) 2>/dev/null`
+
+hostinfo               = `(hostinfo) 2>/dev/null`
+/bin/universe          = `(/bin/universe) 2>/dev/null`
+/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null`
+/bin/arch              = `(/bin/arch) 2>/dev/null`
+/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null`
+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null`
+
+UNAME_MACHINE = "$UNAME_MACHINE"
+UNAME_RELEASE = "$UNAME_RELEASE"
+UNAME_SYSTEM  = "$UNAME_SYSTEM"
+UNAME_VERSION = "$UNAME_VERSION"
+EOF
+fi
+
+exit 1
+
+# Local variables:
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "timestamp='"
+# time-stamp-format: "%:y-%02m-%02d"
+# time-stamp-end: "'"
+# End:
diff --git a/config.h.in b/config.h.in
new file mode 100644
index 0000000..0f02ce8
--- /dev/null
+++ b/config.h.in
@@ -0,0 +1,238 @@
+/* config.h.in.  Generated from configure.ac by autoheader.  */
+
+/* Define if building universal (internal helper macro) */
+#undef AC_APPLE_UNIVERSAL_BUILD
+
+/* Define to 1 if you have the <dlfcn.h> header file. */
+#undef HAVE_DLFCN_H
+
+/* Define to 1 if you don't have `vprintf' but do have `_doprnt.' */
+#undef HAVE_DOPRNT
+
+/* Define to 1 if you have the `dup2' function. */
+#undef HAVE_DUP2
+
+/* Define to 1 if you have the <fcntl.h> header file. */
+#undef HAVE_FCNTL_H
+
+/* Define to 1 if you have the <float.h> header file. */
+#undef HAVE_FLOAT_H
+
+/* Define to 1 if you have the `fork' function. */
+#undef HAVE_FORK
+
+/* Define to 1 if you have the `gethostname' function. */
+#undef HAVE_GETHOSTNAME
+
+/* Define to 1 if you have the `getopt_long' function. */
+#undef HAVE_GETOPT_LONG
+
+/* Define to 1 if you have the `getpagesize' function. */
+#undef HAVE_GETPAGESIZE
+
+/* Define to 1 if you have the <inttypes.h> header file. */
+#undef HAVE_INTTYPES_H
+
+/* Define to 1 if you have the `dl' library (-ldl). */
+#undef HAVE_LIBDL
+
+/* Define to 1 if you have the `m' library (-lm). */
+#undef HAVE_LIBM
+
+/* Define to 1 if you have the `z' library (-lz). */
+#undef HAVE_LIBZ
+
+/* Define to 1 if you have the <limits.h> header file. */
+#undef HAVE_LIMITS_H
+
+/* Define to 1 if your system has a GNU libc compatible `malloc' function, and
+   to 0 otherwise. */
+#undef HAVE_MALLOC
+
+/* Define to 1 if you have the `memset' function. */
+#undef HAVE_MEMSET
+
+/* Define to 1 if you have the `pow' function. */
+#undef HAVE_POW
+
+/* Define to 1 if the system has the type `ptrdiff_t'. */
+#undef HAVE_PTRDIFF_T
+
+/* Define to 1 if your system has a GNU libc compatible `realloc' function,
+   and to 0 otherwise. */
+#undef HAVE_REALLOC
+
+/* Define to 1 if you have the `sqrt' function. */
+#undef HAVE_SQRT
+
+/* Define to 1 if stdbool.h conforms to C99. */
+#undef HAVE_STDBOOL_H
+
+/* Define to 1 if you have the <stddef.h> header file. */
+#undef HAVE_STDDEF_H
+
+/* Define to 1 if you have the <stdint.h> header file. */
+#undef HAVE_STDINT_H
+
+/* Define to 1 if you have the <stdio.h> header file. */
+#undef HAVE_STDIO_H
+
+/* Define to 1 if you have the <stdlib.h> header file. */
+#undef HAVE_STDLIB_H
+
+/* Define to 1 if you have the `strdup' function. */
+#undef HAVE_STRDUP
+
+/* Define to 1 if you have the `strerror' function. */
+#undef HAVE_STRERROR
+
+/* Define to 1 if you have the <strings.h> header file. */
+#undef HAVE_STRINGS_H
+
+/* Define to 1 if you have the <string.h> header file. */
+#undef HAVE_STRING_H
+
+/* Define to 1 if you have the `strtoul' function. */
+#undef HAVE_STRTOUL
+
+/* Define to 1 if you have the <sys/param.h> header file. */
+#undef HAVE_SYS_PARAM_H
+
+/* Define to 1 if you have the <sys/stat.h> header file. */
+#undef HAVE_SYS_STAT_H
+
+/* Define to 1 if you have the <sys/types.h> header file. */
+#undef HAVE_SYS_TYPES_H
+
+/* Define to 1 if you have the <unistd.h> header file. */
+#undef HAVE_UNISTD_H
+
+/* Define to 1 if you have the `vfork' function. */
+#undef HAVE_VFORK
+
+/* Define to 1 if you have the <vfork.h> header file. */
+#undef HAVE_VFORK_H
+
+/* Define to 1 if you have the `vprintf' function. */
+#undef HAVE_VPRINTF
+
+/* Define to 1 if `fork' works. */
+#undef HAVE_WORKING_FORK
+
+/* Define to 1 if `vfork' works. */
+#undef HAVE_WORKING_VFORK
+
+/* Define to 1 if you have the <zlib.h> header file. */
+#undef HAVE_ZLIB_H
+
+/* Define to 1 if the system has the type `_Bool'. */
+#undef HAVE__BOOL
+
+/* Name of package */
+#undef PACKAGE
+
+/* Define to the address where bug reports for this package should be sent. */
+#undef PACKAGE_BUGREPORT
+
+/* Define to the full name of this package. */
+#undef PACKAGE_NAME
+
+/* Define to the full name and version of this package. */
+#undef PACKAGE_STRING
+
+/* Define to the one symbol short name of this package. */
+#undef PACKAGE_TARNAME
+
+/* Define to the home page for this package. */
+#undef PACKAGE_URL
+
+/* Define to the version of this package. */
+#undef PACKAGE_VERSION
+
+/* Define to 1 if all of the C90 standard headers exist (not just the ones
+   required in a freestanding environment). This macro is provided for
+   backward compatibility; new code need not use it. */
+#undef STDC_HEADERS
+
+/* Version number of package */
+#undef VERSION
+
+/* Define WORDS_BIGENDIAN to 1 if your processor stores words with the most
+   significant byte first (like Motorola and SPARC, unlike Intel). */
+#if defined AC_APPLE_UNIVERSAL_BUILD
+# if defined __BIG_ENDIAN__
+#  define WORDS_BIGENDIAN 1
+# endif
+#else
+# ifndef WORDS_BIGENDIAN
+#  undef WORDS_BIGENDIAN
+# endif
+#endif
+
+/* Define for Solaris 2.5.1 so the uint32_t typedef from <sys/synch.h>,
+   <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
+   #define below would cause a syntax error. */
+#undef _UINT32_T
+
+/* Define for Solaris 2.5.1 so the uint64_t typedef from <sys/synch.h>,
+   <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
+   #define below would cause a syntax error. */
+#undef _UINT64_T
+
+/* Define for Solaris 2.5.1 so the uint8_t typedef from <sys/synch.h>,
+   <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
+   #define below would cause a syntax error. */
+#undef _UINT8_T
+
+/* Define if the system does not provide ceilf */
+#undef ceilf
+
+/* Define to empty if `const' does not conform to ANSI C. */
+#undef const
+
+/* Define to `__inline__' or `__inline' if that's what the C compiler
+   calls it, or to nothing if 'inline' is not supported under any name.  */
+#ifndef __cplusplus
+#undef inline
+#endif
+
+/* Define to the type of a signed integer type of width exactly 64 bits if
+   such a type exists and the standard includes do not define it. */
+#undef int64_t
+
+/* Define to rpl_malloc if the replacement function should be used. */
+#undef malloc
+
+/* Define to `int' if <sys/types.h> does not define. */
+#undef mode_t
+
+/* Define as a signed integer type capable of holding a process identifier. */
+#undef pid_t
+
+/* Define to rpl_realloc if the replacement function should be used. */
+#undef realloc
+
+/* Define to `unsigned int' if <sys/types.h> does not define. */
+#undef size_t
+
+/* Define to `int' if <sys/types.h> does not define. */
+#undef ssize_t
+
+/* Define to the type of an unsigned integer type of width exactly 16 bits if
+   such a type exists and the standard includes do not define it. */
+#undef uint16_t
+
+/* Define to the type of an unsigned integer type of width exactly 32 bits if
+   such a type exists and the standard includes do not define it. */
+#undef uint32_t
+
+/* Define to the type of an unsigned integer type of width exactly 64 bits if
+   such a type exists and the standard includes do not define it. */
+#undef uint64_t
+
+/* Define to the type of an unsigned integer type of width exactly 8 bits if
+   such a type exists and the standard includes do not define it. */
+#undef uint8_t
+
+/* Define as `fork' if `vfork' does not work. */
+#undef vfork
diff --git a/config.sub b/config.sub
new file mode 100755
index 0000000..dba16e8
--- /dev/null
+++ b/config.sub
@@ -0,0 +1,1890 @@
+#! /bin/sh
+# Configuration validation subroutine script.
+#   Copyright 1992-2022 Free Software Foundation, Inc.
+
+# shellcheck disable=SC2006,SC2268 # see below for rationale
+
+timestamp='2022-01-03'
+
+# This file is free software; you can redistribute it and/or modify it
+# under the terms of the GNU General Public License as published by
+# the Free Software Foundation, either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>.
+#
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that
+# program.  This Exception is an additional permission under section 7
+# of the GNU General Public License, version 3 ("GPLv3").
+
+
+# Please send patches to <config-patches@gnu.org>.
+#
+# Configuration subroutine to validate and canonicalize a configuration type.
+# Supply the specified configuration type as an argument.
+# If it is invalid, we print an error message on stderr and exit with code 1.
+# Otherwise, we print the canonical config type on stdout and succeed.
+
+# You can get the latest version of this script from:
+# https://git.savannah.gnu.org/cgit/config.git/plain/config.sub
+
+# This file is supposed to be the same for all GNU packages
+# and recognize all the CPU types, system types and aliases
+# that are meaningful with *any* GNU software.
+# Each package is responsible for reporting which valid configurations
+# it does not support.  The user should be able to distinguish
+# a failure to support a valid configuration from a meaningless
+# configuration.
+
+# The goal of this file is to map all the various variations of a given
+# machine specification into a single specification in the form:
+#	CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM
+# or in some cases, the newer four-part form:
+#	CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM
+# It is wrong to echo any other type of specification.
+
+# The "shellcheck disable" line above the timestamp inhibits complaints
+# about features and limitations of the classic Bourne shell that were
+# superseded or lifted in POSIX.  However, this script identifies a wide
+# variety of pre-POSIX systems that do not have POSIX shells at all, and
+# even some reasonably current systems (Solaris 10 as case-in-point) still
+# have a pre-POSIX /bin/sh.
+
+me=`echo "$0" | sed -e 's,.*/,,'`
+
+usage="\
+Usage: $0 [OPTION] CPU-MFR-OPSYS or ALIAS
+
+Canonicalize a configuration name.
+
+Options:
+  -h, --help         print this help, then exit
+  -t, --time-stamp   print date of last modification, then exit
+  -v, --version      print version number, then exit
+
+Report bugs and patches to <config-patches@gnu.org>."
+
+version="\
+GNU config.sub ($timestamp)
+
+Copyright 1992-2022 Free Software Foundation, Inc.
+
+This is free software; see the source for copying conditions.  There is NO
+warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."
+
+help="
+Try \`$me --help' for more information."
+
+# Parse command line
+while test $# -gt 0 ; do
+  case $1 in
+    --time-stamp | --time* | -t )
+       echo "$timestamp" ; exit ;;
+    --version | -v )
+       echo "$version" ; exit ;;
+    --help | --h* | -h )
+       echo "$usage"; exit ;;
+    -- )     # Stop option processing
+       shift; break ;;
+    - )	# Use stdin as input.
+       break ;;
+    -* )
+       echo "$me: invalid option $1$help" >&2
+       exit 1 ;;
+
+    *local*)
+       # First pass through any local machine types.
+       echo "$1"
+       exit ;;
+
+    * )
+       break ;;
+  esac
+done
+
+case $# in
+ 0) echo "$me: missing argument$help" >&2
+    exit 1;;
+ 1) ;;
+ *) echo "$me: too many arguments$help" >&2
+    exit 1;;
+esac
+
+# Split fields of configuration type
+# shellcheck disable=SC2162
+saved_IFS=$IFS
+IFS="-" read field1 field2 field3 field4 <<EOF
+$1
+EOF
+IFS=$saved_IFS
+
+# Separate into logical components for further validation
+case $1 in
+	*-*-*-*-*)
+		echo Invalid configuration \`"$1"\': more than four components >&2
+		exit 1
+		;;
+	*-*-*-*)
+		basic_machine=$field1-$field2
+		basic_os=$field3-$field4
+		;;
+	*-*-*)
+		# Ambiguous whether COMPANY is present, or skipped and KERNEL-OS is two
+		# parts
+		maybe_os=$field2-$field3
+		case $maybe_os in
+			nto-qnx* | linux-* | uclinux-uclibc* \
+			| uclinux-gnu* | kfreebsd*-gnu* | knetbsd*-gnu* | netbsd*-gnu* \
+			| netbsd*-eabi* | kopensolaris*-gnu* | cloudabi*-eabi* \
+			| storm-chaos* | os2-emx* | rtmk-nova*)
+				basic_machine=$field1
+				basic_os=$maybe_os
+				;;
+			android-linux)
+				basic_machine=$field1-unknown
+				basic_os=linux-android
+				;;
+			*)
+				basic_machine=$field1-$field2
+				basic_os=$field3
+				;;
+		esac
+		;;
+	*-*)
+		# A lone config we happen to match not fitting any pattern
+		case $field1-$field2 in
+			decstation-3100)
+				basic_machine=mips-dec
+				basic_os=
+				;;
+			*-*)
+				# Second component is usually, but not always the OS
+				case $field2 in
+					# Prevent following clause from handling this valid os
+					sun*os*)
+						basic_machine=$field1
+						basic_os=$field2
+						;;
+					zephyr*)
+						basic_machine=$field1-unknown
+						basic_os=$field2
+						;;
+					# Manufacturers
+					dec* | mips* | sequent* | encore* | pc533* | sgi* | sony* \
+					| att* | 7300* | 3300* | delta* | motorola* | sun[234]* \
+					| unicom* | ibm* | next | hp | isi* | apollo | altos* \
+					| convergent* | ncr* | news | 32* | 3600* | 3100* \
+					| hitachi* | c[123]* | convex* | sun | crds | omron* | dg \
+					| ultra | tti* | harris | dolphin | highlevel | gould \
+					| cbm | ns | masscomp | apple | axis | knuth | cray \
+					| microblaze* | sim | cisco \
+					| oki | wec | wrs | winbond)
+						basic_machine=$field1-$field2
+						basic_os=
+						;;
+					*)
+						basic_machine=$field1
+						basic_os=$field2
+						;;
+				esac
+			;;
+		esac
+		;;
+	*)
+		# Convert single-component short-hands not valid as part of
+		# multi-component configurations.
+		case $field1 in
+			386bsd)
+				basic_machine=i386-pc
+				basic_os=bsd
+				;;
+			a29khif)
+				basic_machine=a29k-amd
+				basic_os=udi
+				;;
+			adobe68k)
+				basic_machine=m68010-adobe
+				basic_os=scout
+				;;
+			alliant)
+				basic_machine=fx80-alliant
+				basic_os=
+				;;
+			altos | altos3068)
+				basic_machine=m68k-altos
+				basic_os=
+				;;
+			am29k)
+				basic_machine=a29k-none
+				basic_os=bsd
+				;;
+			amdahl)
+				basic_machine=580-amdahl
+				basic_os=sysv
+				;;
+			amiga)
+				basic_machine=m68k-unknown
+				basic_os=
+				;;
+			amigaos | amigados)
+				basic_machine=m68k-unknown
+				basic_os=amigaos
+				;;
+			amigaunix | amix)
+				basic_machine=m68k-unknown
+				basic_os=sysv4
+				;;
+			apollo68)
+				basic_machine=m68k-apollo
+				basic_os=sysv
+				;;
+			apollo68bsd)
+				basic_machine=m68k-apollo
+				basic_os=bsd
+				;;
+			aros)
+				basic_machine=i386-pc
+				basic_os=aros
+				;;
+			aux)
+				basic_machine=m68k-apple
+				basic_os=aux
+				;;
+			balance)
+				basic_machine=ns32k-sequent
+				basic_os=dynix
+				;;
+			blackfin)
+				basic_machine=bfin-unknown
+				basic_os=linux
+				;;
+			cegcc)
+				basic_machine=arm-unknown
+				basic_os=cegcc
+				;;
+			convex-c1)
+				basic_machine=c1-convex
+				basic_os=bsd
+				;;
+			convex-c2)
+				basic_machine=c2-convex
+				basic_os=bsd
+				;;
+			convex-c32)
+				basic_machine=c32-convex
+				basic_os=bsd
+				;;
+			convex-c34)
+				basic_machine=c34-convex
+				basic_os=bsd
+				;;
+			convex-c38)
+				basic_machine=c38-convex
+				basic_os=bsd
+				;;
+			cray)
+				basic_machine=j90-cray
+				basic_os=unicos
+				;;
+			crds | unos)
+				basic_machine=m68k-crds
+				basic_os=
+				;;
+			da30)
+				basic_machine=m68k-da30
+				basic_os=
+				;;
+			decstation | pmax | pmin | dec3100 | decstatn)
+				basic_machine=mips-dec
+				basic_os=
+				;;
+			delta88)
+				basic_machine=m88k-motorola
+				basic_os=sysv3
+				;;
+			dicos)
+				basic_machine=i686-pc
+				basic_os=dicos
+				;;
+			djgpp)
+				basic_machine=i586-pc
+				basic_os=msdosdjgpp
+				;;
+			ebmon29k)
+				basic_machine=a29k-amd
+				basic_os=ebmon
+				;;
+			es1800 | OSE68k | ose68k | ose | OSE)
+				basic_machine=m68k-ericsson
+				basic_os=ose
+				;;
+			gmicro)
+				basic_machine=tron-gmicro
+				basic_os=sysv
+				;;
+			go32)
+				basic_machine=i386-pc
+				basic_os=go32
+				;;
+			h8300hms)
+				basic_machine=h8300-hitachi
+				basic_os=hms
+				;;
+			h8300xray)
+				basic_machine=h8300-hitachi
+				basic_os=xray
+				;;
+			h8500hms)
+				basic_machine=h8500-hitachi
+				basic_os=hms
+				;;
+			harris)
+				basic_machine=m88k-harris
+				basic_os=sysv3
+				;;
+			hp300 | hp300hpux)
+				basic_machine=m68k-hp
+				basic_os=hpux
+				;;
+			hp300bsd)
+				basic_machine=m68k-hp
+				basic_os=bsd
+				;;
+			hppaosf)
+				basic_machine=hppa1.1-hp
+				basic_os=osf
+				;;
+			hppro)
+				basic_machine=hppa1.1-hp
+				basic_os=proelf
+				;;
+			i386mach)
+				basic_machine=i386-mach
+				basic_os=mach
+				;;
+			isi68 | isi)
+				basic_machine=m68k-isi
+				basic_os=sysv
+				;;
+			m68knommu)
+				basic_machine=m68k-unknown
+				basic_os=linux
+				;;
+			magnum | m3230)
+				basic_machine=mips-mips
+				basic_os=sysv
+				;;
+			merlin)
+				basic_machine=ns32k-utek
+				basic_os=sysv
+				;;
+			mingw64)
+				basic_machine=x86_64-pc
+				basic_os=mingw64
+				;;
+			mingw32)
+				basic_machine=i686-pc
+				basic_os=mingw32
+				;;
+			mingw32ce)
+				basic_machine=arm-unknown
+				basic_os=mingw32ce
+				;;
+			monitor)
+				basic_machine=m68k-rom68k
+				basic_os=coff
+				;;
+			morphos)
+				basic_machine=powerpc-unknown
+				basic_os=morphos
+				;;
+			moxiebox)
+				basic_machine=moxie-unknown
+				basic_os=moxiebox
+				;;
+			msdos)
+				basic_machine=i386-pc
+				basic_os=msdos
+				;;
+			msys)
+				basic_machine=i686-pc
+				basic_os=msys
+				;;
+			mvs)
+				basic_machine=i370-ibm
+				basic_os=mvs
+				;;
+			nacl)
+				basic_machine=le32-unknown
+				basic_os=nacl
+				;;
+			ncr3000)
+				basic_machine=i486-ncr
+				basic_os=sysv4
+				;;
+			netbsd386)
+				basic_machine=i386-pc
+				basic_os=netbsd
+				;;
+			netwinder)
+				basic_machine=armv4l-rebel
+				basic_os=linux
+				;;
+			news | news700 | news800 | news900)
+				basic_machine=m68k-sony
+				basic_os=newsos
+				;;
+			news1000)
+				basic_machine=m68030-sony
+				basic_os=newsos
+				;;
+			necv70)
+				basic_machine=v70-nec
+				basic_os=sysv
+				;;
+			nh3000)
+				basic_machine=m68k-harris
+				basic_os=cxux
+				;;
+			nh[45]000)
+				basic_machine=m88k-harris
+				basic_os=cxux
+				;;
+			nindy960)
+				basic_machine=i960-intel
+				basic_os=nindy
+				;;
+			mon960)
+				basic_machine=i960-intel
+				basic_os=mon960
+				;;
+			nonstopux)
+				basic_machine=mips-compaq
+				basic_os=nonstopux
+				;;
+			os400)
+				basic_machine=powerpc-ibm
+				basic_os=os400
+				;;
+			OSE68000 | ose68000)
+				basic_machine=m68000-ericsson
+				basic_os=ose
+				;;
+			os68k)
+				basic_machine=m68k-none
+				basic_os=os68k
+				;;
+			paragon)
+				basic_machine=i860-intel
+				basic_os=osf
+				;;
+			parisc)
+				basic_machine=hppa-unknown
+				basic_os=linux
+				;;
+			psp)
+				basic_machine=mipsallegrexel-sony
+				basic_os=psp
+				;;
+			pw32)
+				basic_machine=i586-unknown
+				basic_os=pw32
+				;;
+			rdos | rdos64)
+				basic_machine=x86_64-pc
+				basic_os=rdos
+				;;
+			rdos32)
+				basic_machine=i386-pc
+				basic_os=rdos
+				;;
+			rom68k)
+				basic_machine=m68k-rom68k
+				basic_os=coff
+				;;
+			sa29200)
+				basic_machine=a29k-amd
+				basic_os=udi
+				;;
+			sei)
+				basic_machine=mips-sei
+				basic_os=seiux
+				;;
+			sequent)
+				basic_machine=i386-sequent
+				basic_os=
+				;;
+			sps7)
+				basic_machine=m68k-bull
+				basic_os=sysv2
+				;;
+			st2000)
+				basic_machine=m68k-tandem
+				basic_os=
+				;;
+			stratus)
+				basic_machine=i860-stratus
+				basic_os=sysv4
+				;;
+			sun2)
+				basic_machine=m68000-sun
+				basic_os=
+				;;
+			sun2os3)
+				basic_machine=m68000-sun
+				basic_os=sunos3
+				;;
+			sun2os4)
+				basic_machine=m68000-sun
+				basic_os=sunos4
+				;;
+			sun3)
+				basic_machine=m68k-sun
+				basic_os=
+				;;
+			sun3os3)
+				basic_machine=m68k-sun
+				basic_os=sunos3
+				;;
+			sun3os4)
+				basic_machine=m68k-sun
+				basic_os=sunos4
+				;;
+			sun4)
+				basic_machine=sparc-sun
+				basic_os=
+				;;
+			sun4os3)
+				basic_machine=sparc-sun
+				basic_os=sunos3
+				;;
+			sun4os4)
+				basic_machine=sparc-sun
+				basic_os=sunos4
+				;;
+			sun4sol2)
+				basic_machine=sparc-sun
+				basic_os=solaris2
+				;;
+			sun386 | sun386i | roadrunner)
+				basic_machine=i386-sun
+				basic_os=
+				;;
+			sv1)
+				basic_machine=sv1-cray
+				basic_os=unicos
+				;;
+			symmetry)
+				basic_machine=i386-sequent
+				basic_os=dynix
+				;;
+			t3e)
+				basic_machine=alphaev5-cray
+				basic_os=unicos
+				;;
+			t90)
+				basic_machine=t90-cray
+				basic_os=unicos
+				;;
+			toad1)
+				basic_machine=pdp10-xkl
+				basic_os=tops20
+				;;
+			tpf)
+				basic_machine=s390x-ibm
+				basic_os=tpf
+				;;
+			udi29k)
+				basic_machine=a29k-amd
+				basic_os=udi
+				;;
+			ultra3)
+				basic_machine=a29k-nyu
+				basic_os=sym1
+				;;
+			v810 | necv810)
+				basic_machine=v810-nec
+				basic_os=none
+				;;
+			vaxv)
+				basic_machine=vax-dec
+				basic_os=sysv
+				;;
+			vms)
+				basic_machine=vax-dec
+				basic_os=vms
+				;;
+			vsta)
+				basic_machine=i386-pc
+				basic_os=vsta
+				;;
+			vxworks960)
+				basic_machine=i960-wrs
+				basic_os=vxworks
+				;;
+			vxworks68)
+				basic_machine=m68k-wrs
+				basic_os=vxworks
+				;;
+			vxworks29k)
+				basic_machine=a29k-wrs
+				basic_os=vxworks
+				;;
+			xbox)
+				basic_machine=i686-pc
+				basic_os=mingw32
+				;;
+			ymp)
+				basic_machine=ymp-cray
+				basic_os=unicos
+				;;
+			*)
+				basic_machine=$1
+				basic_os=
+				;;
+		esac
+		;;
+esac
+
+# Decode 1-component or ad-hoc basic machines
+case $basic_machine in
+	# Here we handle the default manufacturer of certain CPU types.  It is in
+	# some cases the only manufacturer, in others, it is the most popular.
+	w89k)
+		cpu=hppa1.1
+		vendor=winbond
+		;;
+	op50n)
+		cpu=hppa1.1
+		vendor=oki
+		;;
+	op60c)
+		cpu=hppa1.1
+		vendor=oki
+		;;
+	ibm*)
+		cpu=i370
+		vendor=ibm
+		;;
+	orion105)
+		cpu=clipper
+		vendor=highlevel
+		;;
+	mac | mpw | mac-mpw)
+		cpu=m68k
+		vendor=apple
+		;;
+	pmac | pmac-mpw)
+		cpu=powerpc
+		vendor=apple
+		;;
+
+	# Recognize the various machine names and aliases which stand
+	# for a CPU type and a company and sometimes even an OS.
+	3b1 | 7300 | 7300-att | att-7300 | pc7300 | safari | unixpc)
+		cpu=m68000
+		vendor=att
+		;;
+	3b*)
+		cpu=we32k
+		vendor=att
+		;;
+	bluegene*)
+		cpu=powerpc
+		vendor=ibm
+		basic_os=cnk
+		;;
+	decsystem10* | dec10*)
+		cpu=pdp10
+		vendor=dec
+		basic_os=tops10
+		;;
+	decsystem20* | dec20*)
+		cpu=pdp10
+		vendor=dec
+		basic_os=tops20
+		;;
+	delta | 3300 | motorola-3300 | motorola-delta \
+	      | 3300-motorola | delta-motorola)
+		cpu=m68k
+		vendor=motorola
+		;;
+	dpx2*)
+		cpu=m68k
+		vendor=bull
+		basic_os=sysv3
+		;;
+	encore | umax | mmax)
+		cpu=ns32k
+		vendor=encore
+		;;
+	elxsi)
+		cpu=elxsi
+		vendor=elxsi
+		basic_os=${basic_os:-bsd}
+		;;
+	fx2800)
+		cpu=i860
+		vendor=alliant
+		;;
+	genix)
+		cpu=ns32k
+		vendor=ns
+		;;
+	h3050r* | hiux*)
+		cpu=hppa1.1
+		vendor=hitachi
+		basic_os=hiuxwe2
+		;;
+	hp3k9[0-9][0-9] | hp9[0-9][0-9])
+		cpu=hppa1.0
+		vendor=hp
+		;;
+	hp9k2[0-9][0-9] | hp9k31[0-9])
+		cpu=m68000
+		vendor=hp
+		;;
+	hp9k3[2-9][0-9])
+		cpu=m68k
+		vendor=hp
+		;;
+	hp9k6[0-9][0-9] | hp6[0-9][0-9])
+		cpu=hppa1.0
+		vendor=hp
+		;;
+	hp9k7[0-79][0-9] | hp7[0-79][0-9])
+		cpu=hppa1.1
+		vendor=hp
+		;;
+	hp9k78[0-9] | hp78[0-9])
+		# FIXME: really hppa2.0-hp
+		cpu=hppa1.1
+		vendor=hp
+		;;
+	hp9k8[67]1 | hp8[67]1 | hp9k80[24] | hp80[24] | hp9k8[78]9 | hp8[78]9 | hp9k893 | hp893)
+		# FIXME: really hppa2.0-hp
+		cpu=hppa1.1
+		vendor=hp
+		;;
+	hp9k8[0-9][13679] | hp8[0-9][13679])
+		cpu=hppa1.1
+		vendor=hp
+		;;
+	hp9k8[0-9][0-9] | hp8[0-9][0-9])
+		cpu=hppa1.0
+		vendor=hp
+		;;
+	i*86v32)
+		cpu=`echo "$1" | sed -e 's/86.*/86/'`
+		vendor=pc
+		basic_os=sysv32
+		;;
+	i*86v4*)
+		cpu=`echo "$1" | sed -e 's/86.*/86/'`
+		vendor=pc
+		basic_os=sysv4
+		;;
+	i*86v)
+		cpu=`echo "$1" | sed -e 's/86.*/86/'`
+		vendor=pc
+		basic_os=sysv
+		;;
+	i*86sol2)
+		cpu=`echo "$1" | sed -e 's/86.*/86/'`
+		vendor=pc
+		basic_os=solaris2
+		;;
+	j90 | j90-cray)
+		cpu=j90
+		vendor=cray
+		basic_os=${basic_os:-unicos}
+		;;
+	iris | iris4d)
+		cpu=mips
+		vendor=sgi
+		case $basic_os in
+		    irix*)
+			;;
+		    *)
+			basic_os=irix4
+			;;
+		esac
+		;;
+	miniframe)
+		cpu=m68000
+		vendor=convergent
+		;;
+	*mint | mint[0-9]* | *MiNT | *MiNT[0-9]*)
+		cpu=m68k
+		vendor=atari
+		basic_os=mint
+		;;
+	news-3600 | risc-news)
+		cpu=mips
+		vendor=sony
+		basic_os=newsos
+		;;
+	next | m*-next)
+		cpu=m68k
+		vendor=next
+		case $basic_os in
+		    openstep*)
+		        ;;
+		    nextstep*)
+			;;
+		    ns2*)
+		      basic_os=nextstep2
+			;;
+		    *)
+		      basic_os=nextstep3
+			;;
+		esac
+		;;
+	np1)
+		cpu=np1
+		vendor=gould
+		;;
+	op50n-* | op60c-*)
+		cpu=hppa1.1
+		vendor=oki
+		basic_os=proelf
+		;;
+	pa-hitachi)
+		cpu=hppa1.1
+		vendor=hitachi
+		basic_os=hiuxwe2
+		;;
+	pbd)
+		cpu=sparc
+		vendor=tti
+		;;
+	pbb)
+		cpu=m68k
+		vendor=tti
+		;;
+	pc532)
+		cpu=ns32k
+		vendor=pc532
+		;;
+	pn)
+		cpu=pn
+		vendor=gould
+		;;
+	power)
+		cpu=power
+		vendor=ibm
+		;;
+	ps2)
+		cpu=i386
+		vendor=ibm
+		;;
+	rm[46]00)
+		cpu=mips
+		vendor=siemens
+		;;
+	rtpc | rtpc-*)
+		cpu=romp
+		vendor=ibm
+		;;
+	sde)
+		cpu=mipsisa32
+		vendor=sde
+		basic_os=${basic_os:-elf}
+		;;
+	simso-wrs)
+		cpu=sparclite
+		vendor=wrs
+		basic_os=vxworks
+		;;
+	tower | tower-32)
+		cpu=m68k
+		vendor=ncr
+		;;
+	vpp*|vx|vx-*)
+		cpu=f301
+		vendor=fujitsu
+		;;
+	w65)
+		cpu=w65
+		vendor=wdc
+		;;
+	w89k-*)
+		cpu=hppa1.1
+		vendor=winbond
+		basic_os=proelf
+		;;
+	none)
+		cpu=none
+		vendor=none
+		;;
+	leon|leon[3-9])
+		cpu=sparc
+		vendor=$basic_machine
+		;;
+	leon-*|leon[3-9]-*)
+		cpu=sparc
+		vendor=`echo "$basic_machine" | sed 's/-.*//'`
+		;;
+
+	*-*)
+		# shellcheck disable=SC2162
+		saved_IFS=$IFS
+		IFS="-" read cpu vendor <<EOF
+$basic_machine
+EOF
+		IFS=$saved_IFS
+		;;
+	# We use `pc' rather than `unknown'
+	# because (1) that's what they normally are, and
+	# (2) the word "unknown" tends to confuse beginning users.
+	i*86 | x86_64)
+		cpu=$basic_machine
+		vendor=pc
+		;;
+	# These rules are duplicated from below for sake of the special case above;
+	# i.e. things that normalized to x86 arches should also default to "pc"
+	pc98)
+		cpu=i386
+		vendor=pc
+		;;
+	x64 | amd64)
+		cpu=x86_64
+		vendor=pc
+		;;
+	# Recognize the basic CPU types without company name.
+	*)
+		cpu=$basic_machine
+		vendor=unknown
+		;;
+esac
+
+unset -v basic_machine
+
+# Decode basic machines in the full and proper CPU-Company form.
+case $cpu-$vendor in
+	# Here we handle the default manufacturer of certain CPU types in canonical form. It is in
+	# some cases the only manufacturer, in others, it is the most popular.
+	craynv-unknown)
+		vendor=cray
+		basic_os=${basic_os:-unicosmp}
+		;;
+	c90-unknown | c90-cray)
+		vendor=cray
+		basic_os=${Basic_os:-unicos}
+		;;
+	fx80-unknown)
+		vendor=alliant
+		;;
+	romp-unknown)
+		vendor=ibm
+		;;
+	mmix-unknown)
+		vendor=knuth
+		;;
+	microblaze-unknown | microblazeel-unknown)
+		vendor=xilinx
+		;;
+	rs6000-unknown)
+		vendor=ibm
+		;;
+	vax-unknown)
+		vendor=dec
+		;;
+	pdp11-unknown)
+		vendor=dec
+		;;
+	we32k-unknown)
+		vendor=att
+		;;
+	cydra-unknown)
+		vendor=cydrome
+		;;
+	i370-ibm*)
+		vendor=ibm
+		;;
+	orion-unknown)
+		vendor=highlevel
+		;;
+	xps-unknown | xps100-unknown)
+		cpu=xps100
+		vendor=honeywell
+		;;
+
+	# Here we normalize CPU types with a missing or matching vendor
+	armh-unknown | armh-alt)
+		cpu=armv7l
+		vendor=alt
+		basic_os=${basic_os:-linux-gnueabihf}
+		;;
+	dpx20-unknown | dpx20-bull)
+		cpu=rs6000
+		vendor=bull
+		basic_os=${basic_os:-bosx}
+		;;
+
+	# Here we normalize CPU types irrespective of the vendor
+	amd64-*)
+		cpu=x86_64
+		;;
+	blackfin-*)
+		cpu=bfin
+		basic_os=linux
+		;;
+	c54x-*)
+		cpu=tic54x
+		;;
+	c55x-*)
+		cpu=tic55x
+		;;
+	c6x-*)
+		cpu=tic6x
+		;;
+	e500v[12]-*)
+		cpu=powerpc
+		basic_os=${basic_os}"spe"
+		;;
+	mips3*-*)
+		cpu=mips64
+		;;
+	ms1-*)
+		cpu=mt
+		;;
+	m68knommu-*)
+		cpu=m68k
+		basic_os=linux
+		;;
+	m9s12z-* | m68hcs12z-* | hcs12z-* | s12z-*)
+		cpu=s12z
+		;;
+	openrisc-*)
+		cpu=or32
+		;;
+	parisc-*)
+		cpu=hppa
+		basic_os=linux
+		;;
+	pentium-* | p5-* | k5-* | k6-* | nexgen-* | viac3-*)
+		cpu=i586
+		;;
+	pentiumpro-* | p6-* | 6x86-* | athlon-* | athalon_*-*)
+		cpu=i686
+		;;
+	pentiumii-* | pentium2-* | pentiumiii-* | pentium3-*)
+		cpu=i686
+		;;
+	pentium4-*)
+		cpu=i786
+		;;
+	pc98-*)
+		cpu=i386
+		;;
+	ppc-* | ppcbe-*)
+		cpu=powerpc
+		;;
+	ppcle-* | powerpclittle-*)
+		cpu=powerpcle
+		;;
+	ppc64-*)
+		cpu=powerpc64
+		;;
+	ppc64le-* | powerpc64little-*)
+		cpu=powerpc64le
+		;;
+	sb1-*)
+		cpu=mipsisa64sb1
+		;;
+	sb1el-*)
+		cpu=mipsisa64sb1el
+		;;
+	sh5e[lb]-*)
+		cpu=`echo "$cpu" | sed 's/^\(sh.\)e\(.\)$/\1\2e/'`
+		;;
+	spur-*)
+		cpu=spur
+		;;
+	strongarm-* | thumb-*)
+		cpu=arm
+		;;
+	tx39-*)
+		cpu=mipstx39
+		;;
+	tx39el-*)
+		cpu=mipstx39el
+		;;
+	x64-*)
+		cpu=x86_64
+		;;
+	xscale-* | xscalee[bl]-*)
+		cpu=`echo "$cpu" | sed 's/^xscale/arm/'`
+		;;
+	arm64-* | aarch64le-*)
+		cpu=aarch64
+		;;
+
+	# Recognize the canonical CPU Types that limit and/or modify the
+	# company names they are paired with.
+	cr16-*)
+		basic_os=${basic_os:-elf}
+		;;
+	crisv32-* | etraxfs*-*)
+		cpu=crisv32
+		vendor=axis
+		;;
+	cris-* | etrax*-*)
+		cpu=cris
+		vendor=axis
+		;;
+	crx-*)
+		basic_os=${basic_os:-elf}
+		;;
+	neo-tandem)
+		cpu=neo
+		vendor=tandem
+		;;
+	nse-tandem)
+		cpu=nse
+		vendor=tandem
+		;;
+	nsr-tandem)
+		cpu=nsr
+		vendor=tandem
+		;;
+	nsv-tandem)
+		cpu=nsv
+		vendor=tandem
+		;;
+	nsx-tandem)
+		cpu=nsx
+		vendor=tandem
+		;;
+	mipsallegrexel-sony)
+		cpu=mipsallegrexel
+		vendor=sony
+		;;
+	tile*-*)
+		basic_os=${basic_os:-linux-gnu}
+		;;
+
+	*)
+		# Recognize the canonical CPU types that are allowed with any
+		# company name.
+		case $cpu in
+			1750a | 580 \
+			| a29k \
+			| aarch64 | aarch64_be \
+			| abacus \
+			| alpha | alphaev[4-8] | alphaev56 | alphaev6[78] \
+			| alpha64 | alpha64ev[4-8] | alpha64ev56 | alpha64ev6[78] \
+			| alphapca5[67] | alpha64pca5[67] \
+			| am33_2.0 \
+			| amdgcn \
+			| arc | arceb | arc32 | arc64 \
+			| arm | arm[lb]e | arme[lb] | armv* \
+			| avr | avr32 \
+			| asmjs \
+			| ba \
+			| be32 | be64 \
+			| bfin | bpf | bs2000 \
+			| c[123]* | c30 | [cjt]90 | c4x \
+			| c8051 | clipper | craynv | csky | cydra \
+			| d10v | d30v | dlx | dsp16xx \
+			| e2k | elxsi | epiphany \
+			| f30[01] | f700 | fido | fr30 | frv | ft32 | fx80 \
+			| h8300 | h8500 \
+			| hppa | hppa1.[01] | hppa2.0 | hppa2.0[nw] | hppa64 \
+			| hexagon \
+			| i370 | i*86 | i860 | i960 | ia16 | ia64 \
+			| ip2k | iq2000 \
+			| k1om \
+			| le32 | le64 \
+			| lm32 \
+			| loongarch32 | loongarch64 | loongarchx32 \
+			| m32c | m32r | m32rle \
+			| m5200 | m68000 | m680[012346]0 | m68360 | m683?2 | m68k \
+			| m6811 | m68hc11 | m6812 | m68hc12 | m68hcs12x \
+			| m88110 | m88k | maxq | mb | mcore | mep | metag \
+			| microblaze | microblazeel \
+			| mips | mipsbe | mipseb | mipsel | mipsle \
+			| mips16 \
+			| mips64 | mips64eb | mips64el \
+			| mips64octeon | mips64octeonel \
+			| mips64orion | mips64orionel \
+			| mips64r5900 | mips64r5900el \
+			| mips64vr | mips64vrel \
+			| mips64vr4100 | mips64vr4100el \
+			| mips64vr4300 | mips64vr4300el \
+			| mips64vr5000 | mips64vr5000el \
+			| mips64vr5900 | mips64vr5900el \
+			| mipsisa32 | mipsisa32el \
+			| mipsisa32r2 | mipsisa32r2el \
+			| mipsisa32r3 | mipsisa32r3el \
+			| mipsisa32r5 | mipsisa32r5el \
+			| mipsisa32r6 | mipsisa32r6el \
+			| mipsisa64 | mipsisa64el \
+			| mipsisa64r2 | mipsisa64r2el \
+			| mipsisa64r3 | mipsisa64r3el \
+			| mipsisa64r5 | mipsisa64r5el \
+			| mipsisa64r6 | mipsisa64r6el \
+			| mipsisa64sb1 | mipsisa64sb1el \
+			| mipsisa64sr71k | mipsisa64sr71kel \
+			| mipsr5900 | mipsr5900el \
+			| mipstx39 | mipstx39el \
+			| mmix \
+			| mn10200 | mn10300 \
+			| moxie \
+			| mt \
+			| msp430 \
+			| nds32 | nds32le | nds32be \
+			| nfp \
+			| nios | nios2 | nios2eb | nios2el \
+			| none | np1 | ns16k | ns32k | nvptx \
+			| open8 \
+			| or1k* \
+			| or32 \
+			| orion \
+			| picochip \
+			| pdp10 | pdp11 | pj | pjl | pn | power \
+			| powerpc | powerpc64 | powerpc64le | powerpcle | powerpcspe \
+			| pru \
+			| pyramid \
+			| riscv | riscv32 | riscv32be | riscv64 | riscv64be \
+			| rl78 | romp | rs6000 | rx \
+			| s390 | s390x \
+			| score \
+			| sh | shl \
+			| sh[1234] | sh[24]a | sh[24]ae[lb] | sh[23]e | she[lb] | sh[lb]e \
+			| sh[1234]e[lb] |  sh[12345][lb]e | sh[23]ele | sh64 | sh64le \
+			| sparc | sparc64 | sparc64b | sparc64v | sparc86x | sparclet \
+			| sparclite \
+			| sparcv8 | sparcv9 | sparcv9b | sparcv9v | sv1 | sx* \
+			| spu \
+			| tahoe \
+			| thumbv7* \
+			| tic30 | tic4x | tic54x | tic55x | tic6x | tic80 \
+			| tron \
+			| ubicom32 \
+			| v70 | v850 | v850e | v850e1 | v850es | v850e2 | v850e2v3 \
+			| vax \
+			| visium \
+			| w65 \
+			| wasm32 | wasm64 \
+			| we32k \
+			| x86 | x86_64 | xc16x | xgate | xps100 \
+			| xstormy16 | xtensa* \
+			| ymp \
+			| z8k | z80)
+				;;
+
+			*)
+				echo Invalid configuration \`"$1"\': machine \`"$cpu-$vendor"\' not recognized 1>&2
+				exit 1
+				;;
+		esac
+		;;
+esac
+
+# Here we canonicalize certain aliases for manufacturers.
+case $vendor in
+	digital*)
+		vendor=dec
+		;;
+	commodore*)
+		vendor=cbm
+		;;
+	*)
+		;;
+esac
+
+# Decode manufacturer-specific aliases for certain operating systems.
+
+if test x$basic_os != x
+then
+
+# First recognize some ad-hoc cases, or perhaps split kernel-os, or else just
+# set os.
+case $basic_os in
+	gnu/linux*)
+		kernel=linux
+		os=`echo "$basic_os" | sed -e 's|gnu/linux|gnu|'`
+		;;
+	os2-emx)
+		kernel=os2
+		os=`echo "$basic_os" | sed -e 's|os2-emx|emx|'`
+		;;
+	nto-qnx*)
+		kernel=nto
+		os=`echo "$basic_os" | sed -e 's|nto-qnx|qnx|'`
+		;;
+	*-*)
+		# shellcheck disable=SC2162
+		saved_IFS=$IFS
+		IFS="-" read kernel os <<EOF
+$basic_os
+EOF
+		IFS=$saved_IFS
+		;;
+	# Default OS when just kernel was specified
+	nto*)
+		kernel=nto
+		os=`echo "$basic_os" | sed -e 's|nto|qnx|'`
+		;;
+	linux*)
+		kernel=linux
+		os=`echo "$basic_os" | sed -e 's|linux|gnu|'`
+		;;
+	*)
+		kernel=
+		os=$basic_os
+		;;
+esac
+
+# Now, normalize the OS (knowing we just have one component, it's not a kernel,
+# etc.)
+case $os in
+	# First match some system type aliases that might get confused
+	# with valid system types.
+	# solaris* is a basic system type, with this one exception.
+	auroraux)
+		os=auroraux
+		;;
+	bluegene*)
+		os=cnk
+		;;
+	solaris1 | solaris1.*)
+		os=`echo "$os" | sed -e 's|solaris1|sunos4|'`
+		;;
+	solaris)
+		os=solaris2
+		;;
+	unixware*)
+		os=sysv4.2uw
+		;;
+	# es1800 is here to avoid being matched by es* (a different OS)
+	es1800*)
+		os=ose
+		;;
+	# Some version numbers need modification
+	chorusos*)
+		os=chorusos
+		;;
+	isc)
+		os=isc2.2
+		;;
+	sco6)
+		os=sco5v6
+		;;
+	sco5)
+		os=sco3.2v5
+		;;
+	sco4)
+		os=sco3.2v4
+		;;
+	sco3.2.[4-9]*)
+		os=`echo "$os" | sed -e 's/sco3.2./sco3.2v/'`
+		;;
+	sco*v* | scout)
+		# Don't match below
+		;;
+	sco*)
+		os=sco3.2v2
+		;;
+	psos*)
+		os=psos
+		;;
+	qnx*)
+		os=qnx
+		;;
+	hiux*)
+		os=hiuxwe2
+		;;
+	lynx*178)
+		os=lynxos178
+		;;
+	lynx*5)
+		os=lynxos5
+		;;
+	lynxos*)
+		# don't get caught up in next wildcard
+		;;
+	lynx*)
+		os=lynxos
+		;;
+	mac[0-9]*)
+		os=`echo "$os" | sed -e 's|mac|macos|'`
+		;;
+	opened*)
+		os=openedition
+		;;
+	os400*)
+		os=os400
+		;;
+	sunos5*)
+		os=`echo "$os" | sed -e 's|sunos5|solaris2|'`
+		;;
+	sunos6*)
+		os=`echo "$os" | sed -e 's|sunos6|solaris3|'`
+		;;
+	wince*)
+		os=wince
+		;;
+	utek*)
+		os=bsd
+		;;
+	dynix*)
+		os=bsd
+		;;
+	acis*)
+		os=aos
+		;;
+	atheos*)
+		os=atheos
+		;;
+	syllable*)
+		os=syllable
+		;;
+	386bsd)
+		os=bsd
+		;;
+	ctix* | uts*)
+		os=sysv
+		;;
+	nova*)
+		os=rtmk-nova
+		;;
+	ns2)
+		os=nextstep2
+		;;
+	# Preserve the version number of sinix5.
+	sinix5.*)
+		os=`echo "$os" | sed -e 's|sinix|sysv|'`
+		;;
+	sinix*)
+		os=sysv4
+		;;
+	tpf*)
+		os=tpf
+		;;
+	triton*)
+		os=sysv3
+		;;
+	oss*)
+		os=sysv3
+		;;
+	svr4*)
+		os=sysv4
+		;;
+	svr3)
+		os=sysv3
+		;;
+	sysvr4)
+		os=sysv4
+		;;
+	ose*)
+		os=ose
+		;;
+	*mint | mint[0-9]* | *MiNT | MiNT[0-9]*)
+		os=mint
+		;;
+	dicos*)
+		os=dicos
+		;;
+	pikeos*)
+		# Until real need of OS specific support for
+		# particular features comes up, bare metal
+		# configurations are quite functional.
+		case $cpu in
+		    arm*)
+			os=eabi
+			;;
+		    *)
+			os=elf
+			;;
+		esac
+		;;
+	*)
+		# No normalization, but not necessarily accepted, that comes below.
+		;;
+esac
+
+else
+
+# Here we handle the default operating systems that come with various machines.
+# The value should be what the vendor currently ships out the door with their
+# machine or put another way, the most popular os provided with the machine.
+
+# Note that if you're going to try to match "-MANUFACTURER" here (say,
+# "-sun"), then you have to tell the case statement up towards the top
+# that MANUFACTURER isn't an operating system.  Otherwise, code above
+# will signal an error saying that MANUFACTURER isn't an operating
+# system, and we'll never get to this point.
+
+kernel=
+case $cpu-$vendor in
+	score-*)
+		os=elf
+		;;
+	spu-*)
+		os=elf
+		;;
+	*-acorn)
+		os=riscix1.2
+		;;
+	arm*-rebel)
+		kernel=linux
+		os=gnu
+		;;
+	arm*-semi)
+		os=aout
+		;;
+	c4x-* | tic4x-*)
+		os=coff
+		;;
+	c8051-*)
+		os=elf
+		;;
+	clipper-intergraph)
+		os=clix
+		;;
+	hexagon-*)
+		os=elf
+		;;
+	tic54x-*)
+		os=coff
+		;;
+	tic55x-*)
+		os=coff
+		;;
+	tic6x-*)
+		os=coff
+		;;
+	# This must come before the *-dec entry.
+	pdp10-*)
+		os=tops20
+		;;
+	pdp11-*)
+		os=none
+		;;
+	*-dec | vax-*)
+		os=ultrix4.2
+		;;
+	m68*-apollo)
+		os=domain
+		;;
+	i386-sun)
+		os=sunos4.0.2
+		;;
+	m68000-sun)
+		os=sunos3
+		;;
+	m68*-cisco)
+		os=aout
+		;;
+	mep-*)
+		os=elf
+		;;
+	mips*-cisco)
+		os=elf
+		;;
+	mips*-*)
+		os=elf
+		;;
+	or32-*)
+		os=coff
+		;;
+	*-tti)	# must be before sparc entry or we get the wrong os.
+		os=sysv3
+		;;
+	sparc-* | *-sun)
+		os=sunos4.1.1
+		;;
+	pru-*)
+		os=elf
+		;;
+	*-be)
+		os=beos
+		;;
+	*-ibm)
+		os=aix
+		;;
+	*-knuth)
+		os=mmixware
+		;;
+	*-wec)
+		os=proelf
+		;;
+	*-winbond)
+		os=proelf
+		;;
+	*-oki)
+		os=proelf
+		;;
+	*-hp)
+		os=hpux
+		;;
+	*-hitachi)
+		os=hiux
+		;;
+	i860-* | *-att | *-ncr | *-altos | *-motorola | *-convergent)
+		os=sysv
+		;;
+	*-cbm)
+		os=amigaos
+		;;
+	*-dg)
+		os=dgux
+		;;
+	*-dolphin)
+		os=sysv3
+		;;
+	m68k-ccur)
+		os=rtu
+		;;
+	m88k-omron*)
+		os=luna
+		;;
+	*-next)
+		os=nextstep
+		;;
+	*-sequent)
+		os=ptx
+		;;
+	*-crds)
+		os=unos
+		;;
+	*-ns)
+		os=genix
+		;;
+	i370-*)
+		os=mvs
+		;;
+	*-gould)
+		os=sysv
+		;;
+	*-highlevel)
+		os=bsd
+		;;
+	*-encore)
+		os=bsd
+		;;
+	*-sgi)
+		os=irix
+		;;
+	*-siemens)
+		os=sysv4
+		;;
+	*-masscomp)
+		os=rtu
+		;;
+	f30[01]-fujitsu | f700-fujitsu)
+		os=uxpv
+		;;
+	*-rom68k)
+		os=coff
+		;;
+	*-*bug)
+		os=coff
+		;;
+	*-apple)
+		os=macos
+		;;
+	*-atari*)
+		os=mint
+		;;
+	*-wrs)
+		os=vxworks
+		;;
+	*)
+		os=none
+		;;
+esac
+
+fi
+
+# Now, validate our (potentially fixed-up) OS.
+case $os in
+	# Sometimes we do "kernel-libc", so those need to count as OSes.
+	musl* | newlib* | relibc* | uclibc*)
+		;;
+	# Likewise for "kernel-abi"
+	eabi* | gnueabi*)
+		;;
+	# VxWorks passes extra cpu info in the 4th filed.
+	simlinux | simwindows | spe)
+		;;
+	# Now accept the basic system types.
+	# The portable systems comes first.
+	# Each alternative MUST end in a * to match a version number.
+	gnu* | android* | bsd* | mach* | minix* | genix* | ultrix* | irix* \
+	     | *vms* | esix* | aix* | cnk* | sunos | sunos[34]* \
+	     | hpux* | unos* | osf* | luna* | dgux* | auroraux* | solaris* \
+	     | sym* |  plan9* | psp* | sim* | xray* | os68k* | v88r* \
+	     | hiux* | abug | nacl* | netware* | windows* \
+	     | os9* | macos* | osx* | ios* \
+	     | mpw* | magic* | mmixware* | mon960* | lnews* \
+	     | amigaos* | amigados* | msdos* | newsos* | unicos* | aof* \
+	     | aos* | aros* | cloudabi* | sortix* | twizzler* \
+	     | nindy* | vxsim* | vxworks* | ebmon* | hms* | mvs* \
+	     | clix* | riscos* | uniplus* | iris* | isc* | rtu* | xenix* \
+	     | mirbsd* | netbsd* | dicos* | openedition* | ose* \
+	     | bitrig* | openbsd* | secbsd* | solidbsd* | libertybsd* | os108* \
+	     | ekkobsd* | freebsd* | riscix* | lynxos* | os400* \
+	     | bosx* | nextstep* | cxux* | aout* | elf* | oabi* \
+	     | ptx* | coff* | ecoff* | winnt* | domain* | vsta* \
+	     | udi* | lites* | ieee* | go32* | aux* | hcos* \
+	     | chorusrdb* | cegcc* | glidix* | serenity* \
+	     | cygwin* | msys* | pe* | moss* | proelf* | rtems* \
+	     | midipix* | mingw32* | mingw64* | mint* \
+	     | uxpv* | beos* | mpeix* | udk* | moxiebox* \
+	     | interix* | uwin* | mks* | rhapsody* | darwin* \
+	     | openstep* | oskit* | conix* | pw32* | nonstopux* \
+	     | storm-chaos* | tops10* | tenex* | tops20* | its* \
+	     | os2* | vos* | palmos* | uclinux* | nucleus* | morphos* \
+	     | scout* | superux* | sysv* | rtmk* | tpf* | windiss* \
+	     | powermax* | dnix* | nx6 | nx7 | sei* | dragonfly* \
+	     | skyos* | haiku* | rdos* | toppers* | drops* | es* \
+	     | onefs* | tirtos* | phoenix* | fuchsia* | redox* | bme* \
+	     | midnightbsd* | amdhsa* | unleashed* | emscripten* | wasi* \
+	     | nsk* | powerunix* | genode* | zvmoe* | qnx* | emx* | zephyr* \
+	     | fiwix* )
+		;;
+	# This one is extra strict with allowed versions
+	sco3.2v2 | sco3.2v[4-9]* | sco5v6*)
+		# Don't forget version if it is 3.2v4 or newer.
+		;;
+	none)
+		;;
+	*)
+		echo Invalid configuration \`"$1"\': OS \`"$os"\' not recognized 1>&2
+		exit 1
+		;;
+esac
+
+# As a final step for OS-related things, validate the OS-kernel combination
+# (given a valid OS), if there is a kernel.
+case $kernel-$os in
+	linux-gnu* | linux-dietlibc* | linux-android* | linux-newlib* \
+		   | linux-musl* | linux-relibc* | linux-uclibc* )
+		;;
+	uclinux-uclibc* )
+		;;
+	-dietlibc* | -newlib* | -musl* | -relibc* | -uclibc* )
+		# These are just libc implementations, not actual OSes, and thus
+		# require a kernel.
+		echo "Invalid configuration \`$1': libc \`$os' needs explicit kernel." 1>&2
+		exit 1
+		;;
+	kfreebsd*-gnu* | kopensolaris*-gnu*)
+		;;
+	vxworks-simlinux | vxworks-simwindows | vxworks-spe)
+		;;
+	nto-qnx*)
+		;;
+	os2-emx)
+		;;
+	*-eabi* | *-gnueabi*)
+		;;
+	-*)
+		# Blank kernel with real OS is always fine.
+		;;
+	*-*)
+		echo "Invalid configuration \`$1': Kernel \`$kernel' not known to work with OS \`$os'." 1>&2
+		exit 1
+		;;
+esac
+
+# Here we handle the case where we know the os, and the CPU type, but not the
+# manufacturer.  We pick the logical manufacturer.
+case $vendor in
+	unknown)
+		case $cpu-$os in
+			*-riscix*)
+				vendor=acorn
+				;;
+			*-sunos*)
+				vendor=sun
+				;;
+			*-cnk* | *-aix*)
+				vendor=ibm
+				;;
+			*-beos*)
+				vendor=be
+				;;
+			*-hpux*)
+				vendor=hp
+				;;
+			*-mpeix*)
+				vendor=hp
+				;;
+			*-hiux*)
+				vendor=hitachi
+				;;
+			*-unos*)
+				vendor=crds
+				;;
+			*-dgux*)
+				vendor=dg
+				;;
+			*-luna*)
+				vendor=omron
+				;;
+			*-genix*)
+				vendor=ns
+				;;
+			*-clix*)
+				vendor=intergraph
+				;;
+			*-mvs* | *-opened*)
+				vendor=ibm
+				;;
+			*-os400*)
+				vendor=ibm
+				;;
+			s390-* | s390x-*)
+				vendor=ibm
+				;;
+			*-ptx*)
+				vendor=sequent
+				;;
+			*-tpf*)
+				vendor=ibm
+				;;
+			*-vxsim* | *-vxworks* | *-windiss*)
+				vendor=wrs
+				;;
+			*-aux*)
+				vendor=apple
+				;;
+			*-hms*)
+				vendor=hitachi
+				;;
+			*-mpw* | *-macos*)
+				vendor=apple
+				;;
+			*-*mint | *-mint[0-9]* | *-*MiNT | *-MiNT[0-9]*)
+				vendor=atari
+				;;
+			*-vos*)
+				vendor=stratus
+				;;
+		esac
+		;;
+esac
+
+echo "$cpu-$vendor-${kernel:+$kernel-}$os"
+exit
+
+# Local variables:
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "timestamp='"
+# time-stamp-format: "%:y-%02m-%02d"
+# time-stamp-end: "'"
+# End:
diff --git a/configure b/configure
new file mode 100755
index 0000000..94ec909
--- /dev/null
+++ b/configure
@@ -0,0 +1,8932 @@
+#! /bin/sh
+# Guess values for system-dependent variables and create Makefiles.
+# Generated by GNU Autoconf 2.71 for NTHASH 2.1.0.
+#
+# Report bugs to <hmohamadi@bcgsc.ca>.
+#
+#
+# Copyright (C) 1992-1996, 1998-2017, 2020-2021 Free Software Foundation,
+# Inc.
+#
+#
+# This configure script is free software; the Free Software Foundation
+# gives unlimited permission to copy, distribute and modify it.
+## -------------------- ##
+## M4sh Initialization. ##
+## -------------------- ##
+
+# Be more Bourne compatible
+DUALCASE=1; export DUALCASE # for MKS sh
+as_nop=:
+if test ${ZSH_VERSION+y} && (emulate sh) >/dev/null 2>&1
+then :
+  emulate sh
+  NULLCMD=:
+  # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
+  # is contrary to our usage.  Disable this feature.
+  alias -g '${1+"$@"}'='"$@"'
+  setopt NO_GLOB_SUBST
+else $as_nop
+  case `(set -o) 2>/dev/null` in #(
+  *posix*) :
+    set -o posix ;; #(
+  *) :
+     ;;
+esac
+fi
+
+
+
+# Reset variables that may have inherited troublesome values from
+# the environment.
+
+# IFS needs to be set, to space, tab, and newline, in precisely that order.
+# (If _AS_PATH_WALK were called with IFS unset, it would have the
+# side effect of setting IFS to empty, thus disabling word splitting.)
+# Quoting is to prevent editors from complaining about space-tab.
+as_nl='
+'
+export as_nl
+IFS=" ""	$as_nl"
+
+PS1='$ '
+PS2='> '
+PS4='+ '
+
+# Ensure predictable behavior from utilities with locale-dependent output.
+LC_ALL=C
+export LC_ALL
+LANGUAGE=C
+export LANGUAGE
+
+# We cannot yet rely on "unset" to work, but we need these variables
+# to be unset--not just set to an empty or harmless value--now, to
+# avoid bugs in old shells (e.g. pre-3.0 UWIN ksh).  This construct
+# also avoids known problems related to "unset" and subshell syntax
+# in other old shells (e.g. bash 2.01 and pdksh 5.2.14).
+for as_var in BASH_ENV ENV MAIL MAILPATH CDPATH
+do eval test \${$as_var+y} \
+  && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
+done
+
+# Ensure that fds 0, 1, and 2 are open.
+if (exec 3>&0) 2>/dev/null; then :; else exec 0</dev/null; fi
+if (exec 3>&1) 2>/dev/null; then :; else exec 1>/dev/null; fi
+if (exec 3>&2)            ; then :; else exec 2>/dev/null; fi
+
+# The user is always right.
+if ${PATH_SEPARATOR+false} :; then
+  PATH_SEPARATOR=:
+  (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
+    (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
+      PATH_SEPARATOR=';'
+  }
+fi
+
+
+# Find who we are.  Look in the path if we contain no directory separator.
+as_myself=
+case $0 in #((
+  *[\\/]* ) as_myself=$0 ;;
+  *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    test -r "$as_dir$0" && as_myself=$as_dir$0 && break
+  done
+IFS=$as_save_IFS
+
+     ;;
+esac
+# We did not find ourselves, most probably we were run as `sh COMMAND'
+# in which case we are not to be found in the path.
+if test "x$as_myself" = x; then
+  as_myself=$0
+fi
+if test ! -f "$as_myself"; then
+  printf "%s\n" "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
+  exit 1
+fi
+
+
+# Use a proper internal environment variable to ensure we don't fall
+  # into an infinite loop, continuously re-executing ourselves.
+  if test x"${_as_can_reexec}" != xno && test "x$CONFIG_SHELL" != x; then
+    _as_can_reexec=no; export _as_can_reexec;
+    # We cannot yet assume a decent shell, so we have to provide a
+# neutralization value for shells without unset; and this also
+# works around shells that cannot unset nonexistent variables.
+# Preserve -v and -x to the replacement shell.
+BASH_ENV=/dev/null
+ENV=/dev/null
+(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
+case $- in # ((((
+  *v*x* | *x*v* ) as_opts=-vx ;;
+  *v* ) as_opts=-v ;;
+  *x* ) as_opts=-x ;;
+  * ) as_opts= ;;
+esac
+exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
+# Admittedly, this is quite paranoid, since all the known shells bail
+# out after a failed `exec'.
+printf "%s\n" "$0: could not re-execute with $CONFIG_SHELL" >&2
+exit 255
+  fi
+  # We don't want this to propagate to other subprocesses.
+          { _as_can_reexec=; unset _as_can_reexec;}
+if test "x$CONFIG_SHELL" = x; then
+  as_bourne_compatible="as_nop=:
+if test \${ZSH_VERSION+y} && (emulate sh) >/dev/null 2>&1
+then :
+  emulate sh
+  NULLCMD=:
+  # Pre-4.2 versions of Zsh do word splitting on \${1+\"\$@\"}, which
+  # is contrary to our usage.  Disable this feature.
+  alias -g '\${1+\"\$@\"}'='\"\$@\"'
+  setopt NO_GLOB_SUBST
+else \$as_nop
+  case \`(set -o) 2>/dev/null\` in #(
+  *posix*) :
+    set -o posix ;; #(
+  *) :
+     ;;
+esac
+fi
+"
+  as_required="as_fn_return () { (exit \$1); }
+as_fn_success () { as_fn_return 0; }
+as_fn_failure () { as_fn_return 1; }
+as_fn_ret_success () { return 0; }
+as_fn_ret_failure () { return 1; }
+
+exitcode=0
+as_fn_success || { exitcode=1; echo as_fn_success failed.; }
+as_fn_failure && { exitcode=1; echo as_fn_failure succeeded.; }
+as_fn_ret_success || { exitcode=1; echo as_fn_ret_success failed.; }
+as_fn_ret_failure && { exitcode=1; echo as_fn_ret_failure succeeded.; }
+if ( set x; as_fn_ret_success y && test x = \"\$1\" )
+then :
+
+else \$as_nop
+  exitcode=1; echo positional parameters were not saved.
+fi
+test x\$exitcode = x0 || exit 1
+blah=\$(echo \$(echo blah))
+test x\"\$blah\" = xblah || exit 1
+test -x / || exit 1"
+  as_suggested="  as_lineno_1=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_1a=\$LINENO
+  as_lineno_2=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_2a=\$LINENO
+  eval 'test \"x\$as_lineno_1'\$as_run'\" != \"x\$as_lineno_2'\$as_run'\" &&
+  test \"x\`expr \$as_lineno_1'\$as_run' + 1\`\" = \"x\$as_lineno_2'\$as_run'\"' || exit 1
+test \$(( 1 + 1 )) = 2 || exit 1"
+  if (eval "$as_required") 2>/dev/null
+then :
+  as_have_required=yes
+else $as_nop
+  as_have_required=no
+fi
+  if test x$as_have_required = xyes && (eval "$as_suggested") 2>/dev/null
+then :
+
+else $as_nop
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+as_found=false
+for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+  as_found=:
+  case $as_dir in #(
+	 /*)
+	   for as_base in sh bash ksh sh5; do
+	     # Try only shells that exist, to save several forks.
+	     as_shell=$as_dir$as_base
+	     if { test -f "$as_shell" || test -f "$as_shell.exe"; } &&
+		    as_run=a "$as_shell" -c "$as_bourne_compatible""$as_required" 2>/dev/null
+then :
+  CONFIG_SHELL=$as_shell as_have_required=yes
+		   if as_run=a "$as_shell" -c "$as_bourne_compatible""$as_suggested" 2>/dev/null
+then :
+  break 2
+fi
+fi
+	   done;;
+       esac
+  as_found=false
+done
+IFS=$as_save_IFS
+if $as_found
+then :
+
+else $as_nop
+  if { test -f "$SHELL" || test -f "$SHELL.exe"; } &&
+	      as_run=a "$SHELL" -c "$as_bourne_compatible""$as_required" 2>/dev/null
+then :
+  CONFIG_SHELL=$SHELL as_have_required=yes
+fi
+fi
+
+
+      if test "x$CONFIG_SHELL" != x
+then :
+  export CONFIG_SHELL
+             # We cannot yet assume a decent shell, so we have to provide a
+# neutralization value for shells without unset; and this also
+# works around shells that cannot unset nonexistent variables.
+# Preserve -v and -x to the replacement shell.
+BASH_ENV=/dev/null
+ENV=/dev/null
+(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
+case $- in # ((((
+  *v*x* | *x*v* ) as_opts=-vx ;;
+  *v* ) as_opts=-v ;;
+  *x* ) as_opts=-x ;;
+  * ) as_opts= ;;
+esac
+exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
+# Admittedly, this is quite paranoid, since all the known shells bail
+# out after a failed `exec'.
+printf "%s\n" "$0: could not re-execute with $CONFIG_SHELL" >&2
+exit 255
+fi
+
+    if test x$as_have_required = xno
+then :
+  printf "%s\n" "$0: This script requires a shell more modern than all"
+  printf "%s\n" "$0: the shells that I found on your system."
+  if test ${ZSH_VERSION+y} ; then
+    printf "%s\n" "$0: In particular, zsh $ZSH_VERSION has bugs and should"
+    printf "%s\n" "$0: be upgraded to zsh 4.3.4 or later."
+  else
+    printf "%s\n" "$0: Please tell bug-autoconf@gnu.org and hmohamadi@bcgsc.ca
+$0: about your system, including any error possibly output
+$0: before this message. Then install a modern shell, or
+$0: manually run the script under such a shell if you do
+$0: have one."
+  fi
+  exit 1
+fi
+fi
+fi
+SHELL=${CONFIG_SHELL-/bin/sh}
+export SHELL
+# Unset more variables known to interfere with behavior of common tools.
+CLICOLOR_FORCE= GREP_OPTIONS=
+unset CLICOLOR_FORCE GREP_OPTIONS
+
+## --------------------- ##
+## M4sh Shell Functions. ##
+## --------------------- ##
+# as_fn_unset VAR
+# ---------------
+# Portably unset VAR.
+as_fn_unset ()
+{
+  { eval $1=; unset $1;}
+}
+as_unset=as_fn_unset
+
+
+# as_fn_set_status STATUS
+# -----------------------
+# Set $? to STATUS, without forking.
+as_fn_set_status ()
+{
+  return $1
+} # as_fn_set_status
+
+# as_fn_exit STATUS
+# -----------------
+# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
+as_fn_exit ()
+{
+  set +e
+  as_fn_set_status $1
+  exit $1
+} # as_fn_exit
+# as_fn_nop
+# ---------
+# Do nothing but, unlike ":", preserve the value of $?.
+as_fn_nop ()
+{
+  return $?
+}
+as_nop=as_fn_nop
+
+# as_fn_mkdir_p
+# -------------
+# Create "$as_dir" as a directory, including parents if necessary.
+as_fn_mkdir_p ()
+{
+
+  case $as_dir in #(
+  -*) as_dir=./$as_dir;;
+  esac
+  test -d "$as_dir" || eval $as_mkdir_p || {
+    as_dirs=
+    while :; do
+      case $as_dir in #(
+      *\'*) as_qdir=`printf "%s\n" "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
+      *) as_qdir=$as_dir;;
+      esac
+      as_dirs="'$as_qdir' $as_dirs"
+      as_dir=`$as_dirname -- "$as_dir" ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$as_dir" : 'X\(//\)[^/]' \| \
+	 X"$as_dir" : 'X\(//\)$' \| \
+	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+      test -d "$as_dir" && break
+    done
+    test -z "$as_dirs" || eval "mkdir $as_dirs"
+  } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
+
+
+} # as_fn_mkdir_p
+
+# as_fn_executable_p FILE
+# -----------------------
+# Test if FILE is an executable regular file.
+as_fn_executable_p ()
+{
+  test -f "$1" && test -x "$1"
+} # as_fn_executable_p
+# as_fn_append VAR VALUE
+# ----------------------
+# Append the text in VALUE to the end of the definition contained in VAR. Take
+# advantage of any shell optimizations that allow amortized linear growth over
+# repeated appends, instead of the typical quadratic growth present in naive
+# implementations.
+if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null
+then :
+  eval 'as_fn_append ()
+  {
+    eval $1+=\$2
+  }'
+else $as_nop
+  as_fn_append ()
+  {
+    eval $1=\$$1\$2
+  }
+fi # as_fn_append
+
+# as_fn_arith ARG...
+# ------------------
+# Perform arithmetic evaluation on the ARGs, and store the result in the
+# global $as_val. Take advantage of shells that can avoid forks. The arguments
+# must be portable across $(()) and expr.
+if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null
+then :
+  eval 'as_fn_arith ()
+  {
+    as_val=$(( $* ))
+  }'
+else $as_nop
+  as_fn_arith ()
+  {
+    as_val=`expr "$@" || test $? -eq 1`
+  }
+fi # as_fn_arith
+
+# as_fn_nop
+# ---------
+# Do nothing but, unlike ":", preserve the value of $?.
+as_fn_nop ()
+{
+  return $?
+}
+as_nop=as_fn_nop
+
+# as_fn_error STATUS ERROR [LINENO LOG_FD]
+# ----------------------------------------
+# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
+# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
+# script with STATUS, using 1 if that was 0.
+as_fn_error ()
+{
+  as_status=$1; test $as_status -eq 0 && as_status=1
+  if test "$4"; then
+    as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
+  fi
+  printf "%s\n" "$as_me: error: $2" >&2
+  as_fn_exit $as_status
+} # as_fn_error
+
+if expr a : '\(a\)' >/dev/null 2>&1 &&
+   test "X`expr 00001 : '.*\(...\)'`" = X001; then
+  as_expr=expr
+else
+  as_expr=false
+fi
+
+if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
+  as_basename=basename
+else
+  as_basename=false
+fi
+
+if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
+  as_dirname=dirname
+else
+  as_dirname=false
+fi
+
+as_me=`$as_basename -- "$0" ||
+$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
+	 X"$0" : 'X\(//\)$' \| \
+	 X"$0" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X/"$0" |
+    sed '/^.*\/\([^/][^/]*\)\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\/\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\/\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
+
+
+  as_lineno_1=$LINENO as_lineno_1a=$LINENO
+  as_lineno_2=$LINENO as_lineno_2a=$LINENO
+  eval 'test "x$as_lineno_1'$as_run'" != "x$as_lineno_2'$as_run'" &&
+  test "x`expr $as_lineno_1'$as_run' + 1`" = "x$as_lineno_2'$as_run'"' || {
+  # Blame Lee E. McMahon (1931-1989) for sed's syntax.  :-)
+  sed -n '
+    p
+    /[$]LINENO/=
+  ' <$as_myself |
+    sed '
+      s/[$]LINENO.*/&-/
+      t lineno
+      b
+      :lineno
+      N
+      :loop
+      s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
+      t loop
+      s/-\n.*//
+    ' >$as_me.lineno &&
+  chmod +x "$as_me.lineno" ||
+    { printf "%s\n" "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2; as_fn_exit 1; }
+
+  # If we had to re-execute with $CONFIG_SHELL, we're ensured to have
+  # already done that, so ensure we don't try to do so again and fall
+  # in an infinite loop.  This has already happened in practice.
+  _as_can_reexec=no; export _as_can_reexec
+  # Don't try to exec as it changes $[0], causing all sort of problems
+  # (the dirname of $[0] is not the place where we might find the
+  # original and so on.  Autoconf is especially sensitive to this).
+  . "./$as_me.lineno"
+  # Exit status is that of the last command.
+  exit
+}
+
+
+# Determine whether it's possible to make 'echo' print without a newline.
+# These variables are no longer used directly by Autoconf, but are AC_SUBSTed
+# for compatibility with existing Makefiles.
+ECHO_C= ECHO_N= ECHO_T=
+case `echo -n x` in #(((((
+-n*)
+  case `echo 'xy\c'` in
+  *c*) ECHO_T='	';;	# ECHO_T is single tab character.
+  xy)  ECHO_C='\c';;
+  *)   echo `echo ksh88 bug on AIX 6.1` > /dev/null
+       ECHO_T='	';;
+  esac;;
+*)
+  ECHO_N='-n';;
+esac
+
+# For backward compatibility with old third-party macros, we provide
+# the shell variables $as_echo and $as_echo_n.  New code should use
+# AS_ECHO(["message"]) and AS_ECHO_N(["message"]), respectively.
+as_echo='printf %s\n'
+as_echo_n='printf %s'
+
+
+rm -f conf$$ conf$$.exe conf$$.file
+if test -d conf$$.dir; then
+  rm -f conf$$.dir/conf$$.file
+else
+  rm -f conf$$.dir
+  mkdir conf$$.dir 2>/dev/null
+fi
+if (echo >conf$$.file) 2>/dev/null; then
+  if ln -s conf$$.file conf$$ 2>/dev/null; then
+    as_ln_s='ln -s'
+    # ... but there are two gotchas:
+    # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
+    # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
+    # In both cases, we have to default to `cp -pR'.
+    ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
+      as_ln_s='cp -pR'
+  elif ln conf$$.file conf$$ 2>/dev/null; then
+    as_ln_s=ln
+  else
+    as_ln_s='cp -pR'
+  fi
+else
+  as_ln_s='cp -pR'
+fi
+rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
+rmdir conf$$.dir 2>/dev/null
+
+if mkdir -p . 2>/dev/null; then
+  as_mkdir_p='mkdir -p "$as_dir"'
+else
+  test -d ./-p && rmdir ./-p
+  as_mkdir_p=false
+fi
+
+as_test_x='test -x'
+as_executable_p=as_fn_executable_p
+
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
+
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
+
+
+test -n "$DJDIR" || exec 7<&0 </dev/null
+exec 6>&1
+
+# Name of the host.
+# hostname on some systems (SVR3.2, old GNU/Linux) returns a bogus exit status,
+# so uname gets run too.
+ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
+
+#
+# Initializations.
+#
+ac_default_prefix=/usr/local
+ac_clean_files=
+ac_config_libobj_dir=.
+LIBOBJS=
+cross_compiling=no
+subdirs=
+MFLAGS=
+MAKEFLAGS=
+
+# Identity of this package.
+PACKAGE_NAME='NTHASH'
+PACKAGE_TARNAME='ntHash'
+PACKAGE_VERSION='2.1.0'
+PACKAGE_STRING='NTHASH 2.1.0'
+PACKAGE_BUGREPORT='hmohamadi@bcgsc.ca'
+PACKAGE_URL='https://github.com/bcgsc/ntHash'
+
+ac_unique_file="nttest.cpp"
+# Factoring default headers for most tests.
+ac_includes_default="\
+#include <stddef.h>
+#ifdef HAVE_STDIO_H
+# include <stdio.h>
+#endif
+#ifdef HAVE_STDLIB_H
+# include <stdlib.h>
+#endif
+#ifdef HAVE_STRING_H
+# include <string.h>
+#endif
+#ifdef HAVE_INTTYPES_H
+# include <inttypes.h>
+#endif
+#ifdef HAVE_STDINT_H
+# include <stdint.h>
+#endif
+#ifdef HAVE_STRINGS_H
+# include <strings.h>
+#endif
+#ifdef HAVE_SYS_TYPES_H
+# include <sys/types.h>
+#endif
+#ifdef HAVE_SYS_STAT_H
+# include <sys/stat.h>
+#endif
+#ifdef HAVE_UNISTD_H
+# include <unistd.h>
+#endif"
+
+ac_header_c_list=
+ac_func_c_list=
+ac_subst_vars='am__EXEEXT_FALSE
+am__EXEEXT_TRUE
+LTLIBOBJS
+AM_CXXFLAGS
+OPENMP_CXXFLAGS
+HAVE_LIBZ_FALSE
+HAVE_LIBZ_TRUE
+LIBOBJS
+host_os
+host_vendor
+host_cpu
+host
+build_os
+build_vendor
+build_cpu
+build
+EGREP
+GREP
+RANLIB
+am__fastdepCXX_FALSE
+am__fastdepCXX_TRUE
+CXXDEPMODE
+ac_ct_CXX
+CXXFLAGS
+CXX
+CPP
+am__fastdepCC_FALSE
+am__fastdepCC_TRUE
+CCDEPMODE
+am__nodep
+AMDEPBACKSLASH
+AMDEP_FALSE
+AMDEP_TRUE
+am__include
+DEPDIR
+OBJEXT
+EXEEXT
+ac_ct_CC
+CPPFLAGS
+LDFLAGS
+CFLAGS
+CC
+AM_BACKSLASH
+AM_DEFAULT_VERBOSITY
+AM_DEFAULT_V
+AM_V
+CSCOPE
+ETAGS
+CTAGS
+am__untar
+am__tar
+AMTAR
+am__leading_dot
+SET_MAKE
+AWK
+mkdir_p
+MKDIR_P
+INSTALL_STRIP_PROGRAM
+STRIP
+install_sh
+MAKEINFO
+AUTOHEADER
+AUTOMAKE
+AUTOCONF
+ACLOCAL
+VERSION
+PACKAGE
+CYGPATH_W
+am__isrc
+INSTALL_DATA
+INSTALL_SCRIPT
+INSTALL_PROGRAM
+target_alias
+host_alias
+build_alias
+LIBS
+ECHO_T
+ECHO_N
+ECHO_C
+DEFS
+mandir
+localedir
+libdir
+psdir
+pdfdir
+dvidir
+htmldir
+infodir
+docdir
+oldincludedir
+includedir
+runstatedir
+localstatedir
+sharedstatedir
+sysconfdir
+datadir
+datarootdir
+libexecdir
+sbindir
+bindir
+program_transform_name
+prefix
+exec_prefix
+PACKAGE_URL
+PACKAGE_BUGREPORT
+PACKAGE_STRING
+PACKAGE_VERSION
+PACKAGE_TARNAME
+PACKAGE_NAME
+PATH_SEPARATOR
+SHELL
+am__quote'
+ac_subst_files=''
+ac_user_opts='
+enable_option_checking
+enable_silent_rules
+enable_dependency_tracking
+enable_openmp
+'
+      ac_precious_vars='build_alias
+host_alias
+target_alias
+CC
+CFLAGS
+LDFLAGS
+LIBS
+CPPFLAGS
+CPP
+CXX
+CXXFLAGS
+CCC'
+
+
+# Initialize some variables set by options.
+ac_init_help=
+ac_init_version=false
+ac_unrecognized_opts=
+ac_unrecognized_sep=
+# The variables have the same names as the options, with
+# dashes changed to underlines.
+cache_file=/dev/null
+exec_prefix=NONE
+no_create=
+no_recursion=
+prefix=NONE
+program_prefix=NONE
+program_suffix=NONE
+program_transform_name=s,x,x,
+silent=
+site=
+srcdir=
+verbose=
+x_includes=NONE
+x_libraries=NONE
+
+# Installation directory options.
+# These are left unexpanded so users can "make install exec_prefix=/foo"
+# and all the variables that are supposed to be based on exec_prefix
+# by default will actually change.
+# Use braces instead of parens because sh, perl, etc. also accept them.
+# (The list follows the same order as the GNU Coding Standards.)
+bindir='${exec_prefix}/bin'
+sbindir='${exec_prefix}/sbin'
+libexecdir='${exec_prefix}/libexec'
+datarootdir='${prefix}/share'
+datadir='${datarootdir}'
+sysconfdir='${prefix}/etc'
+sharedstatedir='${prefix}/com'
+localstatedir='${prefix}/var'
+runstatedir='${localstatedir}/run'
+includedir='${prefix}/include'
+oldincludedir='/usr/include'
+docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
+infodir='${datarootdir}/info'
+htmldir='${docdir}'
+dvidir='${docdir}'
+pdfdir='${docdir}'
+psdir='${docdir}'
+libdir='${exec_prefix}/lib'
+localedir='${datarootdir}/locale'
+mandir='${datarootdir}/man'
+
+ac_prev=
+ac_dashdash=
+for ac_option
+do
+  # If the previous option needs an argument, assign it.
+  if test -n "$ac_prev"; then
+    eval $ac_prev=\$ac_option
+    ac_prev=
+    continue
+  fi
+
+  case $ac_option in
+  *=?*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;;
+  *=)   ac_optarg= ;;
+  *)    ac_optarg=yes ;;
+  esac
+
+  case $ac_dashdash$ac_option in
+  --)
+    ac_dashdash=yes ;;
+
+  -bindir | --bindir | --bindi | --bind | --bin | --bi)
+    ac_prev=bindir ;;
+  -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
+    bindir=$ac_optarg ;;
+
+  -build | --build | --buil | --bui | --bu)
+    ac_prev=build_alias ;;
+  -build=* | --build=* | --buil=* | --bui=* | --bu=*)
+    build_alias=$ac_optarg ;;
+
+  -cache-file | --cache-file | --cache-fil | --cache-fi \
+  | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
+    ac_prev=cache_file ;;
+  -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
+  | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
+    cache_file=$ac_optarg ;;
+
+  --config-cache | -C)
+    cache_file=config.cache ;;
+
+  -datadir | --datadir | --datadi | --datad)
+    ac_prev=datadir ;;
+  -datadir=* | --datadir=* | --datadi=* | --datad=*)
+    datadir=$ac_optarg ;;
+
+  -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \
+  | --dataroo | --dataro | --datar)
+    ac_prev=datarootdir ;;
+  -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \
+  | --dataroot=* | --dataroo=* | --dataro=* | --datar=*)
+    datarootdir=$ac_optarg ;;
+
+  -disable-* | --disable-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid feature name: \`$ac_useropt'"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`printf "%s\n" "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"enable_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval enable_$ac_useropt=no ;;
+
+  -docdir | --docdir | --docdi | --doc | --do)
+    ac_prev=docdir ;;
+  -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*)
+    docdir=$ac_optarg ;;
+
+  -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv)
+    ac_prev=dvidir ;;
+  -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*)
+    dvidir=$ac_optarg ;;
+
+  -enable-* | --enable-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid feature name: \`$ac_useropt'"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`printf "%s\n" "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"enable_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval enable_$ac_useropt=\$ac_optarg ;;
+
+  -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
+  | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
+  | --exec | --exe | --ex)
+    ac_prev=exec_prefix ;;
+  -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
+  | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
+  | --exec=* | --exe=* | --ex=*)
+    exec_prefix=$ac_optarg ;;
+
+  -gas | --gas | --ga | --g)
+    # Obsolete; use --with-gas.
+    with_gas=yes ;;
+
+  -help | --help | --hel | --he | -h)
+    ac_init_help=long ;;
+  -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
+    ac_init_help=recursive ;;
+  -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
+    ac_init_help=short ;;
+
+  -host | --host | --hos | --ho)
+    ac_prev=host_alias ;;
+  -host=* | --host=* | --hos=* | --ho=*)
+    host_alias=$ac_optarg ;;
+
+  -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht)
+    ac_prev=htmldir ;;
+  -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \
+  | --ht=*)
+    htmldir=$ac_optarg ;;
+
+  -includedir | --includedir | --includedi | --included | --include \
+  | --includ | --inclu | --incl | --inc)
+    ac_prev=includedir ;;
+  -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
+  | --includ=* | --inclu=* | --incl=* | --inc=*)
+    includedir=$ac_optarg ;;
+
+  -infodir | --infodir | --infodi | --infod | --info | --inf)
+    ac_prev=infodir ;;
+  -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
+    infodir=$ac_optarg ;;
+
+  -libdir | --libdir | --libdi | --libd)
+    ac_prev=libdir ;;
+  -libdir=* | --libdir=* | --libdi=* | --libd=*)
+    libdir=$ac_optarg ;;
+
+  -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
+  | --libexe | --libex | --libe)
+    ac_prev=libexecdir ;;
+  -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
+  | --libexe=* | --libex=* | --libe=*)
+    libexecdir=$ac_optarg ;;
+
+  -localedir | --localedir | --localedi | --localed | --locale)
+    ac_prev=localedir ;;
+  -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*)
+    localedir=$ac_optarg ;;
+
+  -localstatedir | --localstatedir | --localstatedi | --localstated \
+  | --localstate | --localstat | --localsta | --localst | --locals)
+    ac_prev=localstatedir ;;
+  -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
+  | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*)
+    localstatedir=$ac_optarg ;;
+
+  -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
+    ac_prev=mandir ;;
+  -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
+    mandir=$ac_optarg ;;
+
+  -nfp | --nfp | --nf)
+    # Obsolete; use --without-fp.
+    with_fp=no ;;
+
+  -no-create | --no-create | --no-creat | --no-crea | --no-cre \
+  | --no-cr | --no-c | -n)
+    no_create=yes ;;
+
+  -no-recursion | --no-recursion | --no-recursio | --no-recursi \
+  | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
+    no_recursion=yes ;;
+
+  -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
+  | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
+  | --oldin | --oldi | --old | --ol | --o)
+    ac_prev=oldincludedir ;;
+  -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
+  | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
+  | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
+    oldincludedir=$ac_optarg ;;
+
+  -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
+    ac_prev=prefix ;;
+  -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
+    prefix=$ac_optarg ;;
+
+  -program-prefix | --program-prefix | --program-prefi | --program-pref \
+  | --program-pre | --program-pr | --program-p)
+    ac_prev=program_prefix ;;
+  -program-prefix=* | --program-prefix=* | --program-prefi=* \
+  | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
+    program_prefix=$ac_optarg ;;
+
+  -program-suffix | --program-suffix | --program-suffi | --program-suff \
+  | --program-suf | --program-su | --program-s)
+    ac_prev=program_suffix ;;
+  -program-suffix=* | --program-suffix=* | --program-suffi=* \
+  | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
+    program_suffix=$ac_optarg ;;
+
+  -program-transform-name | --program-transform-name \
+  | --program-transform-nam | --program-transform-na \
+  | --program-transform-n | --program-transform- \
+  | --program-transform | --program-transfor \
+  | --program-transfo | --program-transf \
+  | --program-trans | --program-tran \
+  | --progr-tra | --program-tr | --program-t)
+    ac_prev=program_transform_name ;;
+  -program-transform-name=* | --program-transform-name=* \
+  | --program-transform-nam=* | --program-transform-na=* \
+  | --program-transform-n=* | --program-transform-=* \
+  | --program-transform=* | --program-transfor=* \
+  | --program-transfo=* | --program-transf=* \
+  | --program-trans=* | --program-tran=* \
+  | --progr-tra=* | --program-tr=* | --program-t=*)
+    program_transform_name=$ac_optarg ;;
+
+  -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd)
+    ac_prev=pdfdir ;;
+  -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*)
+    pdfdir=$ac_optarg ;;
+
+  -psdir | --psdir | --psdi | --psd | --ps)
+    ac_prev=psdir ;;
+  -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*)
+    psdir=$ac_optarg ;;
+
+  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+  | -silent | --silent | --silen | --sile | --sil)
+    silent=yes ;;
+
+  -runstatedir | --runstatedir | --runstatedi | --runstated \
+  | --runstate | --runstat | --runsta | --runst | --runs \
+  | --run | --ru | --r)
+    ac_prev=runstatedir ;;
+  -runstatedir=* | --runstatedir=* | --runstatedi=* | --runstated=* \
+  | --runstate=* | --runstat=* | --runsta=* | --runst=* | --runs=* \
+  | --run=* | --ru=* | --r=*)
+    runstatedir=$ac_optarg ;;
+
+  -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
+    ac_prev=sbindir ;;
+  -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
+  | --sbi=* | --sb=*)
+    sbindir=$ac_optarg ;;
+
+  -sharedstatedir | --sharedstatedir | --sharedstatedi \
+  | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
+  | --sharedst | --shareds | --shared | --share | --shar \
+  | --sha | --sh)
+    ac_prev=sharedstatedir ;;
+  -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
+  | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
+  | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
+  | --sha=* | --sh=*)
+    sharedstatedir=$ac_optarg ;;
+
+  -site | --site | --sit)
+    ac_prev=site ;;
+  -site=* | --site=* | --sit=*)
+    site=$ac_optarg ;;
+
+  -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
+    ac_prev=srcdir ;;
+  -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
+    srcdir=$ac_optarg ;;
+
+  -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
+  | --syscon | --sysco | --sysc | --sys | --sy)
+    ac_prev=sysconfdir ;;
+  -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
+  | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
+    sysconfdir=$ac_optarg ;;
+
+  -target | --target | --targe | --targ | --tar | --ta | --t)
+    ac_prev=target_alias ;;
+  -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
+    target_alias=$ac_optarg ;;
+
+  -v | -verbose | --verbose | --verbos | --verbo | --verb)
+    verbose=yes ;;
+
+  -version | --version | --versio | --versi | --vers | -V)
+    ac_init_version=: ;;
+
+  -with-* | --with-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid package name: \`$ac_useropt'"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`printf "%s\n" "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"with_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval with_$ac_useropt=\$ac_optarg ;;
+
+  -without-* | --without-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid package name: \`$ac_useropt'"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`printf "%s\n" "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"with_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval with_$ac_useropt=no ;;
+
+  --x)
+    # Obsolete; use --with-x.
+    with_x=yes ;;
+
+  -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
+  | --x-incl | --x-inc | --x-in | --x-i)
+    ac_prev=x_includes ;;
+  -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
+  | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
+    x_includes=$ac_optarg ;;
+
+  -x-libraries | --x-libraries | --x-librarie | --x-librari \
+  | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
+    ac_prev=x_libraries ;;
+  -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
+  | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
+    x_libraries=$ac_optarg ;;
+
+  -*) as_fn_error $? "unrecognized option: \`$ac_option'
+Try \`$0 --help' for more information"
+    ;;
+
+  *=*)
+    ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
+    # Reject names that are not valid shell variable names.
+    case $ac_envvar in #(
+      '' | [0-9]* | *[!_$as_cr_alnum]* )
+      as_fn_error $? "invalid variable name: \`$ac_envvar'" ;;
+    esac
+    eval $ac_envvar=\$ac_optarg
+    export $ac_envvar ;;
+
+  *)
+    # FIXME: should be removed in autoconf 3.0.
+    printf "%s\n" "$as_me: WARNING: you should use --build, --host, --target" >&2
+    expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
+      printf "%s\n" "$as_me: WARNING: invalid host type: $ac_option" >&2
+    : "${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}"
+    ;;
+
+  esac
+done
+
+if test -n "$ac_prev"; then
+  ac_option=--`echo $ac_prev | sed 's/_/-/g'`
+  as_fn_error $? "missing argument to $ac_option"
+fi
+
+if test -n "$ac_unrecognized_opts"; then
+  case $enable_option_checking in
+    no) ;;
+    fatal) as_fn_error $? "unrecognized options: $ac_unrecognized_opts" ;;
+    *)     printf "%s\n" "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;;
+  esac
+fi
+
+# Check all directory arguments for consistency.
+for ac_var in	exec_prefix prefix bindir sbindir libexecdir datarootdir \
+		datadir sysconfdir sharedstatedir localstatedir includedir \
+		oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
+		libdir localedir mandir runstatedir
+do
+  eval ac_val=\$$ac_var
+  # Remove trailing slashes.
+  case $ac_val in
+    */ )
+      ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'`
+      eval $ac_var=\$ac_val;;
+  esac
+  # Be sure to have absolute directory names.
+  case $ac_val in
+    [\\/$]* | ?:[\\/]* )  continue;;
+    NONE | '' ) case $ac_var in *prefix ) continue;; esac;;
+  esac
+  as_fn_error $? "expected an absolute directory name for --$ac_var: $ac_val"
+done
+
+# There might be people who depend on the old broken behavior: `$host'
+# used to hold the argument of --host etc.
+# FIXME: To remove some day.
+build=$build_alias
+host=$host_alias
+target=$target_alias
+
+# FIXME: To remove some day.
+if test "x$host_alias" != x; then
+  if test "x$build_alias" = x; then
+    cross_compiling=maybe
+  elif test "x$build_alias" != "x$host_alias"; then
+    cross_compiling=yes
+  fi
+fi
+
+ac_tool_prefix=
+test -n "$host_alias" && ac_tool_prefix=$host_alias-
+
+test "$silent" = yes && exec 6>/dev/null
+
+
+ac_pwd=`pwd` && test -n "$ac_pwd" &&
+ac_ls_di=`ls -di .` &&
+ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` ||
+  as_fn_error $? "working directory cannot be determined"
+test "X$ac_ls_di" = "X$ac_pwd_ls_di" ||
+  as_fn_error $? "pwd does not report name of working directory"
+
+
+# Find the source files, if location was not specified.
+if test -z "$srcdir"; then
+  ac_srcdir_defaulted=yes
+  # Try the directory containing this script, then the parent directory.
+  ac_confdir=`$as_dirname -- "$as_myself" ||
+$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$as_myself" : 'X\(//\)[^/]' \| \
+	 X"$as_myself" : 'X\(//\)$' \| \
+	 X"$as_myself" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X"$as_myself" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+  srcdir=$ac_confdir
+  if test ! -r "$srcdir/$ac_unique_file"; then
+    srcdir=..
+  fi
+else
+  ac_srcdir_defaulted=no
+fi
+if test ! -r "$srcdir/$ac_unique_file"; then
+  test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .."
+  as_fn_error $? "cannot find sources ($ac_unique_file) in $srcdir"
+fi
+ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work"
+ac_abs_confdir=`(
+	cd "$srcdir" && test -r "./$ac_unique_file" || as_fn_error $? "$ac_msg"
+	pwd)`
+# When building in place, set srcdir=.
+if test "$ac_abs_confdir" = "$ac_pwd"; then
+  srcdir=.
+fi
+# Remove unnecessary trailing slashes from srcdir.
+# Double slashes in file names in object file debugging info
+# mess up M-x gdb in Emacs.
+case $srcdir in
+*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;;
+esac
+for ac_var in $ac_precious_vars; do
+  eval ac_env_${ac_var}_set=\${${ac_var}+set}
+  eval ac_env_${ac_var}_value=\$${ac_var}
+  eval ac_cv_env_${ac_var}_set=\${${ac_var}+set}
+  eval ac_cv_env_${ac_var}_value=\$${ac_var}
+done
+
+#
+# Report the --help message.
+#
+if test "$ac_init_help" = "long"; then
+  # Omit some internal or obsolete options to make the list less imposing.
+  # This message is too long to be a string in the A/UX 3.1 sh.
+  cat <<_ACEOF
+\`configure' configures NTHASH 2.1.0 to adapt to many kinds of systems.
+
+Usage: $0 [OPTION]... [VAR=VALUE]...
+
+To assign environment variables (e.g., CC, CFLAGS...), specify them as
+VAR=VALUE.  See below for descriptions of some of the useful variables.
+
+Defaults for the options are specified in brackets.
+
+Configuration:
+  -h, --help              display this help and exit
+      --help=short        display options specific to this package
+      --help=recursive    display the short help of all the included packages
+  -V, --version           display version information and exit
+  -q, --quiet, --silent   do not print \`checking ...' messages
+      --cache-file=FILE   cache test results in FILE [disabled]
+  -C, --config-cache      alias for \`--cache-file=config.cache'
+  -n, --no-create         do not create output files
+      --srcdir=DIR        find the sources in DIR [configure dir or \`..']
+
+Installation directories:
+  --prefix=PREFIX         install architecture-independent files in PREFIX
+                          [$ac_default_prefix]
+  --exec-prefix=EPREFIX   install architecture-dependent files in EPREFIX
+                          [PREFIX]
+
+By default, \`make install' will install all the files in
+\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc.  You can specify
+an installation prefix other than \`$ac_default_prefix' using \`--prefix',
+for instance \`--prefix=\$HOME'.
+
+For better control, use the options below.
+
+Fine tuning of the installation directories:
+  --bindir=DIR            user executables [EPREFIX/bin]
+  --sbindir=DIR           system admin executables [EPREFIX/sbin]
+  --libexecdir=DIR        program executables [EPREFIX/libexec]
+  --sysconfdir=DIR        read-only single-machine data [PREFIX/etc]
+  --sharedstatedir=DIR    modifiable architecture-independent data [PREFIX/com]
+  --localstatedir=DIR     modifiable single-machine data [PREFIX/var]
+  --runstatedir=DIR       modifiable per-process data [LOCALSTATEDIR/run]
+  --libdir=DIR            object code libraries [EPREFIX/lib]
+  --includedir=DIR        C header files [PREFIX/include]
+  --oldincludedir=DIR     C header files for non-gcc [/usr/include]
+  --datarootdir=DIR       read-only arch.-independent data root [PREFIX/share]
+  --datadir=DIR           read-only architecture-independent data [DATAROOTDIR]
+  --infodir=DIR           info documentation [DATAROOTDIR/info]
+  --localedir=DIR         locale-dependent data [DATAROOTDIR/locale]
+  --mandir=DIR            man documentation [DATAROOTDIR/man]
+  --docdir=DIR            documentation root [DATAROOTDIR/doc/ntHash]
+  --htmldir=DIR           html documentation [DOCDIR]
+  --dvidir=DIR            dvi documentation [DOCDIR]
+  --pdfdir=DIR            pdf documentation [DOCDIR]
+  --psdir=DIR             ps documentation [DOCDIR]
+_ACEOF
+
+  cat <<\_ACEOF
+
+Program names:
+  --program-prefix=PREFIX            prepend PREFIX to installed program names
+  --program-suffix=SUFFIX            append SUFFIX to installed program names
+  --program-transform-name=PROGRAM   run sed PROGRAM on installed program names
+
+System types:
+  --build=BUILD     configure for building on BUILD [guessed]
+  --host=HOST       cross-compile to build programs to run on HOST [BUILD]
+_ACEOF
+fi
+
+if test -n "$ac_init_help"; then
+  case $ac_init_help in
+     short | recursive ) echo "Configuration of NTHASH 2.1.0:";;
+   esac
+  cat <<\_ACEOF
+
+Optional Features:
+  --disable-option-checking  ignore unrecognized --enable/--with options
+  --disable-FEATURE       do not include FEATURE (same as --enable-FEATURE=no)
+  --enable-FEATURE[=ARG]  include FEATURE [ARG=yes]
+  --enable-silent-rules   less verbose build output (undo: "make V=1")
+  --disable-silent-rules  verbose build output (undo: "make V=0")
+  --enable-dependency-tracking
+                          do not reject slow dependency extractors
+  --disable-dependency-tracking
+                          speeds up one-time build
+  --disable-openmp        do not use OpenMP
+
+Some influential environment variables:
+  CC          C compiler command
+  CFLAGS      C compiler flags
+  LDFLAGS     linker flags, e.g. -L<lib dir> if you have libraries in a
+              nonstandard directory <lib dir>
+  LIBS        libraries to pass to the linker, e.g. -l<library>
+  CPPFLAGS    (Objective) C/C++ preprocessor flags, e.g. -I<include dir> if
+              you have headers in a nonstandard directory <include dir>
+  CPP         C preprocessor
+  CXX         C++ compiler command
+  CXXFLAGS    C++ compiler flags
+
+Use these variables to override the choices made by `configure' or to help
+it to find libraries and programs with nonstandard names/locations.
+
+Report bugs to <hmohamadi@bcgsc.ca>.
+NTHASH home page: <https://github.com/bcgsc/ntHash>.
+_ACEOF
+ac_status=$?
+fi
+
+if test "$ac_init_help" = "recursive"; then
+  # If there are subdirs, report their specific --help.
+  for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
+    test -d "$ac_dir" ||
+      { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } ||
+      continue
+    ac_builddir=.
+
+case "$ac_dir" in
+.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
+*)
+  ac_dir_suffix=/`printf "%s\n" "$ac_dir" | sed 's|^\.[\\/]||'`
+  # A ".." for each directory in $ac_dir_suffix.
+  ac_top_builddir_sub=`printf "%s\n" "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
+  case $ac_top_builddir_sub in
+  "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
+  *)  ac_top_build_prefix=$ac_top_builddir_sub/ ;;
+  esac ;;
+esac
+ac_abs_top_builddir=$ac_pwd
+ac_abs_builddir=$ac_pwd$ac_dir_suffix
+# for backward compatibility:
+ac_top_builddir=$ac_top_build_prefix
+
+case $srcdir in
+  .)  # We are building in place.
+    ac_srcdir=.
+    ac_top_srcdir=$ac_top_builddir_sub
+    ac_abs_top_srcdir=$ac_pwd ;;
+  [\\/]* | ?:[\\/]* )  # Absolute name.
+    ac_srcdir=$srcdir$ac_dir_suffix;
+    ac_top_srcdir=$srcdir
+    ac_abs_top_srcdir=$srcdir ;;
+  *) # Relative name.
+    ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
+    ac_top_srcdir=$ac_top_build_prefix$srcdir
+    ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
+esac
+ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
+
+    cd "$ac_dir" || { ac_status=$?; continue; }
+    # Check for configure.gnu first; this name is used for a wrapper for
+    # Metaconfig's "Configure" on case-insensitive file systems.
+    if test -f "$ac_srcdir/configure.gnu"; then
+      echo &&
+      $SHELL "$ac_srcdir/configure.gnu" --help=recursive
+    elif test -f "$ac_srcdir/configure"; then
+      echo &&
+      $SHELL "$ac_srcdir/configure" --help=recursive
+    else
+      printf "%s\n" "$as_me: WARNING: no configuration information is in $ac_dir" >&2
+    fi || ac_status=$?
+    cd "$ac_pwd" || { ac_status=$?; break; }
+  done
+fi
+
+test -n "$ac_init_help" && exit $ac_status
+if $ac_init_version; then
+  cat <<\_ACEOF
+NTHASH configure 2.1.0
+generated by GNU Autoconf 2.71
+
+Copyright (C) 2021 Free Software Foundation, Inc.
+This configure script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it.
+_ACEOF
+  exit
+fi
+
+## ------------------------ ##
+## Autoconf initialization. ##
+## ------------------------ ##
+
+# ac_fn_c_try_compile LINENO
+# --------------------------
+# Try to compile conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_compile ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext conftest.beam
+  if { { ac_try="$ac_compile"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_compile") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_c_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest.$ac_objext
+then :
+  ac_retval=0
+else $as_nop
+  printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+	ac_retval=1
+fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_compile
+
+# ac_fn_c_try_cpp LINENO
+# ----------------------
+# Try to preprocess conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_cpp ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if { { ac_try="$ac_cpp conftest.$ac_ext"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } > conftest.i && {
+	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
+	 test ! -s conftest.err
+       }
+then :
+  ac_retval=0
+else $as_nop
+  printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+    ac_retval=1
+fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_cpp
+
+# ac_fn_cxx_try_compile LINENO
+# ----------------------------
+# Try to compile conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_compile ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext conftest.beam
+  if { { ac_try="$ac_compile"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_compile") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_cxx_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest.$ac_objext
+then :
+  ac_retval=0
+else $as_nop
+  printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+	ac_retval=1
+fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_cxx_try_compile
+
+# ac_fn_c_check_header_compile LINENO HEADER VAR INCLUDES
+# -------------------------------------------------------
+# Tests whether HEADER exists and can be compiled using the include files in
+# INCLUDES, setting the cache variable VAR accordingly.
+ac_fn_c_check_header_compile ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+printf %s "checking for $2... " >&6; }
+if eval test \${$3+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
+#include <$2>
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  eval "$3=yes"
+else $as_nop
+  eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+printf "%s\n" "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_header_compile
+
+# ac_fn_c_check_type LINENO TYPE VAR INCLUDES
+# -------------------------------------------
+# Tests whether TYPE exists after having included INCLUDES, setting cache
+# variable VAR accordingly.
+ac_fn_c_check_type ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+printf %s "checking for $2... " >&6; }
+if eval test \${$3+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  eval "$3=no"
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
+int
+main (void)
+{
+if (sizeof ($2))
+	 return 0;
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
+int
+main (void)
+{
+if (sizeof (($2)))
+	    return 0;
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+
+else $as_nop
+  eval "$3=yes"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+printf "%s\n" "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_type
+
+# ac_fn_c_try_link LINENO
+# -----------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_link ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext conftest.beam conftest$ac_exeext
+  if { { ac_try="$ac_link"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_c_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest$ac_exeext && {
+	 test "$cross_compiling" = yes ||
+	 test -x conftest$ac_exeext
+       }
+then :
+  ac_retval=0
+else $as_nop
+  printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+	ac_retval=1
+fi
+  # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
+  # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
+  # interfere with the next link command; also delete a directory that is
+  # left behind by Apple's compiler.  We do this before executing the actions.
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_link
+
+# ac_fn_c_check_func LINENO FUNC VAR
+# ----------------------------------
+# Tests whether FUNC exists, setting the cache variable VAR accordingly
+ac_fn_c_check_func ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+printf %s "checking for $2... " >&6; }
+if eval test \${$3+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+/* Define $2 to an innocuous variant, in case <limits.h> declares $2.
+   For example, HP-UX 11i <limits.h> declares gettimeofday.  */
+#define $2 innocuous_$2
+
+/* System header to define __stub macros and hopefully few prototypes,
+   which can conflict with char $2 (); below.  */
+
+#include <limits.h>
+#undef $2
+
+/* Override any GCC internal prototype to avoid an error.
+   Use char because int might match the return type of a GCC
+   builtin and then its argument prototype would still apply.  */
+#ifdef __cplusplus
+extern "C"
+#endif
+char $2 ();
+/* The GNU C library defines this for functions which it implements
+    to always fail with ENOSYS.  Some functions are actually named
+    something starting with __ and the normal name is an alias.  */
+#if defined __stub_$2 || defined __stub___$2
+choke me
+#endif
+
+int
+main (void)
+{
+return $2 ();
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"
+then :
+  eval "$3=yes"
+else $as_nop
+  eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam \
+    conftest$ac_exeext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+printf "%s\n" "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_func
+
+# ac_fn_c_try_run LINENO
+# ----------------------
+# Try to run conftest.$ac_ext, and return whether this succeeded. Assumes that
+# executables *can* be run.
+ac_fn_c_try_run ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if { { ac_try="$ac_link"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && { ac_try='./conftest$ac_exeext'
+  { { case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_try") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; }
+then :
+  ac_retval=0
+else $as_nop
+  printf "%s\n" "$as_me: program exited with status $ac_status" >&5
+       printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+       ac_retval=$ac_status
+fi
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_run
+
+# ac_fn_c_find_intX_t LINENO BITS VAR
+# -----------------------------------
+# Finds a signed integer type with width BITS, setting cache variable VAR
+# accordingly.
+ac_fn_c_find_intX_t ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for int$2_t" >&5
+printf %s "checking for int$2_t... " >&6; }
+if eval test \${$3+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  eval "$3=no"
+     # Order is important - never check a type that is potentially smaller
+     # than half of the expected target width.
+     for ac_type in int$2_t 'int' 'long int' \
+	 'long long int' 'short int' 'signed char'; do
+       cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+	     enum { N = $2 / 2 - 1 };
+int
+main (void)
+{
+static int test_array [1 - 2 * !(0 < ($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 1))];
+test_array [0] = 0;
+return test_array [0];
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+	        enum { N = $2 / 2 - 1 };
+int
+main (void)
+{
+static int test_array [1 - 2 * !(($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 1)
+		 < ($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 2))];
+test_array [0] = 0;
+return test_array [0];
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+
+else $as_nop
+  case $ac_type in #(
+  int$2_t) :
+    eval "$3=yes" ;; #(
+  *) :
+    eval "$3=\$ac_type" ;;
+esac
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+       if eval test \"x\$"$3"\" = x"no"
+then :
+
+else $as_nop
+  break
+fi
+     done
+fi
+eval ac_res=\$$3
+	       { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+printf "%s\n" "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_find_intX_t
+
+# ac_fn_c_find_uintX_t LINENO BITS VAR
+# ------------------------------------
+# Finds an unsigned integer type with width BITS, setting cache variable VAR
+# accordingly.
+ac_fn_c_find_uintX_t ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for uint$2_t" >&5
+printf %s "checking for uint$2_t... " >&6; }
+if eval test \${$3+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  eval "$3=no"
+     # Order is important - never check a type that is potentially smaller
+     # than half of the expected target width.
+     for ac_type in uint$2_t 'unsigned int' 'unsigned long int' \
+	 'unsigned long long int' 'unsigned short int' 'unsigned char'; do
+       cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+int
+main (void)
+{
+static int test_array [1 - 2 * !((($ac_type) -1 >> ($2 / 2 - 1)) >> ($2 / 2 - 1) == 3)];
+test_array [0] = 0;
+return test_array [0];
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  case $ac_type in #(
+  uint$2_t) :
+    eval "$3=yes" ;; #(
+  *) :
+    eval "$3=\$ac_type" ;;
+esac
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+       if eval test \"x\$"$3"\" = x"no"
+then :
+
+else $as_nop
+  break
+fi
+     done
+fi
+eval ac_res=\$$3
+	       { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+printf "%s\n" "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_find_uintX_t
+
+# ac_fn_cxx_try_link LINENO
+# -------------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_link ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext conftest.beam conftest$ac_exeext
+  if { { ac_try="$ac_link"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_cxx_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest$ac_exeext && {
+	 test "$cross_compiling" = yes ||
+	 test -x conftest$ac_exeext
+       }
+then :
+  ac_retval=0
+else $as_nop
+  printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+	ac_retval=1
+fi
+  # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
+  # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
+  # interfere with the next link command; also delete a directory that is
+  # left behind by Apple's compiler.  We do this before executing the actions.
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_cxx_try_link
+ac_configure_args_raw=
+for ac_arg
+do
+  case $ac_arg in
+  *\'*)
+    ac_arg=`printf "%s\n" "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
+  esac
+  as_fn_append ac_configure_args_raw " '$ac_arg'"
+done
+
+case $ac_configure_args_raw in
+  *$as_nl*)
+    ac_safe_unquote= ;;
+  *)
+    ac_unsafe_z='|&;<>()$`\\"*?[ ''	' # This string ends in space, tab.
+    ac_unsafe_a="$ac_unsafe_z#~"
+    ac_safe_unquote="s/ '\\([^$ac_unsafe_a][^$ac_unsafe_z]*\\)'/ \\1/g"
+    ac_configure_args_raw=`      printf "%s\n" "$ac_configure_args_raw" | sed "$ac_safe_unquote"`;;
+esac
+
+cat >config.log <<_ACEOF
+This file contains any messages produced by compilers while
+running configure, to aid debugging if configure makes a mistake.
+
+It was created by NTHASH $as_me 2.1.0, which was
+generated by GNU Autoconf 2.71.  Invocation command line was
+
+  $ $0$ac_configure_args_raw
+
+_ACEOF
+exec 5>>config.log
+{
+cat <<_ASUNAME
+## --------- ##
+## Platform. ##
+## --------- ##
+
+hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
+uname -m = `(uname -m) 2>/dev/null || echo unknown`
+uname -r = `(uname -r) 2>/dev/null || echo unknown`
+uname -s = `(uname -s) 2>/dev/null || echo unknown`
+uname -v = `(uname -v) 2>/dev/null || echo unknown`
+
+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
+/bin/uname -X     = `(/bin/uname -X) 2>/dev/null     || echo unknown`
+
+/bin/arch              = `(/bin/arch) 2>/dev/null              || echo unknown`
+/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null       || echo unknown`
+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
+/usr/bin/hostinfo      = `(/usr/bin/hostinfo) 2>/dev/null      || echo unknown`
+/bin/machine           = `(/bin/machine) 2>/dev/null           || echo unknown`
+/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null       || echo unknown`
+/bin/universe          = `(/bin/universe) 2>/dev/null          || echo unknown`
+
+_ASUNAME
+
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    printf "%s\n" "PATH: $as_dir"
+  done
+IFS=$as_save_IFS
+
+} >&5
+
+cat >&5 <<_ACEOF
+
+
+## ----------- ##
+## Core tests. ##
+## ----------- ##
+
+_ACEOF
+
+
+# Keep a trace of the command line.
+# Strip out --no-create and --no-recursion so they do not pile up.
+# Strip out --silent because we don't want to record it for future runs.
+# Also quote any args containing shell meta-characters.
+# Make two passes to allow for proper duplicate-argument suppression.
+ac_configure_args=
+ac_configure_args0=
+ac_configure_args1=
+ac_must_keep_next=false
+for ac_pass in 1 2
+do
+  for ac_arg
+  do
+    case $ac_arg in
+    -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
+    -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+    | -silent | --silent | --silen | --sile | --sil)
+      continue ;;
+    *\'*)
+      ac_arg=`printf "%s\n" "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
+    esac
+    case $ac_pass in
+    1) as_fn_append ac_configure_args0 " '$ac_arg'" ;;
+    2)
+      as_fn_append ac_configure_args1 " '$ac_arg'"
+      if test $ac_must_keep_next = true; then
+	ac_must_keep_next=false # Got value, back to normal.
+      else
+	case $ac_arg in
+	  *=* | --config-cache | -C | -disable-* | --disable-* \
+	  | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
+	  | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
+	  | -with-* | --with-* | -without-* | --without-* | --x)
+	    case "$ac_configure_args0 " in
+	      "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
+	    esac
+	    ;;
+	  -* ) ac_must_keep_next=true ;;
+	esac
+      fi
+      as_fn_append ac_configure_args " '$ac_arg'"
+      ;;
+    esac
+  done
+done
+{ ac_configure_args0=; unset ac_configure_args0;}
+{ ac_configure_args1=; unset ac_configure_args1;}
+
+# When interrupted or exit'd, cleanup temporary files, and complete
+# config.log.  We remove comments because anyway the quotes in there
+# would cause problems or look ugly.
+# WARNING: Use '\'' to represent an apostrophe within the trap.
+# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug.
+trap 'exit_status=$?
+  # Sanitize IFS.
+  IFS=" ""	$as_nl"
+  # Save into config.log some information that might help in debugging.
+  {
+    echo
+
+    printf "%s\n" "## ---------------- ##
+## Cache variables. ##
+## ---------------- ##"
+    echo
+    # The following way of writing the cache mishandles newlines in values,
+(
+  for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do
+    eval ac_val=\$$ac_var
+    case $ac_val in #(
+    *${as_nl}*)
+      case $ac_var in #(
+      *_cv_*) { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
+printf "%s\n" "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
+      esac
+      case $ac_var in #(
+      _ | IFS | as_nl) ;; #(
+      BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
+      *) { eval $ac_var=; unset $ac_var;} ;;
+      esac ;;
+    esac
+  done
+  (set) 2>&1 |
+    case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #(
+    *${as_nl}ac_space=\ *)
+      sed -n \
+	"s/'\''/'\''\\\\'\'''\''/g;
+	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p"
+      ;; #(
+    *)
+      sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
+      ;;
+    esac |
+    sort
+)
+    echo
+
+    printf "%s\n" "## ----------------- ##
+## Output variables. ##
+## ----------------- ##"
+    echo
+    for ac_var in $ac_subst_vars
+    do
+      eval ac_val=\$$ac_var
+      case $ac_val in
+      *\'\''*) ac_val=`printf "%s\n" "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
+      esac
+      printf "%s\n" "$ac_var='\''$ac_val'\''"
+    done | sort
+    echo
+
+    if test -n "$ac_subst_files"; then
+      printf "%s\n" "## ------------------- ##
+## File substitutions. ##
+## ------------------- ##"
+      echo
+      for ac_var in $ac_subst_files
+      do
+	eval ac_val=\$$ac_var
+	case $ac_val in
+	*\'\''*) ac_val=`printf "%s\n" "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
+	esac
+	printf "%s\n" "$ac_var='\''$ac_val'\''"
+      done | sort
+      echo
+    fi
+
+    if test -s confdefs.h; then
+      printf "%s\n" "## ----------- ##
+## confdefs.h. ##
+## ----------- ##"
+      echo
+      cat confdefs.h
+      echo
+    fi
+    test "$ac_signal" != 0 &&
+      printf "%s\n" "$as_me: caught signal $ac_signal"
+    printf "%s\n" "$as_me: exit $exit_status"
+  } >&5
+  rm -f core *.core core.conftest.* &&
+    rm -f -r conftest* confdefs* conf$$* $ac_clean_files &&
+    exit $exit_status
+' 0
+for ac_signal in 1 2 13 15; do
+  trap 'ac_signal='$ac_signal'; as_fn_exit 1' $ac_signal
+done
+ac_signal=0
+
+# confdefs.h avoids OS command line length limits that DEFS can exceed.
+rm -f -r conftest* confdefs.h
+
+printf "%s\n" "/* confdefs.h */" > confdefs.h
+
+# Predefined preprocessor variables.
+
+printf "%s\n" "#define PACKAGE_NAME \"$PACKAGE_NAME\"" >>confdefs.h
+
+printf "%s\n" "#define PACKAGE_TARNAME \"$PACKAGE_TARNAME\"" >>confdefs.h
+
+printf "%s\n" "#define PACKAGE_VERSION \"$PACKAGE_VERSION\"" >>confdefs.h
+
+printf "%s\n" "#define PACKAGE_STRING \"$PACKAGE_STRING\"" >>confdefs.h
+
+printf "%s\n" "#define PACKAGE_BUGREPORT \"$PACKAGE_BUGREPORT\"" >>confdefs.h
+
+printf "%s\n" "#define PACKAGE_URL \"$PACKAGE_URL\"" >>confdefs.h
+
+
+# Let the site file select an alternate cache file if it wants to.
+# Prefer an explicitly selected file to automatically selected ones.
+if test -n "$CONFIG_SITE"; then
+  ac_site_files="$CONFIG_SITE"
+elif test "x$prefix" != xNONE; then
+  ac_site_files="$prefix/share/config.site $prefix/etc/config.site"
+else
+  ac_site_files="$ac_default_prefix/share/config.site $ac_default_prefix/etc/config.site"
+fi
+
+for ac_site_file in $ac_site_files
+do
+  case $ac_site_file in #(
+  */*) :
+     ;; #(
+  *) :
+    ac_site_file=./$ac_site_file ;;
+esac
+  if test -f "$ac_site_file" && test -r "$ac_site_file"; then
+    { printf "%s\n" "$as_me:${as_lineno-$LINENO}: loading site script $ac_site_file" >&5
+printf "%s\n" "$as_me: loading site script $ac_site_file" >&6;}
+    sed 's/^/| /' "$ac_site_file" >&5
+    . "$ac_site_file" \
+      || { { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "failed to load site script $ac_site_file
+See \`config.log' for more details" "$LINENO" 5; }
+  fi
+done
+
+if test -r "$cache_file"; then
+  # Some versions of bash will fail to source /dev/null (special files
+  # actually), so we avoid doing that.  DJGPP emulates it as a regular file.
+  if test /dev/null != "$cache_file" && test -f "$cache_file"; then
+    { printf "%s\n" "$as_me:${as_lineno-$LINENO}: loading cache $cache_file" >&5
+printf "%s\n" "$as_me: loading cache $cache_file" >&6;}
+    case $cache_file in
+      [\\/]* | ?:[\\/]* ) . "$cache_file";;
+      *)                      . "./$cache_file";;
+    esac
+  fi
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: creating cache $cache_file" >&5
+printf "%s\n" "$as_me: creating cache $cache_file" >&6;}
+  >$cache_file
+fi
+
+# Test code for whether the C compiler supports C89 (global declarations)
+ac_c_conftest_c89_globals='
+/* Does the compiler advertise C89 conformance?
+   Do not test the value of __STDC__, because some compilers set it to 0
+   while being otherwise adequately conformant. */
+#if !defined __STDC__
+# error "Compiler does not advertise C89 conformance"
+#endif
+
+#include <stddef.h>
+#include <stdarg.h>
+struct stat;
+/* Most of the following tests are stolen from RCS 5.7 src/conf.sh.  */
+struct buf { int x; };
+struct buf * (*rcsopen) (struct buf *, struct stat *, int);
+static char *e (p, i)
+     char **p;
+     int i;
+{
+  return p[i];
+}
+static char *f (char * (*g) (char **, int), char **p, ...)
+{
+  char *s;
+  va_list v;
+  va_start (v,p);
+  s = g (p, va_arg (v,int));
+  va_end (v);
+  return s;
+}
+
+/* OSF 4.0 Compaq cc is some sort of almost-ANSI by default.  It has
+   function prototypes and stuff, but not \xHH hex character constants.
+   These do not provoke an error unfortunately, instead are silently treated
+   as an "x".  The following induces an error, until -std is added to get
+   proper ANSI mode.  Curiously \x00 != x always comes out true, for an
+   array size at least.  It is necessary to write \x00 == 0 to get something
+   that is true only with -std.  */
+int osf4_cc_array ['\''\x00'\'' == 0 ? 1 : -1];
+
+/* IBM C 6 for AIX is almost-ANSI by default, but it replaces macro parameters
+   inside strings and character constants.  */
+#define FOO(x) '\''x'\''
+int xlc6_cc_array[FOO(a) == '\''x'\'' ? 1 : -1];
+
+int test (int i, double x);
+struct s1 {int (*f) (int a);};
+struct s2 {int (*f) (double a);};
+int pairnames (int, char **, int *(*)(struct buf *, struct stat *, int),
+               int, int);'
+
+# Test code for whether the C compiler supports C89 (body of main).
+ac_c_conftest_c89_main='
+ok |= (argc == 0 || f (e, argv, 0) != argv[0] || f (e, argv, 1) != argv[1]);
+'
+
+# Test code for whether the C compiler supports C99 (global declarations)
+ac_c_conftest_c99_globals='
+// Does the compiler advertise C99 conformance?
+#if !defined __STDC_VERSION__ || __STDC_VERSION__ < 199901L
+# error "Compiler does not advertise C99 conformance"
+#endif
+
+#include <stdbool.h>
+extern int puts (const char *);
+extern int printf (const char *, ...);
+extern int dprintf (int, const char *, ...);
+extern void *malloc (size_t);
+
+// Check varargs macros.  These examples are taken from C99 6.10.3.5.
+// dprintf is used instead of fprintf to avoid needing to declare
+// FILE and stderr.
+#define debug(...) dprintf (2, __VA_ARGS__)
+#define showlist(...) puts (#__VA_ARGS__)
+#define report(test,...) ((test) ? puts (#test) : printf (__VA_ARGS__))
+static void
+test_varargs_macros (void)
+{
+  int x = 1234;
+  int y = 5678;
+  debug ("Flag");
+  debug ("X = %d\n", x);
+  showlist (The first, second, and third items.);
+  report (x>y, "x is %d but y is %d", x, y);
+}
+
+// Check long long types.
+#define BIG64 18446744073709551615ull
+#define BIG32 4294967295ul
+#define BIG_OK (BIG64 / BIG32 == 4294967297ull && BIG64 % BIG32 == 0)
+#if !BIG_OK
+  #error "your preprocessor is broken"
+#endif
+#if BIG_OK
+#else
+  #error "your preprocessor is broken"
+#endif
+static long long int bignum = -9223372036854775807LL;
+static unsigned long long int ubignum = BIG64;
+
+struct incomplete_array
+{
+  int datasize;
+  double data[];
+};
+
+struct named_init {
+  int number;
+  const wchar_t *name;
+  double average;
+};
+
+typedef const char *ccp;
+
+static inline int
+test_restrict (ccp restrict text)
+{
+  // See if C++-style comments work.
+  // Iterate through items via the restricted pointer.
+  // Also check for declarations in for loops.
+  for (unsigned int i = 0; *(text+i) != '\''\0'\''; ++i)
+    continue;
+  return 0;
+}
+
+// Check varargs and va_copy.
+static bool
+test_varargs (const char *format, ...)
+{
+  va_list args;
+  va_start (args, format);
+  va_list args_copy;
+  va_copy (args_copy, args);
+
+  const char *str = "";
+  int number = 0;
+  float fnumber = 0;
+
+  while (*format)
+    {
+      switch (*format++)
+	{
+	case '\''s'\'': // string
+	  str = va_arg (args_copy, const char *);
+	  break;
+	case '\''d'\'': // int
+	  number = va_arg (args_copy, int);
+	  break;
+	case '\''f'\'': // float
+	  fnumber = va_arg (args_copy, double);
+	  break;
+	default:
+	  break;
+	}
+    }
+  va_end (args_copy);
+  va_end (args);
+
+  return *str && number && fnumber;
+}
+'
+
+# Test code for whether the C compiler supports C99 (body of main).
+ac_c_conftest_c99_main='
+  // Check bool.
+  _Bool success = false;
+  success |= (argc != 0);
+
+  // Check restrict.
+  if (test_restrict ("String literal") == 0)
+    success = true;
+  char *restrict newvar = "Another string";
+
+  // Check varargs.
+  success &= test_varargs ("s, d'\'' f .", "string", 65, 34.234);
+  test_varargs_macros ();
+
+  // Check flexible array members.
+  struct incomplete_array *ia =
+    malloc (sizeof (struct incomplete_array) + (sizeof (double) * 10));
+  ia->datasize = 10;
+  for (int i = 0; i < ia->datasize; ++i)
+    ia->data[i] = i * 1.234;
+
+  // Check named initializers.
+  struct named_init ni = {
+    .number = 34,
+    .name = L"Test wide string",
+    .average = 543.34343,
+  };
+
+  ni.number = 58;
+
+  int dynamic_array[ni.number];
+  dynamic_array[0] = argv[0][0];
+  dynamic_array[ni.number - 1] = 543;
+
+  // work around unused variable warnings
+  ok |= (!success || bignum == 0LL || ubignum == 0uLL || newvar[0] == '\''x'\''
+	 || dynamic_array[ni.number - 1] != 543);
+'
+
+# Test code for whether the C compiler supports C11 (global declarations)
+ac_c_conftest_c11_globals='
+// Does the compiler advertise C11 conformance?
+#if !defined __STDC_VERSION__ || __STDC_VERSION__ < 201112L
+# error "Compiler does not advertise C11 conformance"
+#endif
+
+// Check _Alignas.
+char _Alignas (double) aligned_as_double;
+char _Alignas (0) no_special_alignment;
+extern char aligned_as_int;
+char _Alignas (0) _Alignas (int) aligned_as_int;
+
+// Check _Alignof.
+enum
+{
+  int_alignment = _Alignof (int),
+  int_array_alignment = _Alignof (int[100]),
+  char_alignment = _Alignof (char)
+};
+_Static_assert (0 < -_Alignof (int), "_Alignof is signed");
+
+// Check _Noreturn.
+int _Noreturn does_not_return (void) { for (;;) continue; }
+
+// Check _Static_assert.
+struct test_static_assert
+{
+  int x;
+  _Static_assert (sizeof (int) <= sizeof (long int),
+                  "_Static_assert does not work in struct");
+  long int y;
+};
+
+// Check UTF-8 literals.
+#define u8 syntax error!
+char const utf8_literal[] = u8"happens to be ASCII" "another string";
+
+// Check duplicate typedefs.
+typedef long *long_ptr;
+typedef long int *long_ptr;
+typedef long_ptr long_ptr;
+
+// Anonymous structures and unions -- taken from C11 6.7.2.1 Example 1.
+struct anonymous
+{
+  union {
+    struct { int i; int j; };
+    struct { int k; long int l; } w;
+  };
+  int m;
+} v1;
+'
+
+# Test code for whether the C compiler supports C11 (body of main).
+ac_c_conftest_c11_main='
+  _Static_assert ((offsetof (struct anonymous, i)
+		   == offsetof (struct anonymous, w.k)),
+		  "Anonymous union alignment botch");
+  v1.i = 2;
+  v1.w.k = 5;
+  ok |= v1.i != 5;
+'
+
+# Test code for whether the C compiler supports C11 (complete).
+ac_c_conftest_c11_program="${ac_c_conftest_c89_globals}
+${ac_c_conftest_c99_globals}
+${ac_c_conftest_c11_globals}
+
+int
+main (int argc, char **argv)
+{
+  int ok = 0;
+  ${ac_c_conftest_c89_main}
+  ${ac_c_conftest_c99_main}
+  ${ac_c_conftest_c11_main}
+  return ok;
+}
+"
+
+# Test code for whether the C compiler supports C99 (complete).
+ac_c_conftest_c99_program="${ac_c_conftest_c89_globals}
+${ac_c_conftest_c99_globals}
+
+int
+main (int argc, char **argv)
+{
+  int ok = 0;
+  ${ac_c_conftest_c89_main}
+  ${ac_c_conftest_c99_main}
+  return ok;
+}
+"
+
+# Test code for whether the C compiler supports C89 (complete).
+ac_c_conftest_c89_program="${ac_c_conftest_c89_globals}
+
+int
+main (int argc, char **argv)
+{
+  int ok = 0;
+  ${ac_c_conftest_c89_main}
+  return ok;
+}
+"
+
+# Test code for whether the C++ compiler supports C++98 (global declarations)
+ac_cxx_conftest_cxx98_globals='
+// Does the compiler advertise C++98 conformance?
+#if !defined __cplusplus || __cplusplus < 199711L
+# error "Compiler does not advertise C++98 conformance"
+#endif
+
+// These inclusions are to reject old compilers that
+// lack the unsuffixed header files.
+#include <cstdlib>
+#include <exception>
+
+// <cassert> and <cstring> are *not* freestanding headers in C++98.
+extern void assert (int);
+namespace std {
+  extern int strcmp (const char *, const char *);
+}
+
+// Namespaces, exceptions, and templates were all added after "C++ 2.0".
+using std::exception;
+using std::strcmp;
+
+namespace {
+
+void test_exception_syntax()
+{
+  try {
+    throw "test";
+  } catch (const char *s) {
+    // Extra parentheses suppress a warning when building autoconf itself,
+    // due to lint rules shared with more typical C programs.
+    assert (!(strcmp) (s, "test"));
+  }
+}
+
+template <typename T> struct test_template
+{
+  T const val;
+  explicit test_template(T t) : val(t) {}
+  template <typename U> T add(U u) { return static_cast<T>(u) + val; }
+};
+
+} // anonymous namespace
+'
+
+# Test code for whether the C++ compiler supports C++98 (body of main)
+ac_cxx_conftest_cxx98_main='
+  assert (argc);
+  assert (! argv[0]);
+{
+  test_exception_syntax ();
+  test_template<double> tt (2.0);
+  assert (tt.add (4) == 6.0);
+  assert (true && !false);
+}
+'
+
+# Test code for whether the C++ compiler supports C++11 (global declarations)
+ac_cxx_conftest_cxx11_globals='
+// Does the compiler advertise C++ 2011 conformance?
+#if !defined __cplusplus || __cplusplus < 201103L
+# error "Compiler does not advertise C++11 conformance"
+#endif
+
+namespace cxx11test
+{
+  constexpr int get_val() { return 20; }
+
+  struct testinit
+  {
+    int i;
+    double d;
+  };
+
+  class delegate
+  {
+  public:
+    delegate(int n) : n(n) {}
+    delegate(): delegate(2354) {}
+
+    virtual int getval() { return this->n; };
+  protected:
+    int n;
+  };
+
+  class overridden : public delegate
+  {
+  public:
+    overridden(int n): delegate(n) {}
+    virtual int getval() override final { return this->n * 2; }
+  };
+
+  class nocopy
+  {
+  public:
+    nocopy(int i): i(i) {}
+    nocopy() = default;
+    nocopy(const nocopy&) = delete;
+    nocopy & operator=(const nocopy&) = delete;
+  private:
+    int i;
+  };
+
+  // for testing lambda expressions
+  template <typename Ret, typename Fn> Ret eval(Fn f, Ret v)
+  {
+    return f(v);
+  }
+
+  // for testing variadic templates and trailing return types
+  template <typename V> auto sum(V first) -> V
+  {
+    return first;
+  }
+  template <typename V, typename... Args> auto sum(V first, Args... rest) -> V
+  {
+    return first + sum(rest...);
+  }
+}
+'
+
+# Test code for whether the C++ compiler supports C++11 (body of main)
+ac_cxx_conftest_cxx11_main='
+{
+  // Test auto and decltype
+  auto a1 = 6538;
+  auto a2 = 48573953.4;
+  auto a3 = "String literal";
+
+  int total = 0;
+  for (auto i = a3; *i; ++i) { total += *i; }
+
+  decltype(a2) a4 = 34895.034;
+}
+{
+  // Test constexpr
+  short sa[cxx11test::get_val()] = { 0 };
+}
+{
+  // Test initializer lists
+  cxx11test::testinit il = { 4323, 435234.23544 };
+}
+{
+  // Test range-based for
+  int array[] = {9, 7, 13, 15, 4, 18, 12, 10, 5, 3,
+                 14, 19, 17, 8, 6, 20, 16, 2, 11, 1};
+  for (auto &x : array) { x += 23; }
+}
+{
+  // Test lambda expressions
+  using cxx11test::eval;
+  assert (eval ([](int x) { return x*2; }, 21) == 42);
+  double d = 2.0;
+  assert (eval ([&](double x) { return d += x; }, 3.0) == 5.0);
+  assert (d == 5.0);
+  assert (eval ([=](double x) mutable { return d += x; }, 4.0) == 9.0);
+  assert (d == 5.0);
+}
+{
+  // Test use of variadic templates
+  using cxx11test::sum;
+  auto a = sum(1);
+  auto b = sum(1, 2);
+  auto c = sum(1.0, 2.0, 3.0);
+}
+{
+  // Test constructor delegation
+  cxx11test::delegate d1;
+  cxx11test::delegate d2();
+  cxx11test::delegate d3(45);
+}
+{
+  // Test override and final
+  cxx11test::overridden o1(55464);
+}
+{
+  // Test nullptr
+  char *c = nullptr;
+}
+{
+  // Test template brackets
+  test_template<::test_template<int>> v(test_template<int>(12));
+}
+{
+  // Unicode literals
+  char const *utf8 = u8"UTF-8 string \u2500";
+  char16_t const *utf16 = u"UTF-8 string \u2500";
+  char32_t const *utf32 = U"UTF-32 string \u2500";
+}
+'
+
+# Test code for whether the C compiler supports C++11 (complete).
+ac_cxx_conftest_cxx11_program="${ac_cxx_conftest_cxx98_globals}
+${ac_cxx_conftest_cxx11_globals}
+
+int
+main (int argc, char **argv)
+{
+  int ok = 0;
+  ${ac_cxx_conftest_cxx98_main}
+  ${ac_cxx_conftest_cxx11_main}
+  return ok;
+}
+"
+
+# Test code for whether the C compiler supports C++98 (complete).
+ac_cxx_conftest_cxx98_program="${ac_cxx_conftest_cxx98_globals}
+int
+main (int argc, char **argv)
+{
+  int ok = 0;
+  ${ac_cxx_conftest_cxx98_main}
+  return ok;
+}
+"
+
+as_fn_append ac_header_c_list " stdio.h stdio_h HAVE_STDIO_H"
+as_fn_append ac_header_c_list " stdlib.h stdlib_h HAVE_STDLIB_H"
+as_fn_append ac_header_c_list " string.h string_h HAVE_STRING_H"
+as_fn_append ac_header_c_list " inttypes.h inttypes_h HAVE_INTTYPES_H"
+as_fn_append ac_header_c_list " stdint.h stdint_h HAVE_STDINT_H"
+as_fn_append ac_header_c_list " strings.h strings_h HAVE_STRINGS_H"
+as_fn_append ac_header_c_list " sys/stat.h sys_stat_h HAVE_SYS_STAT_H"
+as_fn_append ac_header_c_list " sys/types.h sys_types_h HAVE_SYS_TYPES_H"
+as_fn_append ac_header_c_list " unistd.h unistd_h HAVE_UNISTD_H"
+as_fn_append ac_header_c_list " vfork.h vfork_h HAVE_VFORK_H"
+as_fn_append ac_func_c_list " fork HAVE_FORK"
+as_fn_append ac_func_c_list " vfork HAVE_VFORK"
+as_fn_append ac_func_c_list " vprintf HAVE_VPRINTF"
+
+# Auxiliary files required by this configure script.
+ac_aux_files="config.guess config.sub compile missing install-sh"
+
+# Locations in which to look for auxiliary files.
+ac_aux_dir_candidates="${srcdir}${PATH_SEPARATOR}${srcdir}/..${PATH_SEPARATOR}${srcdir}/../.."
+
+# Search for a directory containing all of the required auxiliary files,
+# $ac_aux_files, from the $PATH-style list $ac_aux_dir_candidates.
+# If we don't find one directory that contains all the files we need,
+# we report the set of missing files from the *first* directory in
+# $ac_aux_dir_candidates and give up.
+ac_missing_aux_files=""
+ac_first_candidate=:
+printf "%s\n" "$as_me:${as_lineno-$LINENO}: looking for aux files: $ac_aux_files" >&5
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+as_found=false
+for as_dir in $ac_aux_dir_candidates
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+  as_found=:
+
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}:  trying $as_dir" >&5
+  ac_aux_dir_found=yes
+  ac_install_sh=
+  for ac_aux in $ac_aux_files
+  do
+    # As a special case, if "install-sh" is required, that requirement
+    # can be satisfied by any of "install-sh", "install.sh", or "shtool",
+    # and $ac_install_sh is set appropriately for whichever one is found.
+    if test x"$ac_aux" = x"install-sh"
+    then
+      if test -f "${as_dir}install-sh"; then
+        printf "%s\n" "$as_me:${as_lineno-$LINENO}:   ${as_dir}install-sh found" >&5
+        ac_install_sh="${as_dir}install-sh -c"
+      elif test -f "${as_dir}install.sh"; then
+        printf "%s\n" "$as_me:${as_lineno-$LINENO}:   ${as_dir}install.sh found" >&5
+        ac_install_sh="${as_dir}install.sh -c"
+      elif test -f "${as_dir}shtool"; then
+        printf "%s\n" "$as_me:${as_lineno-$LINENO}:   ${as_dir}shtool found" >&5
+        ac_install_sh="${as_dir}shtool install -c"
+      else
+        ac_aux_dir_found=no
+        if $ac_first_candidate; then
+          ac_missing_aux_files="${ac_missing_aux_files} install-sh"
+        else
+          break
+        fi
+      fi
+    else
+      if test -f "${as_dir}${ac_aux}"; then
+        printf "%s\n" "$as_me:${as_lineno-$LINENO}:   ${as_dir}${ac_aux} found" >&5
+      else
+        ac_aux_dir_found=no
+        if $ac_first_candidate; then
+          ac_missing_aux_files="${ac_missing_aux_files} ${ac_aux}"
+        else
+          break
+        fi
+      fi
+    fi
+  done
+  if test "$ac_aux_dir_found" = yes; then
+    ac_aux_dir="$as_dir"
+    break
+  fi
+  ac_first_candidate=false
+
+  as_found=false
+done
+IFS=$as_save_IFS
+if $as_found
+then :
+
+else $as_nop
+  as_fn_error $? "cannot find required auxiliary files:$ac_missing_aux_files" "$LINENO" 5
+fi
+
+
+# These three variables are undocumented and unsupported,
+# and are intended to be withdrawn in a future Autoconf release.
+# They can cause serious problems if a builder's source tree is in a directory
+# whose full name contains unusual characters.
+if test -f "${ac_aux_dir}config.guess"; then
+  ac_config_guess="$SHELL ${ac_aux_dir}config.guess"
+fi
+if test -f "${ac_aux_dir}config.sub"; then
+  ac_config_sub="$SHELL ${ac_aux_dir}config.sub"
+fi
+if test -f "$ac_aux_dir/configure"; then
+  ac_configure="$SHELL ${ac_aux_dir}configure"
+fi
+
+# Check that the precious variables saved in the cache have kept the same
+# value.
+ac_cache_corrupted=false
+for ac_var in $ac_precious_vars; do
+  eval ac_old_set=\$ac_cv_env_${ac_var}_set
+  eval ac_new_set=\$ac_env_${ac_var}_set
+  eval ac_old_val=\$ac_cv_env_${ac_var}_value
+  eval ac_new_val=\$ac_env_${ac_var}_value
+  case $ac_old_set,$ac_new_set in
+    set,)
+      { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
+printf "%s\n" "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
+      ac_cache_corrupted=: ;;
+    ,set)
+      { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was not set in the previous run" >&5
+printf "%s\n" "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
+      ac_cache_corrupted=: ;;
+    ,);;
+    *)
+      if test "x$ac_old_val" != "x$ac_new_val"; then
+	# differences in whitespace do not lead to failure.
+	ac_old_val_w=`echo x $ac_old_val`
+	ac_new_val_w=`echo x $ac_new_val`
+	if test "$ac_old_val_w" != "$ac_new_val_w"; then
+	  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' has changed since the previous run:" >&5
+printf "%s\n" "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
+	  ac_cache_corrupted=:
+	else
+	  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5
+printf "%s\n" "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;}
+	  eval $ac_var=\$ac_old_val
+	fi
+	{ printf "%s\n" "$as_me:${as_lineno-$LINENO}:   former value:  \`$ac_old_val'" >&5
+printf "%s\n" "$as_me:   former value:  \`$ac_old_val'" >&2;}
+	{ printf "%s\n" "$as_me:${as_lineno-$LINENO}:   current value: \`$ac_new_val'" >&5
+printf "%s\n" "$as_me:   current value: \`$ac_new_val'" >&2;}
+      fi;;
+  esac
+  # Pass precious variables to config.status.
+  if test "$ac_new_set" = set; then
+    case $ac_new_val in
+    *\'*) ac_arg=$ac_var=`printf "%s\n" "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
+    *) ac_arg=$ac_var=$ac_new_val ;;
+    esac
+    case " $ac_configure_args " in
+      *" '$ac_arg' "*) ;; # Avoid dups.  Use of quotes ensures accuracy.
+      *) as_fn_append ac_configure_args " '$ac_arg'" ;;
+    esac
+  fi
+done
+if $ac_cache_corrupted; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: changes in the environment can compromise the build" >&5
+printf "%s\n" "$as_me: error: changes in the environment can compromise the build" >&2;}
+  as_fn_error $? "run \`${MAKE-make} distclean' and/or \`rm $cache_file'
+	    and start over" "$LINENO" 5
+fi
+## -------------------- ##
+## Main body of script. ##
+## -------------------- ##
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+# add 'foreign' to allow README.md instead of README
+am__api_version='1.16'
+
+
+
+  # Find a good install program.  We prefer a C program (faster),
+# so one script is as good as another.  But avoid the broken or
+# incompatible versions:
+# SysV /etc/install, /usr/sbin/install
+# SunOS /usr/etc/install
+# IRIX /sbin/install
+# AIX /bin/install
+# AmigaOS /C/install, which installs bootblocks on floppy discs
+# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
+# AFS /usr/afsws/bin/install, which mishandles nonexistent args
+# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
+# OS/2's system install, which has a completely different semantic
+# ./install, which can be erroneously created by make from ./install.sh.
+# Reject install programs that cannot install multiple files.
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for a BSD-compatible install" >&5
+printf %s "checking for a BSD-compatible install... " >&6; }
+if test -z "$INSTALL"; then
+if test ${ac_cv_path_install+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    # Account for fact that we put trailing slashes in our PATH walk.
+case $as_dir in #((
+  ./ | /[cC]/* | \
+  /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
+  ?:[\\/]os2[\\/]install[\\/]* | ?:[\\/]OS2[\\/]INSTALL[\\/]* | \
+  /usr/ucb/* ) ;;
+  *)
+    # OSF1 and SCO ODT 3.0 have their own names for install.
+    # Don't use installbsd from OSF since it installs stuff as root
+    # by default.
+    for ac_prog in ginstall scoinst install; do
+      for ac_exec_ext in '' $ac_executable_extensions; do
+	if as_fn_executable_p "$as_dir$ac_prog$ac_exec_ext"; then
+	  if test $ac_prog = install &&
+	    grep dspmsg "$as_dir$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+	    # AIX install.  It has an incompatible calling convention.
+	    :
+	  elif test $ac_prog = install &&
+	    grep pwplus "$as_dir$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+	    # program-specific install script used by HP pwplus--don't use.
+	    :
+	  else
+	    rm -rf conftest.one conftest.two conftest.dir
+	    echo one > conftest.one
+	    echo two > conftest.two
+	    mkdir conftest.dir
+	    if "$as_dir$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir/" &&
+	      test -s conftest.one && test -s conftest.two &&
+	      test -s conftest.dir/conftest.one &&
+	      test -s conftest.dir/conftest.two
+	    then
+	      ac_cv_path_install="$as_dir$ac_prog$ac_exec_ext -c"
+	      break 3
+	    fi
+	  fi
+	fi
+      done
+    done
+    ;;
+esac
+
+  done
+IFS=$as_save_IFS
+
+rm -rf conftest.one conftest.two conftest.dir
+
+fi
+  if test ${ac_cv_path_install+y}; then
+    INSTALL=$ac_cv_path_install
+  else
+    # As a last resort, use the slow shell script.  Don't cache a
+    # value for INSTALL within a source directory, because that will
+    # break other packages using the cache if that directory is
+    # removed, or if the value is a relative name.
+    INSTALL=$ac_install_sh
+  fi
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $INSTALL" >&5
+printf "%s\n" "$INSTALL" >&6; }
+
+# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
+# It thinks the first close brace ends the variable substitution.
+test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
+
+test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
+
+test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether build environment is sane" >&5
+printf %s "checking whether build environment is sane... " >&6; }
+# Reject unsafe characters in $srcdir or the absolute working directory
+# name.  Accept space and tab only in the latter.
+am_lf='
+'
+case `pwd` in
+  *[\\\"\#\$\&\'\`$am_lf]*)
+    as_fn_error $? "unsafe absolute working directory name" "$LINENO" 5;;
+esac
+case $srcdir in
+  *[\\\"\#\$\&\'\`$am_lf\ \	]*)
+    as_fn_error $? "unsafe srcdir value: '$srcdir'" "$LINENO" 5;;
+esac
+
+# Do 'set' in a subshell so we don't clobber the current shell's
+# arguments.  Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+   am_has_slept=no
+   for am_try in 1 2; do
+     echo "timestamp, slept: $am_has_slept" > conftest.file
+     set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
+     if test "$*" = "X"; then
+	# -L didn't work.
+	set X `ls -t "$srcdir/configure" conftest.file`
+     fi
+     if test "$*" != "X $srcdir/configure conftest.file" \
+	&& test "$*" != "X conftest.file $srcdir/configure"; then
+
+	# If neither matched, then we have a broken ls.  This can happen
+	# if, for instance, CONFIG_SHELL is bash and it inherits a
+	# broken ls alias from the environment.  This has actually
+	# happened.  Such a system could not be considered "sane".
+	as_fn_error $? "ls -t appears to fail.  Make sure there is not a broken
+  alias in your environment" "$LINENO" 5
+     fi
+     if test "$2" = conftest.file || test $am_try -eq 2; then
+       break
+     fi
+     # Just in case.
+     sleep 1
+     am_has_slept=yes
+   done
+   test "$2" = conftest.file
+   )
+then
+   # Ok.
+   :
+else
+   as_fn_error $? "newly created file is older than distributed files!
+Check your system clock" "$LINENO" 5
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+printf "%s\n" "yes" >&6; }
+# If we didn't sleep, we still need to ensure time stamps of config.status and
+# generated files are strictly newer.
+am_sleep_pid=
+if grep 'slept: no' conftest.file >/dev/null 2>&1; then
+  ( sleep 1 ) &
+  am_sleep_pid=$!
+fi
+
+rm -f conftest.file
+
+test "$program_prefix" != NONE &&
+  program_transform_name="s&^&$program_prefix&;$program_transform_name"
+# Use a double $ so make ignores it.
+test "$program_suffix" != NONE &&
+  program_transform_name="s&\$&$program_suffix&;$program_transform_name"
+# Double any \ or $.
+# By default was `s,x,x', remove it if useless.
+ac_script='s/[\\$]/&&/g;s/;s,x,x,$//'
+program_transform_name=`printf "%s\n" "$program_transform_name" | sed "$ac_script"`
+
+
+# Expand $ac_aux_dir to an absolute path.
+am_aux_dir=`cd "$ac_aux_dir" && pwd`
+
+
+  if test x"${MISSING+set}" != xset; then
+  MISSING="\${SHELL} '$am_aux_dir/missing'"
+fi
+# Use eval to expand $SHELL
+if eval "$MISSING --is-lightweight"; then
+  am_missing_run="$MISSING "
+else
+  am_missing_run=
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: 'missing' script is too old or missing" >&5
+printf "%s\n" "$as_me: WARNING: 'missing' script is too old or missing" >&2;}
+fi
+
+if test x"${install_sh+set}" != xset; then
+  case $am_aux_dir in
+  *\ * | *\	*)
+    install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
+  *)
+    install_sh="\${SHELL} $am_aux_dir/install-sh"
+  esac
+fi
+
+# Installed binaries are usually stripped using 'strip' when the user
+# run "make install-strip".  However 'strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the 'STRIP' environment variable to overrule this program.
+if test "$cross_compiling" != no; then
+  if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
+set dummy ${ac_tool_prefix}strip; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_STRIP+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$STRIP"; then
+  ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_STRIP="${ac_tool_prefix}strip"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+STRIP=$ac_cv_prog_STRIP
+if test -n "$STRIP"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5
+printf "%s\n" "$STRIP" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_STRIP"; then
+  ac_ct_STRIP=$STRIP
+  # Extract the first word of "strip", so it can be a program name with args.
+set dummy strip; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_ac_ct_STRIP+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$ac_ct_STRIP"; then
+  ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_STRIP="strip"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
+if test -n "$ac_ct_STRIP"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5
+printf "%s\n" "$ac_ct_STRIP" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+  if test "x$ac_ct_STRIP" = x; then
+    STRIP=":"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+printf "%s\n" "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    STRIP=$ac_ct_STRIP
+  fi
+else
+  STRIP="$ac_cv_prog_STRIP"
+fi
+
+fi
+INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
+
+
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for a race-free mkdir -p" >&5
+printf %s "checking for a race-free mkdir -p... " >&6; }
+if test -z "$MKDIR_P"; then
+  if test ${ac_cv_path_mkdir+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_prog in mkdir gmkdir; do
+	 for ac_exec_ext in '' $ac_executable_extensions; do
+	   as_fn_executable_p "$as_dir$ac_prog$ac_exec_ext" || continue
+	   case `"$as_dir$ac_prog$ac_exec_ext" --version 2>&1` in #(
+	     'mkdir ('*'coreutils) '* | \
+	     'BusyBox '* | \
+	     'mkdir (fileutils) '4.1*)
+	       ac_cv_path_mkdir=$as_dir$ac_prog$ac_exec_ext
+	       break 3;;
+	   esac
+	 done
+       done
+  done
+IFS=$as_save_IFS
+
+fi
+
+  test -d ./--version && rmdir ./--version
+  if test ${ac_cv_path_mkdir+y}; then
+    MKDIR_P="$ac_cv_path_mkdir -p"
+  else
+    # As a last resort, use the slow shell script.  Don't cache a
+    # value for MKDIR_P within a source directory, because that will
+    # break other packages using the cache if that directory is
+    # removed, or if the value is a relative name.
+    MKDIR_P="$ac_install_sh -d"
+  fi
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $MKDIR_P" >&5
+printf "%s\n" "$MKDIR_P" >&6; }
+
+for ac_prog in gawk mawk nawk awk
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_AWK+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$AWK"; then
+  ac_cv_prog_AWK="$AWK" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_AWK="$ac_prog"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+AWK=$ac_cv_prog_AWK
+if test -n "$AWK"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
+printf "%s\n" "$AWK" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+  test -n "$AWK" && break
+done
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5
+printf %s "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
+set x ${MAKE-make}
+ac_make=`printf "%s\n" "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
+if eval test \${ac_cv_prog_make_${ac_make}_set+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat >conftest.make <<\_ACEOF
+SHELL = /bin/sh
+all:
+	@echo '@@@%%%=$(MAKE)=@@@%%%'
+_ACEOF
+# GNU make sometimes prints "make[1]: Entering ...", which would confuse us.
+case `${MAKE-make} -f conftest.make 2>/dev/null` in
+  *@@@%%%=?*=@@@%%%*)
+    eval ac_cv_prog_make_${ac_make}_set=yes;;
+  *)
+    eval ac_cv_prog_make_${ac_make}_set=no;;
+esac
+rm -f conftest.make
+fi
+if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+printf "%s\n" "yes" >&6; }
+  SET_MAKE=
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+  SET_MAKE="MAKE=${MAKE-make}"
+fi
+
+rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+  am__leading_dot=.
+else
+  am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+
+# Check whether --enable-silent-rules was given.
+if test ${enable_silent_rules+y}
+then :
+  enableval=$enable_silent_rules;
+fi
+
+case $enable_silent_rules in # (((
+  yes) AM_DEFAULT_VERBOSITY=0;;
+   no) AM_DEFAULT_VERBOSITY=1;;
+    *) AM_DEFAULT_VERBOSITY=1;;
+esac
+am_make=${MAKE-make}
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether $am_make supports nested variables" >&5
+printf %s "checking whether $am_make supports nested variables... " >&6; }
+if test ${am_cv_make_support_nested_variables+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if printf "%s\n" 'TRUE=$(BAR$(V))
+BAR0=false
+BAR1=true
+V=1
+am__doit:
+	@$(TRUE)
+.PHONY: am__doit' | $am_make -f - >/dev/null 2>&1; then
+  am_cv_make_support_nested_variables=yes
+else
+  am_cv_make_support_nested_variables=no
+fi
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $am_cv_make_support_nested_variables" >&5
+printf "%s\n" "$am_cv_make_support_nested_variables" >&6; }
+if test $am_cv_make_support_nested_variables = yes; then
+    AM_V='$(V)'
+  AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
+else
+  AM_V=$AM_DEFAULT_VERBOSITY
+  AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
+fi
+AM_BACKSLASH='\'
+
+if test "`cd $srcdir && pwd`" != "`pwd`"; then
+  # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
+  # is not polluted with repeated "-I."
+  am__isrc=' -I$(srcdir)'
+  # test to see if srcdir already configured
+  if test -f $srcdir/config.status; then
+    as_fn_error $? "source directory already configured; run \"make distclean\" there first" "$LINENO" 5
+  fi
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+  if (cygpath --version) >/dev/null 2>/dev/null; then
+    CYGPATH_W='cygpath -w'
+  else
+    CYGPATH_W=echo
+  fi
+fi
+
+
+# Define the identity of the package.
+ PACKAGE='ntHash'
+ VERSION='2.1.0'
+
+
+printf "%s\n" "#define PACKAGE \"$PACKAGE\"" >>confdefs.h
+
+
+printf "%s\n" "#define VERSION \"$VERSION\"" >>confdefs.h
+
+# Some tools Automake needs.
+
+ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
+
+
+AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
+
+
+AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
+
+
+AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
+
+
+MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
+
+# For better backward compatibility.  To be removed once Automake 1.9.x
+# dies out for good.  For more background, see:
+# <https://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
+# <https://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
+mkdir_p='$(MKDIR_P)'
+
+# We need awk for the "check" target (and possibly the TAP driver).  The
+# system "awk" is bad on some platforms.
+# Always define AMTAR for backward compatibility.  Yes, it's still used
+# in the wild :-(  We should find a proper way to deprecate it ...
+AMTAR='$${TAR-tar}'
+
+
+# We'll loop over all known methods to create a tar archive until one works.
+_am_tools='gnutar  pax cpio none'
+
+am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'
+
+
+
+
+
+# Variables for tags utilities; see am/tags.am
+if test -z "$CTAGS"; then
+  CTAGS=ctags
+fi
+
+if test -z "$ETAGS"; then
+  ETAGS=etags
+fi
+
+if test -z "$CSCOPE"; then
+  CSCOPE=cscope
+fi
+
+
+
+# POSIX will say in a future version that running "rm -f" with no argument
+# is OK; and we want to be able to make that assumption in our Makefile
+# recipes.  So use an aggressive probe to check that the usage we want is
+# actually supported "in the wild" to an acceptable degree.
+# See automake bug#10828.
+# To make any issue more visible, cause the running configure to be aborted
+# by default if the 'rm' program in use doesn't match our expectations; the
+# user can still override this though.
+if rm -f && rm -fr && rm -rf; then : OK; else
+  cat >&2 <<'END'
+Oops!
+
+Your 'rm' program seems unable to run without file operands specified
+on the command line, even when the '-f' option is present.  This is contrary
+to the behaviour of most rm programs out there, and not conforming with
+the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
+
+Please tell bug-automake@gnu.org about your system, including the value
+of your $PATH and any error possibly output before this message.  This
+can help us improve future automake versions.
+
+END
+  if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
+    echo 'Configuration will proceed anyway, since you have set the' >&2
+    echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
+    echo >&2
+  else
+    cat >&2 <<'END'
+Aborting the configuration process, to ensure you take notice of the issue.
+
+You can download and install GNU coreutils to get an 'rm' implementation
+that behaves properly: <https://www.gnu.org/software/coreutils/>.
+
+If you want to complete the configuration process using your problematic
+'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
+to "yes", and re-run configure.
+
+END
+    as_fn_error $? "Your 'rm' program is bad, sorry." "$LINENO" 5
+  fi
+fi
+
+
+ac_config_headers="$ac_config_headers config.h"
+
+
+if test -z $CXXFLAGS; then
+    CXXFLAGS='-O3'
+fi
+
+if test -z $CCFLAGS; then
+    CCFLAGS='-O3'
+fi
+
+# Checks for programs.
+for ac_prog in gawk mawk nawk awk
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_AWK+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$AWK"; then
+  ac_cv_prog_AWK="$AWK" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_AWK="$ac_prog"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+AWK=$ac_cv_prog_AWK
+if test -n "$AWK"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
+printf "%s\n" "$AWK" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+  test -n "$AWK" && break
+done
+
+
+
+
+
+
+
+
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}gcc; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="${ac_tool_prefix}gcc"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+printf "%s\n" "$CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_CC"; then
+  ac_ct_CC=$CC
+  # Extract the first word of "gcc", so it can be a program name with args.
+set dummy gcc; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_ac_ct_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CC="gcc"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+printf "%s\n" "$ac_ct_CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+  if test "x$ac_ct_CC" = x; then
+    CC=""
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+printf "%s\n" "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    CC=$ac_ct_CC
+  fi
+else
+  CC="$ac_cv_prog_CC"
+fi
+
+if test -z "$CC"; then
+          if test -n "$ac_tool_prefix"; then
+    # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}cc; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="${ac_tool_prefix}cc"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+printf "%s\n" "$CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+  fi
+fi
+if test -z "$CC"; then
+  # Extract the first word of "cc", so it can be a program name with args.
+set dummy cc; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+  ac_prog_rejected=no
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    if test "$as_dir$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then
+       ac_prog_rejected=yes
+       continue
+     fi
+    ac_cv_prog_CC="cc"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+if test $ac_prog_rejected = yes; then
+  # We found a bogon in the path, so make sure we never use it.
+  set dummy $ac_cv_prog_CC
+  shift
+  if test $# != 0; then
+    # We chose a different compiler from the bogus one.
+    # However, it has the same basename, so the bogon will be chosen
+    # first if we set CC to just the basename; use the full file name.
+    shift
+    ac_cv_prog_CC="$as_dir$ac_word${1+' '}$@"
+  fi
+fi
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+printf "%s\n" "$CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+fi
+if test -z "$CC"; then
+  if test -n "$ac_tool_prefix"; then
+  for ac_prog in cl.exe
+  do
+    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="$ac_tool_prefix$ac_prog"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+printf "%s\n" "$CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+    test -n "$CC" && break
+  done
+fi
+if test -z "$CC"; then
+  ac_ct_CC=$CC
+  for ac_prog in cl.exe
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_ac_ct_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CC="$ac_prog"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+printf "%s\n" "$ac_ct_CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+  test -n "$ac_ct_CC" && break
+done
+
+  if test "x$ac_ct_CC" = x; then
+    CC=""
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+printf "%s\n" "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    CC=$ac_ct_CC
+  fi
+fi
+
+fi
+if test -z "$CC"; then
+  if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}clang", so it can be a program name with args.
+set dummy ${ac_tool_prefix}clang; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="${ac_tool_prefix}clang"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+printf "%s\n" "$CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_CC"; then
+  ac_ct_CC=$CC
+  # Extract the first word of "clang", so it can be a program name with args.
+set dummy clang; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_ac_ct_CC+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CC="clang"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+printf "%s\n" "$ac_ct_CC" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+  if test "x$ac_ct_CC" = x; then
+    CC=""
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+printf "%s\n" "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    CC=$ac_ct_CC
+  fi
+else
+  CC="$ac_cv_prog_CC"
+fi
+
+fi
+
+
+test -z "$CC" && { { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "no acceptable C compiler found in \$PATH
+See \`config.log' for more details" "$LINENO" 5; }
+
+# Provide some information about the compiler.
+printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for C compiler version" >&5
+set X $ac_compile
+ac_compiler=$2
+for ac_option in --version -v -V -qversion -version; do
+  { { ac_try="$ac_compiler $ac_option >&5"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_compiler $ac_option >&5") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    sed '10a\
+... rest of stderr output deleted ...
+         10q' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+  fi
+  rm -f conftest.er1 conftest.err
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+done
+
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out"
+# Try to create an executable without -o first, disregard a.out.
+# It will help us diagnose broken compilers, and finding out an intuition
+# of exeext.
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether the C compiler works" >&5
+printf %s "checking whether the C compiler works... " >&6; }
+ac_link_default=`printf "%s\n" "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
+
+# The possible output files:
+ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*"
+
+ac_rmfiles=
+for ac_file in $ac_files
+do
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
+    * ) ac_rmfiles="$ac_rmfiles $ac_file";;
+  esac
+done
+rm -f $ac_rmfiles
+
+if { { ac_try="$ac_link_default"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_link_default") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+then :
+  # Autoconf-2.13 could set the ac_cv_exeext variable to `no'.
+# So ignore a value of `no', otherwise this would lead to `EXEEXT = no'
+# in a Makefile.  We should not override ac_cv_exeext if it was cached,
+# so that the user can short-circuit this test for compilers unknown to
+# Autoconf.
+for ac_file in $ac_files ''
+do
+  test -f "$ac_file" || continue
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj )
+	;;
+    [ab].out )
+	# We found the default executable, but exeext='' is most
+	# certainly right.
+	break;;
+    *.* )
+	if test ${ac_cv_exeext+y} && test "$ac_cv_exeext" != no;
+	then :; else
+	   ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+	fi
+	# We set ac_cv_exeext here because the later test for it is not
+	# safe: cross compilers may not add the suffix if given an `-o'
+	# argument, so we may need to know it at that point already.
+	# Even if this section looks crufty: it has the advantage of
+	# actually working.
+	break;;
+    * )
+	break;;
+  esac
+done
+test "$ac_cv_exeext" = no && ac_cv_exeext=
+
+else $as_nop
+  ac_file=''
+fi
+if test -z "$ac_file"
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+{ { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error 77 "C compiler cannot create executables
+See \`config.log' for more details" "$LINENO" 5; }
+else $as_nop
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+printf "%s\n" "yes" >&6; }
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for C compiler default output file name" >&5
+printf %s "checking for C compiler default output file name... " >&6; }
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_file" >&5
+printf "%s\n" "$ac_file" >&6; }
+ac_exeext=$ac_cv_exeext
+
+rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out
+ac_clean_files=$ac_clean_files_save
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for suffix of executables" >&5
+printf %s "checking for suffix of executables... " >&6; }
+if { { ac_try="$ac_link"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+then :
+  # If both `conftest.exe' and `conftest' are `present' (well, observable)
+# catch `conftest.exe'.  For instance with Cygwin, `ls conftest' will
+# work properly (i.e., refer to `conftest.exe'), while it won't with
+# `rm'.
+for ac_file in conftest.exe conftest conftest.*; do
+  test -f "$ac_file" || continue
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
+    *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+	  break;;
+    * ) break;;
+  esac
+done
+else $as_nop
+  { { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot compute suffix of executables: cannot compile and link
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+rm -f conftest conftest$ac_cv_exeext
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_exeext" >&5
+printf "%s\n" "$ac_cv_exeext" >&6; }
+
+rm -f conftest.$ac_ext
+EXEEXT=$ac_cv_exeext
+ac_exeext=$EXEEXT
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <stdio.h>
+int
+main (void)
+{
+FILE *f = fopen ("conftest.out", "w");
+ return ferror (f) || fclose (f) != 0;
+
+  ;
+  return 0;
+}
+_ACEOF
+ac_clean_files="$ac_clean_files conftest.out"
+# Check that the compiler produces executables we can run.  If not, either
+# the compiler is broken, or we cross compile.
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether we are cross compiling" >&5
+printf %s "checking whether we are cross compiling... " >&6; }
+if test "$cross_compiling" != yes; then
+  { { ac_try="$ac_link"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+  if { ac_try='./conftest$ac_cv_exeext'
+  { { case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_try") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; }; then
+    cross_compiling=no
+  else
+    if test "$cross_compiling" = maybe; then
+	cross_compiling=yes
+    else
+	{ { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error 77 "cannot run C compiled programs.
+If you meant to cross compile, use \`--host'.
+See \`config.log' for more details" "$LINENO" 5; }
+    fi
+  fi
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $cross_compiling" >&5
+printf "%s\n" "$cross_compiling" >&6; }
+
+rm -f conftest.$ac_ext conftest$ac_cv_exeext conftest.out
+ac_clean_files=$ac_clean_files_save
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for suffix of object files" >&5
+printf %s "checking for suffix of object files... " >&6; }
+if test ${ac_cv_objext+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.o conftest.obj
+if { { ac_try="$ac_compile"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_compile") 2>&5
+  ac_status=$?
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+then :
+  for ac_file in conftest.o conftest.obj conftest.*; do
+  test -f "$ac_file" || continue;
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;;
+    *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
+       break;;
+  esac
+done
+else $as_nop
+  printf "%s\n" "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+{ { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot compute suffix of object files: cannot compile
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+rm -f conftest.$ac_cv_objext conftest.$ac_ext
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_objext" >&5
+printf "%s\n" "$ac_cv_objext" >&6; }
+OBJEXT=$ac_cv_objext
+ac_objext=$OBJEXT
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether the compiler supports GNU C" >&5
+printf %s "checking whether the compiler supports GNU C... " >&6; }
+if test ${ac_cv_c_compiler_gnu+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+#ifndef __GNUC__
+       choke me
+#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_compiler_gnu=yes
+else $as_nop
+  ac_compiler_gnu=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+ac_cv_c_compiler_gnu=$ac_compiler_gnu
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_compiler_gnu" >&5
+printf "%s\n" "$ac_cv_c_compiler_gnu" >&6; }
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+if test $ac_compiler_gnu = yes; then
+  GCC=yes
+else
+  GCC=
+fi
+ac_test_CFLAGS=${CFLAGS+y}
+ac_save_CFLAGS=$CFLAGS
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether $CC accepts -g" >&5
+printf %s "checking whether $CC accepts -g... " >&6; }
+if test ${ac_cv_prog_cc_g+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_save_c_werror_flag=$ac_c_werror_flag
+   ac_c_werror_flag=yes
+   ac_cv_prog_cc_g=no
+   CFLAGS="-g"
+   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_prog_cc_g=yes
+else $as_nop
+  CFLAGS=""
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+
+else $as_nop
+  ac_c_werror_flag=$ac_save_c_werror_flag
+	 CFLAGS="-g"
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_prog_cc_g=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+   ac_c_werror_flag=$ac_save_c_werror_flag
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_g" >&5
+printf "%s\n" "$ac_cv_prog_cc_g" >&6; }
+if test $ac_test_CFLAGS; then
+  CFLAGS=$ac_save_CFLAGS
+elif test $ac_cv_prog_cc_g = yes; then
+  if test "$GCC" = yes; then
+    CFLAGS="-g -O2"
+  else
+    CFLAGS="-g"
+  fi
+else
+  if test "$GCC" = yes; then
+    CFLAGS="-O2"
+  else
+    CFLAGS=
+  fi
+fi
+ac_prog_cc_stdc=no
+if test x$ac_prog_cc_stdc = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $CC option to enable C11 features" >&5
+printf %s "checking for $CC option to enable C11 features... " >&6; }
+if test ${ac_cv_prog_cc_c11+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_prog_cc_c11=no
+ac_save_CC=$CC
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_c_conftest_c11_program
+_ACEOF
+for ac_arg in '' -std=gnu11
+do
+  CC="$ac_save_CC $ac_arg"
+  if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_prog_cc_c11=$ac_arg
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam
+  test "x$ac_cv_prog_cc_c11" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CC=$ac_save_CC
+fi
+
+if test "x$ac_cv_prog_cc_c11" = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+printf "%s\n" "unsupported" >&6; }
+else $as_nop
+  if test "x$ac_cv_prog_cc_c11" = x
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+printf "%s\n" "none needed" >&6; }
+else $as_nop
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_c11" >&5
+printf "%s\n" "$ac_cv_prog_cc_c11" >&6; }
+     CC="$CC $ac_cv_prog_cc_c11"
+fi
+  ac_cv_prog_cc_stdc=$ac_cv_prog_cc_c11
+  ac_prog_cc_stdc=c11
+fi
+fi
+if test x$ac_prog_cc_stdc = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $CC option to enable C99 features" >&5
+printf %s "checking for $CC option to enable C99 features... " >&6; }
+if test ${ac_cv_prog_cc_c99+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_prog_cc_c99=no
+ac_save_CC=$CC
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_c_conftest_c99_program
+_ACEOF
+for ac_arg in '' -std=gnu99 -std=c99 -c99 -qlanglvl=extc1x -qlanglvl=extc99 -AC99 -D_STDC_C99=
+do
+  CC="$ac_save_CC $ac_arg"
+  if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_prog_cc_c99=$ac_arg
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam
+  test "x$ac_cv_prog_cc_c99" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CC=$ac_save_CC
+fi
+
+if test "x$ac_cv_prog_cc_c99" = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+printf "%s\n" "unsupported" >&6; }
+else $as_nop
+  if test "x$ac_cv_prog_cc_c99" = x
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+printf "%s\n" "none needed" >&6; }
+else $as_nop
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_c99" >&5
+printf "%s\n" "$ac_cv_prog_cc_c99" >&6; }
+     CC="$CC $ac_cv_prog_cc_c99"
+fi
+  ac_cv_prog_cc_stdc=$ac_cv_prog_cc_c99
+  ac_prog_cc_stdc=c99
+fi
+fi
+if test x$ac_prog_cc_stdc = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $CC option to enable C89 features" >&5
+printf %s "checking for $CC option to enable C89 features... " >&6; }
+if test ${ac_cv_prog_cc_c89+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_prog_cc_c89=no
+ac_save_CC=$CC
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_c_conftest_c89_program
+_ACEOF
+for ac_arg in '' -qlanglvl=extc89 -qlanglvl=ansi -std -Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__"
+do
+  CC="$ac_save_CC $ac_arg"
+  if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_prog_cc_c89=$ac_arg
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam
+  test "x$ac_cv_prog_cc_c89" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CC=$ac_save_CC
+fi
+
+if test "x$ac_cv_prog_cc_c89" = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+printf "%s\n" "unsupported" >&6; }
+else $as_nop
+  if test "x$ac_cv_prog_cc_c89" = x
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+printf "%s\n" "none needed" >&6; }
+else $as_nop
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_c89" >&5
+printf "%s\n" "$ac_cv_prog_cc_c89" >&6; }
+     CC="$CC $ac_cv_prog_cc_c89"
+fi
+  ac_cv_prog_cc_stdc=$ac_cv_prog_cc_c89
+  ac_prog_cc_stdc=c89
+fi
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+  ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether $CC understands -c and -o together" >&5
+printf %s "checking whether $CC understands -c and -o together... " >&6; }
+if test ${am_cv_prog_cc_c_o+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+  # Make sure it works both with $CC and with simple cc.
+  # Following AC_PROG_CC_C_O, we do the test twice because some
+  # compilers refuse to overwrite an existing .o file with -o,
+  # though they will create one.
+  am_cv_prog_cc_c_o=yes
+  for am_i in 1 2; do
+    if { echo "$as_me:$LINENO: $CC -c conftest.$ac_ext -o conftest2.$ac_objext" >&5
+   ($CC -c conftest.$ac_ext -o conftest2.$ac_objext) >&5 2>&5
+   ac_status=$?
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
+   (exit $ac_status); } \
+         && test -f conftest2.$ac_objext; then
+      : OK
+    else
+      am_cv_prog_cc_c_o=no
+      break
+    fi
+  done
+  rm -f core conftest*
+  unset am_i
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $am_cv_prog_cc_c_o" >&5
+printf "%s\n" "$am_cv_prog_cc_c_o" >&6; }
+if test "$am_cv_prog_cc_c_o" != yes; then
+   # Losing compiler, so override with the script.
+   # FIXME: It is wrong to rewrite CC.
+   # But if we don't then we get into trouble of one sort or another.
+   # A longer-term fix would be to have automake use am__CC in this case,
+   # and then we could set am__CC="\$(top_srcdir)/compile \$(CC)"
+   CC="$am_aux_dir/compile $CC"
+fi
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+DEPDIR="${am__leading_dot}deps"
+
+ac_config_commands="$ac_config_commands depfiles"
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} supports the include directive" >&5
+printf %s "checking whether ${MAKE-make} supports the include directive... " >&6; }
+cat > confinc.mk << 'END'
+am__doit:
+	@echo this is the am__doit target >confinc.out
+.PHONY: am__doit
+END
+am__include="#"
+am__quote=
+# BSD make does it like this.
+echo '.include "confinc.mk" # ignored' > confmf.BSD
+# Other make implementations (GNU, Solaris 10, AIX) do it like this.
+echo 'include confinc.mk # ignored' > confmf.GNU
+_am_result=no
+for s in GNU BSD; do
+  { echo "$as_me:$LINENO: ${MAKE-make} -f confmf.$s && cat confinc.out" >&5
+   (${MAKE-make} -f confmf.$s && cat confinc.out) >&5 2>&5
+   ac_status=$?
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
+   (exit $ac_status); }
+  case $?:`cat confinc.out 2>/dev/null` in #(
+  '0:this is the am__doit target') :
+    case $s in #(
+  BSD) :
+    am__include='.include' am__quote='"' ;; #(
+  *) :
+    am__include='include' am__quote='' ;;
+esac ;; #(
+  *) :
+     ;;
+esac
+  if test "$am__include" != "#"; then
+    _am_result="yes ($s style)"
+    break
+  fi
+done
+rm -f confinc.* confmf.*
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: ${_am_result}" >&5
+printf "%s\n" "${_am_result}" >&6; }
+
+# Check whether --enable-dependency-tracking was given.
+if test ${enable_dependency_tracking+y}
+then :
+  enableval=$enable_dependency_tracking;
+fi
+
+if test "x$enable_dependency_tracking" != xno; then
+  am_depcomp="$ac_aux_dir/depcomp"
+  AMDEPBACKSLASH='\'
+  am__nodep='_no'
+fi
+ if test "x$enable_dependency_tracking" != xno; then
+  AMDEP_TRUE=
+  AMDEP_FALSE='#'
+else
+  AMDEP_TRUE='#'
+  AMDEP_FALSE=
+fi
+
+
+
+depcc="$CC"   am_compiler_list=
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
+printf %s "checking dependency style of $depcc... " >&6; }
+if test ${am_cv_CC_dependencies_compiler_type+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named 'D' -- because '-MD' means "put the output
+  # in D".
+  rm -rf conftest.dir
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+  # We will build objects and dependencies in a subdirectory because
+  # it helps to detect inapplicable dependency modes.  For instance
+  # both Tru64's cc and ICC support -MD to output dependencies as a
+  # side effect of compilation, but ICC will put the dependencies in
+  # the current directory while Tru64 will put them in the object
+  # directory.
+  mkdir sub
+
+  am_cv_CC_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+  fi
+  am__universal=false
+  case " $depcc " in #(
+     *\ -arch\ *\ -arch\ *) am__universal=true ;;
+     esac
+
+  for depmode in $am_compiler_list; do
+    # Setup a source with many dependencies, because some compilers
+    # like to wrap large dependency lists on column 80 (with \), and
+    # we should not choose a depcomp mode which is confused by this.
+    #
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    : > sub/conftest.c
+    for i in 1 2 3 4 5 6; do
+      echo '#include "conftst'$i'.h"' >> sub/conftest.c
+      # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
+      # Solaris 10 /bin/sh.
+      echo '/* dummy */' > sub/conftst$i.h
+    done
+    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+
+    # We check with '-c' and '-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle '-M -o', and we need to detect this.  Also, some Intel
+    # versions had trouble with output in subdirs.
+    am__obj=sub/conftest.${OBJEXT-o}
+    am__minus_obj="-o $am__obj"
+    case $depmode in
+    gcc)
+      # This depmode causes a compiler race in universal mode.
+      test "$am__universal" = false || continue
+      ;;
+    nosideeffect)
+      # After this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested.
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+      # This compiler won't grok '-c -o', but also, the minuso test has
+      # not run yet.  These depmodes are late enough in the game, and
+      # so weak that their functioning should not be impacted.
+      am__obj=conftest.${OBJEXT-o}
+      am__minus_obj=
+      ;;
+    none) break ;;
+    esac
+    if depmode=$depmode \
+       source=sub/conftest.c object=$am__obj \
+       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # or remarks (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored or not supported.
+      # When given -MP, icc 7.0 and 7.1 complain thusly:
+      #   icc: Command line warning: ignoring option '-M'; no argument required
+      # The diagnosis changed in icc 8.0:
+      #   icc: Command line remark: option '-MP' not supported
+      if (grep 'ignoring option' conftest.err ||
+          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+        am_cv_CC_dependencies_compiler_type=$depmode
+        break
+      fi
+    fi
+  done
+
+  cd ..
+  rm -rf conftest.dir
+else
+  am_cv_CC_dependencies_compiler_type=none
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $am_cv_CC_dependencies_compiler_type" >&5
+printf "%s\n" "$am_cv_CC_dependencies_compiler_type" >&6; }
+CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type
+
+ if
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then
+  am__fastdepCC_TRUE=
+  am__fastdepCC_FALSE='#'
+else
+  am__fastdepCC_TRUE='#'
+  am__fastdepCC_FALSE=
+fi
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking how to run the C preprocessor" >&5
+printf %s "checking how to run the C preprocessor... " >&6; }
+# On Suns, sometimes $CPP names a directory.
+if test -n "$CPP" && test -d "$CPP"; then
+  CPP=
+fi
+if test -z "$CPP"; then
+  if test ${ac_cv_prog_CPP+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+      # Double quotes because $CC needs to be expanded
+    for CPP in "$CC -E" "$CC -E -traditional-cpp" cpp /lib/cpp
+    do
+      ac_preproc_ok=false
+for ac_c_preproc_warn_flag in '' yes
+do
+  # Use a header file that comes with gcc, so configuring glibc
+  # with a fresh cross-compiler works.
+  # On the NeXT, cc -E runs the code through the compiler's parser,
+  # not just through cpp. "Syntax error" is here to catch this case.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <limits.h>
+		     Syntax error
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"
+then :
+
+else $as_nop
+  # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+  # OK, works on sane cases.  Now check whether nonexistent headers
+  # can be detected and how.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <ac_nonexistent.h>
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"
+then :
+  # Broken: success on invalid input.
+continue
+else $as_nop
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok
+then :
+  break
+fi
+
+    done
+    ac_cv_prog_CPP=$CPP
+
+fi
+  CPP=$ac_cv_prog_CPP
+else
+  ac_cv_prog_CPP=$CPP
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CPP" >&5
+printf "%s\n" "$CPP" >&6; }
+ac_preproc_ok=false
+for ac_c_preproc_warn_flag in '' yes
+do
+  # Use a header file that comes with gcc, so configuring glibc
+  # with a fresh cross-compiler works.
+  # On the NeXT, cc -E runs the code through the compiler's parser,
+  # not just through cpp. "Syntax error" is here to catch this case.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <limits.h>
+		     Syntax error
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"
+then :
+
+else $as_nop
+  # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+  # OK, works on sane cases.  Now check whether nonexistent headers
+  # can be detected and how.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <ac_nonexistent.h>
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"
+then :
+  # Broken: success on invalid input.
+continue
+else $as_nop
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok
+then :
+
+else $as_nop
+  { { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "C preprocessor \"$CPP\" fails sanity check
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+
+
+
+
+
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+if test -z "$CXX"; then
+  if test -n "$CCC"; then
+    CXX=$CCC
+  else
+    if test -n "$ac_tool_prefix"; then
+  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC clang++
+  do
+    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_CXX+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$CXX"; then
+  ac_cv_prog_CXX="$CXX" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CXX=$ac_cv_prog_CXX
+if test -n "$CXX"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $CXX" >&5
+printf "%s\n" "$CXX" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+    test -n "$CXX" && break
+  done
+fi
+if test -z "$CXX"; then
+  ac_ct_CXX=$CXX
+  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC clang++
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_ac_ct_CXX+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$ac_ct_CXX"; then
+  ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CXX="$ac_prog"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
+if test -n "$ac_ct_CXX"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CXX" >&5
+printf "%s\n" "$ac_ct_CXX" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+  test -n "$ac_ct_CXX" && break
+done
+
+  if test "x$ac_ct_CXX" = x; then
+    CXX="g++"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+printf "%s\n" "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    CXX=$ac_ct_CXX
+  fi
+fi
+
+  fi
+fi
+# Provide some information about the compiler.
+printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for C++ compiler version" >&5
+set X $ac_compile
+ac_compiler=$2
+for ac_option in --version -v -V -qversion; do
+  { { ac_try="$ac_compiler $ac_option >&5"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+printf "%s\n" "$ac_try_echo"; } >&5
+  (eval "$ac_compiler $ac_option >&5") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    sed '10a\
+... rest of stderr output deleted ...
+         10q' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+  fi
+  rm -f conftest.er1 conftest.err
+  printf "%s\n" "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+done
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether the compiler supports GNU C++" >&5
+printf %s "checking whether the compiler supports GNU C++... " >&6; }
+if test ${ac_cv_cxx_compiler_gnu+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+#ifndef __GNUC__
+       choke me
+#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"
+then :
+  ac_compiler_gnu=yes
+else $as_nop
+  ac_compiler_gnu=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_cxx_compiler_gnu" >&5
+printf "%s\n" "$ac_cv_cxx_compiler_gnu" >&6; }
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+
+if test $ac_compiler_gnu = yes; then
+  GXX=yes
+else
+  GXX=
+fi
+ac_test_CXXFLAGS=${CXXFLAGS+y}
+ac_save_CXXFLAGS=$CXXFLAGS
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether $CXX accepts -g" >&5
+printf %s "checking whether $CXX accepts -g... " >&6; }
+if test ${ac_cv_prog_cxx_g+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_save_cxx_werror_flag=$ac_cxx_werror_flag
+   ac_cxx_werror_flag=yes
+   ac_cv_prog_cxx_g=no
+   CXXFLAGS="-g"
+   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"
+then :
+  ac_cv_prog_cxx_g=yes
+else $as_nop
+  CXXFLAGS=""
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"
+then :
+
+else $as_nop
+  ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+	 CXXFLAGS="-g"
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"
+then :
+  ac_cv_prog_cxx_g=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+   ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_g" >&5
+printf "%s\n" "$ac_cv_prog_cxx_g" >&6; }
+if test $ac_test_CXXFLAGS; then
+  CXXFLAGS=$ac_save_CXXFLAGS
+elif test $ac_cv_prog_cxx_g = yes; then
+  if test "$GXX" = yes; then
+    CXXFLAGS="-g -O2"
+  else
+    CXXFLAGS="-g"
+  fi
+else
+  if test "$GXX" = yes; then
+    CXXFLAGS="-O2"
+  else
+    CXXFLAGS=
+  fi
+fi
+ac_prog_cxx_stdcxx=no
+if test x$ac_prog_cxx_stdcxx = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $CXX option to enable C++11 features" >&5
+printf %s "checking for $CXX option to enable C++11 features... " >&6; }
+if test ${ac_cv_prog_cxx_11+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_prog_cxx_11=no
+ac_save_CXX=$CXX
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_cxx_conftest_cxx11_program
+_ACEOF
+for ac_arg in '' -std=gnu++11 -std=gnu++0x -std=c++11 -std=c++0x -qlanglvl=extended0x -AA
+do
+  CXX="$ac_save_CXX $ac_arg"
+  if ac_fn_cxx_try_compile "$LINENO"
+then :
+  ac_cv_prog_cxx_cxx11=$ac_arg
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam
+  test "x$ac_cv_prog_cxx_cxx11" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CXX=$ac_save_CXX
+fi
+
+if test "x$ac_cv_prog_cxx_cxx11" = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+printf "%s\n" "unsupported" >&6; }
+else $as_nop
+  if test "x$ac_cv_prog_cxx_cxx11" = x
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+printf "%s\n" "none needed" >&6; }
+else $as_nop
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_cxx11" >&5
+printf "%s\n" "$ac_cv_prog_cxx_cxx11" >&6; }
+     CXX="$CXX $ac_cv_prog_cxx_cxx11"
+fi
+  ac_cv_prog_cxx_stdcxx=$ac_cv_prog_cxx_cxx11
+  ac_prog_cxx_stdcxx=cxx11
+fi
+fi
+if test x$ac_prog_cxx_stdcxx = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $CXX option to enable C++98 features" >&5
+printf %s "checking for $CXX option to enable C++98 features... " >&6; }
+if test ${ac_cv_prog_cxx_98+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_prog_cxx_98=no
+ac_save_CXX=$CXX
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_cxx_conftest_cxx98_program
+_ACEOF
+for ac_arg in '' -std=gnu++98 -std=c++98 -qlanglvl=extended -AA
+do
+  CXX="$ac_save_CXX $ac_arg"
+  if ac_fn_cxx_try_compile "$LINENO"
+then :
+  ac_cv_prog_cxx_cxx98=$ac_arg
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam
+  test "x$ac_cv_prog_cxx_cxx98" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CXX=$ac_save_CXX
+fi
+
+if test "x$ac_cv_prog_cxx_cxx98" = xno
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+printf "%s\n" "unsupported" >&6; }
+else $as_nop
+  if test "x$ac_cv_prog_cxx_cxx98" = x
+then :
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+printf "%s\n" "none needed" >&6; }
+else $as_nop
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_cxx98" >&5
+printf "%s\n" "$ac_cv_prog_cxx_cxx98" >&6; }
+     CXX="$CXX $ac_cv_prog_cxx_cxx98"
+fi
+  ac_cv_prog_cxx_stdcxx=$ac_cv_prog_cxx_cxx98
+  ac_prog_cxx_stdcxx=cxx98
+fi
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+depcc="$CXX"  am_compiler_list=
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
+printf %s "checking dependency style of $depcc... " >&6; }
+if test ${am_cv_CXX_dependencies_compiler_type+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named 'D' -- because '-MD' means "put the output
+  # in D".
+  rm -rf conftest.dir
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+  # We will build objects and dependencies in a subdirectory because
+  # it helps to detect inapplicable dependency modes.  For instance
+  # both Tru64's cc and ICC support -MD to output dependencies as a
+  # side effect of compilation, but ICC will put the dependencies in
+  # the current directory while Tru64 will put them in the object
+  # directory.
+  mkdir sub
+
+  am_cv_CXX_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+  fi
+  am__universal=false
+  case " $depcc " in #(
+     *\ -arch\ *\ -arch\ *) am__universal=true ;;
+     esac
+
+  for depmode in $am_compiler_list; do
+    # Setup a source with many dependencies, because some compilers
+    # like to wrap large dependency lists on column 80 (with \), and
+    # we should not choose a depcomp mode which is confused by this.
+    #
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    : > sub/conftest.c
+    for i in 1 2 3 4 5 6; do
+      echo '#include "conftst'$i'.h"' >> sub/conftest.c
+      # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
+      # Solaris 10 /bin/sh.
+      echo '/* dummy */' > sub/conftst$i.h
+    done
+    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+
+    # We check with '-c' and '-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle '-M -o', and we need to detect this.  Also, some Intel
+    # versions had trouble with output in subdirs.
+    am__obj=sub/conftest.${OBJEXT-o}
+    am__minus_obj="-o $am__obj"
+    case $depmode in
+    gcc)
+      # This depmode causes a compiler race in universal mode.
+      test "$am__universal" = false || continue
+      ;;
+    nosideeffect)
+      # After this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested.
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+      # This compiler won't grok '-c -o', but also, the minuso test has
+      # not run yet.  These depmodes are late enough in the game, and
+      # so weak that their functioning should not be impacted.
+      am__obj=conftest.${OBJEXT-o}
+      am__minus_obj=
+      ;;
+    none) break ;;
+    esac
+    if depmode=$depmode \
+       source=sub/conftest.c object=$am__obj \
+       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # or remarks (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored or not supported.
+      # When given -MP, icc 7.0 and 7.1 complain thusly:
+      #   icc: Command line warning: ignoring option '-M'; no argument required
+      # The diagnosis changed in icc 8.0:
+      #   icc: Command line remark: option '-MP' not supported
+      if (grep 'ignoring option' conftest.err ||
+          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+        am_cv_CXX_dependencies_compiler_type=$depmode
+        break
+      fi
+    fi
+  done
+
+  cd ..
+  rm -rf conftest.dir
+else
+  am_cv_CXX_dependencies_compiler_type=none
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $am_cv_CXX_dependencies_compiler_type" >&5
+printf "%s\n" "$am_cv_CXX_dependencies_compiler_type" >&6; }
+CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
+
+ if
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
+  am__fastdepCXX_TRUE=
+  am__fastdepCXX_FALSE='#'
+else
+  am__fastdepCXX_TRUE='#'
+  am__fastdepCXX_FALSE=
+fi
+
+
+
+if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args.
+set dummy ${ac_tool_prefix}ranlib; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_RANLIB+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$RANLIB"; then
+  ac_cv_prog_RANLIB="$RANLIB" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+RANLIB=$ac_cv_prog_RANLIB
+if test -n "$RANLIB"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $RANLIB" >&5
+printf "%s\n" "$RANLIB" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_RANLIB"; then
+  ac_ct_RANLIB=$RANLIB
+  # Extract the first word of "ranlib", so it can be a program name with args.
+set dummy ranlib; ac_word=$2
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+printf %s "checking for $ac_word... " >&6; }
+if test ${ac_cv_prog_ac_ct_RANLIB+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -n "$ac_ct_RANLIB"; then
+  ac_cv_prog_ac_ct_RANLIB="$ac_ct_RANLIB" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if as_fn_executable_p "$as_dir$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_RANLIB="ranlib"
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: found $as_dir$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB
+if test -n "$ac_ct_RANLIB"; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_ct_RANLIB" >&5
+printf "%s\n" "$ac_ct_RANLIB" >&6; }
+else
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: no" >&5
+printf "%s\n" "no" >&6; }
+fi
+
+  if test "x$ac_ct_RANLIB" = x; then
+    RANLIB=":"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+printf "%s\n" "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    RANLIB=$ac_ct_RANLIB
+  fi
+else
+  RANLIB="$ac_cv_prog_RANLIB"
+fi
+
+
+# Checks for header files.
+
+ac_header= ac_cache=
+for ac_item in $ac_header_c_list
+do
+  if test $ac_cache; then
+    ac_fn_c_check_header_compile "$LINENO" $ac_header ac_cv_header_$ac_cache "$ac_includes_default"
+    if eval test \"x\$ac_cv_header_$ac_cache\" = xyes; then
+      printf "%s\n" "#define $ac_item 1" >> confdefs.h
+    fi
+    ac_header= ac_cache=
+  elif test $ac_header; then
+    ac_cache=$ac_item
+  else
+    ac_header=$ac_item
+  fi
+done
+
+
+
+
+
+
+
+
+if test $ac_cv_header_stdlib_h = yes && test $ac_cv_header_string_h = yes
+then :
+
+printf "%s\n" "#define STDC_HEADERS 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "dlfcn.h" "ac_cv_header_dlfcn_h" "$ac_includes_default"
+if test "x$ac_cv_header_dlfcn_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_DLFCN_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "fcntl.h" "ac_cv_header_fcntl_h" "$ac_includes_default"
+if test "x$ac_cv_header_fcntl_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_FCNTL_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "float.h" "ac_cv_header_float_h" "$ac_includes_default"
+if test "x$ac_cv_header_float_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_FLOAT_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "limits.h" "ac_cv_header_limits_h" "$ac_includes_default"
+if test "x$ac_cv_header_limits_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_LIMITS_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "stddef.h" "ac_cv_header_stddef_h" "$ac_includes_default"
+if test "x$ac_cv_header_stddef_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_STDDEF_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "stdint.h" "ac_cv_header_stdint_h" "$ac_includes_default"
+if test "x$ac_cv_header_stdint_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_STDINT_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "stdlib.h" "ac_cv_header_stdlib_h" "$ac_includes_default"
+if test "x$ac_cv_header_stdlib_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_STDLIB_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "sys/param.h" "ac_cv_header_sys_param_h" "$ac_includes_default"
+if test "x$ac_cv_header_sys_param_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_SYS_PARAM_H 1" >>confdefs.h
+
+fi
+ac_fn_c_check_header_compile "$LINENO" "zlib.h" "ac_cv_header_zlib_h" "$ac_includes_default"
+if test "x$ac_cv_header_zlib_h" = xyes
+then :
+  printf "%s\n" "#define HAVE_ZLIB_H 1" >>confdefs.h
+
+fi
+
+ac_fn_c_check_type "$LINENO" "_Bool" "ac_cv_type__Bool" "$ac_includes_default"
+if test "x$ac_cv_type__Bool" = xyes
+then :
+
+printf "%s\n" "#define HAVE__BOOL 1" >>confdefs.h
+
+
+fi
+
+   { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for stdbool.h that conforms to C99" >&5
+printf %s "checking for stdbool.h that conforms to C99... " >&6; }
+if test ${ac_cv_header_stdbool_h+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <stdbool.h>
+
+             #ifndef __bool_true_false_are_defined
+               #error "__bool_true_false_are_defined is not defined"
+             #endif
+             char a[__bool_true_false_are_defined == 1 ? 1 : -1];
+
+             /* Regardless of whether this is C++ or "_Bool" is a
+                valid type name, "true" and "false" should be usable
+                in #if expressions and integer constant expressions,
+                and "bool" should be a valid type name.  */
+
+             #if !true
+               #error "'true' is not true"
+             #endif
+             #if true != 1
+               #error "'true' is not equal to 1"
+             #endif
+             char b[true == 1 ? 1 : -1];
+             char c[true];
+
+             #if false
+               #error "'false' is not false"
+             #endif
+             #if false != 0
+               #error "'false' is not equal to 0"
+             #endif
+             char d[false == 0 ? 1 : -1];
+
+             enum { e = false, f = true, g = false * true, h = true * 256 };
+
+             char i[(bool) 0.5 == true ? 1 : -1];
+             char j[(bool) 0.0 == false ? 1 : -1];
+             char k[sizeof (bool) > 0 ? 1 : -1];
+
+             struct sb { bool s: 1; bool t; } s;
+             char l[sizeof s.t > 0 ? 1 : -1];
+
+             /* The following fails for
+                HP aC++/ANSI C B3910B A.05.55 [Dec 04 2003]. */
+             bool m[h];
+             char n[sizeof m == h * sizeof m[0] ? 1 : -1];
+             char o[-1 - (bool) 0 < 0 ? 1 : -1];
+             /* Catch a bug in an HP-UX C compiler.  See
+         https://gcc.gnu.org/ml/gcc-patches/2003-12/msg02303.html
+         https://lists.gnu.org/archive/html/bug-coreutils/2005-11/msg00161.html
+              */
+             bool p = true;
+             bool *pp = &p;
+
+             /* C 1999 specifies that bool, true, and false are to be
+                macros, but C++ 2011 and later overrule this.  */
+             #if __cplusplus < 201103
+              #ifndef bool
+               #error "bool is not defined"
+              #endif
+              #ifndef false
+               #error "false is not defined"
+              #endif
+              #ifndef true
+               #error "true is not defined"
+              #endif
+             #endif
+
+             /* If _Bool is available, repeat with it all the tests
+                above that used bool.  */
+             #ifdef HAVE__BOOL
+               struct sB { _Bool s: 1; _Bool t; } t;
+
+               char q[(_Bool) 0.5 == true ? 1 : -1];
+               char r[(_Bool) 0.0 == false ? 1 : -1];
+               char u[sizeof (_Bool) > 0 ? 1 : -1];
+               char v[sizeof t.t > 0 ? 1 : -1];
+
+               _Bool w[h];
+               char x[sizeof m == h * sizeof m[0] ? 1 : -1];
+               char y[-1 - (_Bool) 0 < 0 ? 1 : -1];
+               _Bool z = true;
+               _Bool *pz = &p;
+             #endif
+
+int
+main (void)
+{
+
+             bool ps = &s;
+             *pp |= p;
+             *pp |= ! p;
+
+             #ifdef HAVE__BOOL
+               _Bool pt = &t;
+               *pz |= z;
+               *pz |= ! z;
+             #endif
+
+             /* Refer to every declared value, so they cannot be
+                discarded as unused.  */
+             return (!a + !b + !c + !d + !e + !f + !g + !h + !i + !j + !k
+                     + !l + !m + !n + !o + !p + !pp + !ps
+             #ifdef HAVE__BOOL
+                     + !q + !r + !u + !v + !w + !x + !y + !z + !pt
+             #endif
+                    );
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_header_stdbool_h=yes
+else $as_nop
+  ac_cv_header_stdbool_h=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdbool_h" >&5
+printf "%s\n" "$ac_cv_header_stdbool_h" >&6; }
+
+if test $ac_cv_header_stdbool_h = yes; then
+
+printf "%s\n" "#define HAVE_STDBOOL_H 1" >>confdefs.h
+
+fi
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for grep that handles long lines and -e" >&5
+printf %s "checking for grep that handles long lines and -e... " >&6; }
+if test ${ac_cv_path_GREP+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test -z "$GREP"; then
+  ac_path_GREP_found=false
+  # Loop through the user's path and test for each of PROGNAME-LIST
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_prog in grep ggrep
+   do
+    for ac_exec_ext in '' $ac_executable_extensions; do
+      ac_path_GREP="$as_dir$ac_prog$ac_exec_ext"
+      as_fn_executable_p "$ac_path_GREP" || continue
+# Check for GNU ac_path_GREP and select it if it is found.
+  # Check for GNU $ac_path_GREP
+case `"$ac_path_GREP" --version 2>&1` in
+*GNU*)
+  ac_cv_path_GREP="$ac_path_GREP" ac_path_GREP_found=:;;
+*)
+  ac_count=0
+  printf %s 0123456789 >"conftest.in"
+  while :
+  do
+    cat "conftest.in" "conftest.in" >"conftest.tmp"
+    mv "conftest.tmp" "conftest.in"
+    cp "conftest.in" "conftest.nl"
+    printf "%s\n" 'GREP' >> "conftest.nl"
+    "$ac_path_GREP" -e 'GREP$' -e '-(cannot match)-' < "conftest.nl" >"conftest.out" 2>/dev/null || break
+    diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
+    as_fn_arith $ac_count + 1 && ac_count=$as_val
+    if test $ac_count -gt ${ac_path_GREP_max-0}; then
+      # Best one so far, save it but keep looking for a better one
+      ac_cv_path_GREP="$ac_path_GREP"
+      ac_path_GREP_max=$ac_count
+    fi
+    # 10*(2^10) chars as input seems more than enough
+    test $ac_count -gt 10 && break
+  done
+  rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
+esac
+
+      $ac_path_GREP_found && break 3
+    done
+  done
+  done
+IFS=$as_save_IFS
+  if test -z "$ac_cv_path_GREP"; then
+    as_fn_error $? "no acceptable grep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
+  fi
+else
+  ac_cv_path_GREP=$GREP
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_GREP" >&5
+printf "%s\n" "$ac_cv_path_GREP" >&6; }
+ GREP="$ac_cv_path_GREP"
+
+
+# Autoupdate added the next two lines to ensure that your configure
+# script's behavior did not change.  They are probably safe to remove.
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for egrep" >&5
+printf %s "checking for egrep... " >&6; }
+if test ${ac_cv_path_EGREP+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if echo a | $GREP -E '(a|b)' >/dev/null 2>&1
+   then ac_cv_path_EGREP="$GREP -E"
+   else
+     if test -z "$EGREP"; then
+  ac_path_EGREP_found=false
+  # Loop through the user's path and test for each of PROGNAME-LIST
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    for ac_prog in egrep
+   do
+    for ac_exec_ext in '' $ac_executable_extensions; do
+      ac_path_EGREP="$as_dir$ac_prog$ac_exec_ext"
+      as_fn_executable_p "$ac_path_EGREP" || continue
+# Check for GNU ac_path_EGREP and select it if it is found.
+  # Check for GNU $ac_path_EGREP
+case `"$ac_path_EGREP" --version 2>&1` in
+*GNU*)
+  ac_cv_path_EGREP="$ac_path_EGREP" ac_path_EGREP_found=:;;
+*)
+  ac_count=0
+  printf %s 0123456789 >"conftest.in"
+  while :
+  do
+    cat "conftest.in" "conftest.in" >"conftest.tmp"
+    mv "conftest.tmp" "conftest.in"
+    cp "conftest.in" "conftest.nl"
+    printf "%s\n" 'EGREP' >> "conftest.nl"
+    "$ac_path_EGREP" 'EGREP$' < "conftest.nl" >"conftest.out" 2>/dev/null || break
+    diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
+    as_fn_arith $ac_count + 1 && ac_count=$as_val
+    if test $ac_count -gt ${ac_path_EGREP_max-0}; then
+      # Best one so far, save it but keep looking for a better one
+      ac_cv_path_EGREP="$ac_path_EGREP"
+      ac_path_EGREP_max=$ac_count
+    fi
+    # 10*(2^10) chars as input seems more than enough
+    test $ac_count -gt 10 && break
+  done
+  rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
+esac
+
+      $ac_path_EGREP_found && break 3
+    done
+  done
+  done
+IFS=$as_save_IFS
+  if test -z "$ac_cv_path_EGREP"; then
+    as_fn_error $? "no acceptable egrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
+  fi
+else
+  ac_cv_path_EGREP=$EGREP
+fi
+
+   fi
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_EGREP" >&5
+printf "%s\n" "$ac_cv_path_EGREP" >&6; }
+ EGREP="$ac_cv_path_EGREP"
+
+
+
+
+# Checks for library functions.
+ac_fn_c_check_func "$LINENO" "dup2" "ac_cv_func_dup2"
+if test "x$ac_cv_func_dup2" = xyes
+then :
+  printf "%s\n" "#define HAVE_DUP2 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "gethostname" "ac_cv_func_gethostname"
+if test "x$ac_cv_func_gethostname" = xyes
+then :
+  printf "%s\n" "#define HAVE_GETHOSTNAME 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "getopt_long" "ac_cv_func_getopt_long"
+if test "x$ac_cv_func_getopt_long" = xyes
+then :
+  printf "%s\n" "#define HAVE_GETOPT_LONG 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "getpagesize" "ac_cv_func_getpagesize"
+if test "x$ac_cv_func_getpagesize" = xyes
+then :
+  printf "%s\n" "#define HAVE_GETPAGESIZE 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "memset" "ac_cv_func_memset"
+if test "x$ac_cv_func_memset" = xyes
+then :
+  printf "%s\n" "#define HAVE_MEMSET 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "strdup" "ac_cv_func_strdup"
+if test "x$ac_cv_func_strdup" = xyes
+then :
+  printf "%s\n" "#define HAVE_STRDUP 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "strerror" "ac_cv_func_strerror"
+if test "x$ac_cv_func_strerror" = xyes
+then :
+  printf "%s\n" "#define HAVE_STRERROR 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "strtoul" "ac_cv_func_strtoul"
+if test "x$ac_cv_func_strtoul" = xyes
+then :
+  printf "%s\n" "#define HAVE_STRTOUL 1" >>confdefs.h
+
+fi
+
+
+  ac_fn_c_check_type "$LINENO" "pid_t" "ac_cv_type_pid_t" "$ac_includes_default
+"
+if test "x$ac_cv_type_pid_t" = xyes
+then :
+
+else $as_nop
+                                          cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+          #if defined _WIN64 && !defined __CYGWIN__
+          LLP64
+          #endif
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_pid_type='int'
+else $as_nop
+  ac_pid_type='__int64'
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+
+printf "%s\n" "#define pid_t $ac_pid_type" >>confdefs.h
+
+
+fi
+
+
+
+ac_func=
+for ac_item in $ac_func_c_list
+do
+  if test $ac_func; then
+    ac_fn_c_check_func "$LINENO" $ac_func ac_cv_func_$ac_func
+    if eval test \"x\$ac_cv_func_$ac_func\" = xyes; then
+      echo "#define $ac_item 1" >> confdefs.h
+    fi
+    ac_func=
+  else
+    ac_func=$ac_item
+  fi
+done
+
+
+
+if test "x$ac_cv_func_fork" = xyes; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for working fork" >&5
+printf %s "checking for working fork... " >&6; }
+if test ${ac_cv_func_fork_works+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test "$cross_compiling" = yes
+then :
+  ac_cv_func_fork_works=cross
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+int
+main (void)
+{
+
+	  /* By Ruediger Kuhlmann. */
+	  return fork () < 0;
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"
+then :
+  ac_cv_func_fork_works=yes
+else $as_nop
+  ac_cv_func_fork_works=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_fork_works" >&5
+printf "%s\n" "$ac_cv_func_fork_works" >&6; }
+
+else
+  ac_cv_func_fork_works=$ac_cv_func_fork
+fi
+if test "x$ac_cv_func_fork_works" = xcross; then
+  case $host in
+    *-*-amigaos* | *-*-msdosdjgpp*)
+      # Override, as these systems have only a dummy fork() stub
+      ac_cv_func_fork_works=no
+      ;;
+    *)
+      ac_cv_func_fork_works=yes
+      ;;
+  esac
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: result $ac_cv_func_fork_works guessed because of cross compilation" >&5
+printf "%s\n" "$as_me: WARNING: result $ac_cv_func_fork_works guessed because of cross compilation" >&2;}
+fi
+ac_cv_func_vfork_works=$ac_cv_func_vfork
+if test "x$ac_cv_func_vfork" = xyes; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for working vfork" >&5
+printf %s "checking for working vfork... " >&6; }
+if test ${ac_cv_func_vfork_works+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test "$cross_compiling" = yes
+then :
+  ac_cv_func_vfork_works=cross
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+/* Thanks to Paul Eggert for this test.  */
+$ac_includes_default
+#include <signal.h>
+#include <sys/wait.h>
+#ifdef HAVE_VFORK_H
+# include <vfork.h>
+#endif
+
+static void
+do_nothing (int sig)
+{
+  (void) sig;
+}
+
+/* On some sparc systems, changes by the child to local and incoming
+   argument registers are propagated back to the parent.  The compiler
+   is told about this with #include <vfork.h>, but some compilers
+   (e.g. gcc -O) don't grok <vfork.h>.  Test for this by using a
+   static variable whose address is put into a register that is
+   clobbered by the vfork.  */
+static void
+sparc_address_test (int arg)
+{
+  static pid_t child;
+  if (!child) {
+    child = vfork ();
+    if (child < 0) {
+      perror ("vfork");
+      _exit(2);
+    }
+    if (!child) {
+      arg = getpid();
+      write(-1, "", 0);
+      _exit (arg);
+    }
+  }
+}
+
+int
+main (void)
+{
+  pid_t parent = getpid ();
+  pid_t child;
+
+  sparc_address_test (0);
+
+  /* On Solaris 2.4, changes by the child to the signal handler
+     also munge signal handlers in the parent.  To detect this,
+     start by putting the parent's handler in a known state.  */
+  signal (SIGTERM, SIG_DFL);
+
+  child = vfork ();
+
+  if (child == 0) {
+    /* Here is another test for sparc vfork register problems.  This
+       test uses lots of local variables, at least as many local
+       variables as main has allocated so far including compiler
+       temporaries.  4 locals are enough for gcc 1.40.3 on a Solaris
+       4.1.3 sparc, but we use 8 to be safe.  A buggy compiler should
+       reuse the register of parent for one of the local variables,
+       since it will think that parent can't possibly be used any more
+       in this routine.  Assigning to the local variable will thus
+       munge parent in the parent process.  */
+    pid_t
+      p = getpid(), p1 = getpid(), p2 = getpid(), p3 = getpid(),
+      p4 = getpid(), p5 = getpid(), p6 = getpid(), p7 = getpid();
+    /* Convince the compiler that p..p7 are live; otherwise, it might
+       use the same hardware register for all 8 local variables.  */
+    if (p != p1 || p != p2 || p != p3 || p != p4
+	|| p != p5 || p != p6 || p != p7)
+      _exit(1);
+
+    /* Alter the child's signal handler.  */
+    if (signal (SIGTERM, do_nothing) != SIG_DFL)
+      _exit(1);
+
+    /* On some systems (e.g. IRIX 3.3), vfork doesn't separate parent
+       from child file descriptors.  If the child closes a descriptor
+       before it execs or exits, this munges the parent's descriptor
+       as well.  Test for this by closing stdout in the child.  */
+    _exit(close(fileno(stdout)) != 0);
+  } else {
+    int status;
+    struct stat st;
+
+    while (wait(&status) != child)
+      ;
+    return (
+	 /* Was there some problem with vforking?  */
+	 child < 0
+
+	 /* Did the child munge the parent's signal handler?  */
+	 || signal (SIGTERM, SIG_DFL) != SIG_DFL
+
+	 /* Did the child fail?  (This shouldn't happen.)  */
+	 || status
+
+	 /* Did the vfork/compiler bug occur?  */
+	 || parent != getpid()
+
+	 /* Did the file descriptor bug occur?  */
+	 || fstat(fileno(stdout), &st) != 0
+	 );
+  }
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"
+then :
+  ac_cv_func_vfork_works=yes
+else $as_nop
+  ac_cv_func_vfork_works=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_vfork_works" >&5
+printf "%s\n" "$ac_cv_func_vfork_works" >&6; }
+
+fi;
+if test "x$ac_cv_func_fork_works" = xcross; then
+  ac_cv_func_vfork_works=$ac_cv_func_vfork
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: result $ac_cv_func_vfork_works guessed because of cross compilation" >&5
+printf "%s\n" "$as_me: WARNING: result $ac_cv_func_vfork_works guessed because of cross compilation" >&2;}
+fi
+
+if test "x$ac_cv_func_vfork_works" = xyes; then
+
+printf "%s\n" "#define HAVE_WORKING_VFORK 1" >>confdefs.h
+
+else
+
+printf "%s\n" "#define vfork fork" >>confdefs.h
+
+fi
+if test "x$ac_cv_func_fork_works" = xyes; then
+
+printf "%s\n" "#define HAVE_WORKING_FORK 1" >>confdefs.h
+
+fi
+
+
+
+  # Make sure we can run config.sub.
+$SHELL "${ac_aux_dir}config.sub" sun4 >/dev/null 2>&1 ||
+  as_fn_error $? "cannot run $SHELL ${ac_aux_dir}config.sub" "$LINENO" 5
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking build system type" >&5
+printf %s "checking build system type... " >&6; }
+if test ${ac_cv_build+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_build_alias=$build_alias
+test "x$ac_build_alias" = x &&
+  ac_build_alias=`$SHELL "${ac_aux_dir}config.guess"`
+test "x$ac_build_alias" = x &&
+  as_fn_error $? "cannot guess build type; you must specify one" "$LINENO" 5
+ac_cv_build=`$SHELL "${ac_aux_dir}config.sub" $ac_build_alias` ||
+  as_fn_error $? "$SHELL ${ac_aux_dir}config.sub $ac_build_alias failed" "$LINENO" 5
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_build" >&5
+printf "%s\n" "$ac_cv_build" >&6; }
+case $ac_cv_build in
+*-*-*) ;;
+*) as_fn_error $? "invalid value of canonical build" "$LINENO" 5;;
+esac
+build=$ac_cv_build
+ac_save_IFS=$IFS; IFS='-'
+set x $ac_cv_build
+shift
+build_cpu=$1
+build_vendor=$2
+shift; shift
+# Remember, the first character of IFS is used to create $*,
+# except with old shells:
+build_os=$*
+IFS=$ac_save_IFS
+case $build_os in *\ *) build_os=`echo "$build_os" | sed 's/ /-/g'`;; esac
+
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking host system type" >&5
+printf %s "checking host system type... " >&6; }
+if test ${ac_cv_host+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test "x$host_alias" = x; then
+  ac_cv_host=$ac_cv_build
+else
+  ac_cv_host=`$SHELL "${ac_aux_dir}config.sub" $host_alias` ||
+    as_fn_error $? "$SHELL ${ac_aux_dir}config.sub $host_alias failed" "$LINENO" 5
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_host" >&5
+printf "%s\n" "$ac_cv_host" >&6; }
+case $ac_cv_host in
+*-*-*) ;;
+*) as_fn_error $? "invalid value of canonical host" "$LINENO" 5;;
+esac
+host=$ac_cv_host
+ac_save_IFS=$IFS; IFS='-'
+set x $ac_cv_host
+shift
+host_cpu=$1
+host_vendor=$2
+shift; shift
+# Remember, the first character of IFS is used to create $*,
+# except with old shells:
+host_os=$*
+IFS=$ac_save_IFS
+case $host_os in *\ *) host_os=`echo "$host_os" | sed 's/ /-/g'`;; esac
+
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for GNU libc compatible malloc" >&5
+printf %s "checking for GNU libc compatible malloc... " >&6; }
+if test ${ac_cv_func_malloc_0_nonnull+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test "$cross_compiling" = yes
+then :
+  case "$host_os" in # ((
+		  # Guess yes on platforms where we know the result.
+		  *-gnu* | freebsd* | netbsd* | openbsd* | bitrig* \
+		  | hpux* | solaris* | cygwin* | mingw* | msys* )
+		    ac_cv_func_malloc_0_nonnull=yes ;;
+		  # If we don't know, assume the worst.
+		  *) ac_cv_func_malloc_0_nonnull=no ;;
+		esac
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <stdlib.h>
+
+int
+main (void)
+{
+void *p = malloc (0);
+		   int result = !p;
+		   free (p);
+		   return result;
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"
+then :
+  ac_cv_func_malloc_0_nonnull=yes
+else $as_nop
+  ac_cv_func_malloc_0_nonnull=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_malloc_0_nonnull" >&5
+printf "%s\n" "$ac_cv_func_malloc_0_nonnull" >&6; }
+if test $ac_cv_func_malloc_0_nonnull = yes
+then :
+
+printf "%s\n" "#define HAVE_MALLOC 1" >>confdefs.h
+
+else $as_nop
+  printf "%s\n" "#define HAVE_MALLOC 0" >>confdefs.h
+
+   case " $LIBOBJS " in
+  *" malloc.$ac_objext "* ) ;;
+  *) LIBOBJS="$LIBOBJS malloc.$ac_objext"
+ ;;
+esac
+
+
+printf "%s\n" "#define malloc rpl_malloc" >>confdefs.h
+
+fi
+
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for working memcmp" >&5
+printf %s "checking for working memcmp... " >&6; }
+if test ${ac_cv_func_memcmp_working+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test "$cross_compiling" = yes
+then :
+  ac_cv_func_memcmp_working=no
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+int
+main (void)
+{
+
+  /* Some versions of memcmp are not 8-bit clean.  */
+  char c0 = '\100', c1 = '\200', c2 = '\201';
+  if (memcmp(&c0, &c2, 1) >= 0 || memcmp(&c1, &c2, 1) >= 0)
+    return 1;
+
+  /* The Next x86 OpenStep bug shows up only when comparing 16 bytes
+     or more and with at least one buffer not starting on a 4-byte boundary.
+     William Lewis provided this test program.   */
+  {
+    char foo[21];
+    char bar[21];
+    int i;
+    for (i = 0; i < 4; i++)
+      {
+	char *a = foo + i;
+	char *b = bar + i;
+	strcpy (a, "--------01111111");
+	strcpy (b, "--------10000000");
+	if (memcmp (a, b, 16) >= 0)
+	  return 1;
+      }
+    return 0;
+  }
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"
+then :
+  ac_cv_func_memcmp_working=yes
+else $as_nop
+  ac_cv_func_memcmp_working=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_memcmp_working" >&5
+printf "%s\n" "$ac_cv_func_memcmp_working" >&6; }
+test $ac_cv_func_memcmp_working = no && case " $LIBOBJS " in
+  *" memcmp.$ac_objext "* ) ;;
+  *) LIBOBJS="$LIBOBJS memcmp.$ac_objext"
+ ;;
+esac
+
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for GNU libc compatible realloc" >&5
+printf %s "checking for GNU libc compatible realloc... " >&6; }
+if test ${ac_cv_func_realloc_0_nonnull+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  if test "$cross_compiling" = yes
+then :
+  case "$host_os" in # ((
+		  # Guess yes on platforms where we know the result.
+		  *-gnu* | freebsd* | netbsd* | openbsd* | bitrig* \
+		  | hpux* | solaris* | cygwin* | mingw* | msys* )
+		    ac_cv_func_realloc_0_nonnull=yes ;;
+		  # If we don't know, assume the worst.
+		  *) ac_cv_func_realloc_0_nonnull=no ;;
+		esac
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <stdlib.h>
+
+int
+main (void)
+{
+void *p = realloc (0, 0);
+		   int result = !p;
+		   free (p);
+		   return result;
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"
+then :
+  ac_cv_func_realloc_0_nonnull=yes
+else $as_nop
+  ac_cv_func_realloc_0_nonnull=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_realloc_0_nonnull" >&5
+printf "%s\n" "$ac_cv_func_realloc_0_nonnull" >&6; }
+if test $ac_cv_func_realloc_0_nonnull = yes
+then :
+
+printf "%s\n" "#define HAVE_REALLOC 1" >>confdefs.h
+
+else $as_nop
+  printf "%s\n" "#define HAVE_REALLOC 0" >>confdefs.h
+
+   case " $LIBOBJS " in
+  *" realloc.$ac_objext "* ) ;;
+  *) LIBOBJS="$LIBOBJS realloc.$ac_objext"
+ ;;
+esac
+
+
+printf "%s\n" "#define realloc rpl_realloc" >>confdefs.h
+
+fi
+
+
+if test ${ac_cv_func_setvbuf_reversed+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_func_setvbuf_reversed=no
+fi
+
+
+
+
+if test "x$ac_cv_func_vprintf" = xno
+then :
+  ac_fn_c_check_func "$LINENO" "_doprnt" "ac_cv_func__doprnt"
+if test "x$ac_cv_func__doprnt" = xyes
+then :
+
+printf "%s\n" "#define HAVE_DOPRNT 1" >>confdefs.h
+
+fi
+
+fi
+
+# Checks for typedefs, structures, and compiler characteristics.
+ { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking whether byte ordering is bigendian" >&5
+printf %s "checking whether byte ordering is bigendian... " >&6; }
+if test ${ac_cv_c_bigendian+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_c_bigendian=unknown
+    # See if we're dealing with a universal compiler.
+    cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#ifndef __APPLE_CC__
+	       not a universal capable compiler
+	     #endif
+	     typedef int dummy;
+
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+
+	# Check for potential -arch flags.  It is not universal unless
+	# there are at least two -arch flags with different values.
+	ac_arch=
+	ac_prev=
+	for ac_word in $CC $CFLAGS $CPPFLAGS $LDFLAGS; do
+	 if test -n "$ac_prev"; then
+	   case $ac_word in
+	     i?86 | x86_64 | ppc | ppc64)
+	       if test -z "$ac_arch" || test "$ac_arch" = "$ac_word"; then
+		 ac_arch=$ac_word
+	       else
+		 ac_cv_c_bigendian=universal
+		 break
+	       fi
+	       ;;
+	   esac
+	   ac_prev=
+	 elif test "x$ac_word" = "x-arch"; then
+	   ac_prev=arch
+	 fi
+       done
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+    if test $ac_cv_c_bigendian = unknown; then
+      # See if sys/param.h defines the BYTE_ORDER macro.
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <sys/types.h>
+	     #include <sys/param.h>
+
+int
+main (void)
+{
+#if ! (defined BYTE_ORDER && defined BIG_ENDIAN \
+		     && defined LITTLE_ENDIAN && BYTE_ORDER && BIG_ENDIAN \
+		     && LITTLE_ENDIAN)
+	      bogus endian macros
+	     #endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  # It does; now see whether it defined to BIG_ENDIAN or not.
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <sys/types.h>
+		#include <sys/param.h>
+
+int
+main (void)
+{
+#if BYTE_ORDER != BIG_ENDIAN
+		 not big endian
+		#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_c_bigendian=yes
+else $as_nop
+  ac_cv_c_bigendian=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+    fi
+    if test $ac_cv_c_bigendian = unknown; then
+      # See if <limits.h> defines _LITTLE_ENDIAN or _BIG_ENDIAN (e.g., Solaris).
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <limits.h>
+
+int
+main (void)
+{
+#if ! (defined _LITTLE_ENDIAN || defined _BIG_ENDIAN)
+	      bogus endian macros
+	     #endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  # It does; now see whether it defined to _BIG_ENDIAN or not.
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <limits.h>
+
+int
+main (void)
+{
+#ifndef _BIG_ENDIAN
+		 not big endian
+		#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_c_bigendian=yes
+else $as_nop
+  ac_cv_c_bigendian=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+    fi
+    if test $ac_cv_c_bigendian = unknown; then
+      # Compile a test program.
+      if test "$cross_compiling" = yes
+then :
+  # Try to guess by grepping values from an object file.
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+unsigned short int ascii_mm[] =
+		  { 0x4249, 0x4765, 0x6E44, 0x6961, 0x6E53, 0x7953, 0 };
+		unsigned short int ascii_ii[] =
+		  { 0x694C, 0x5454, 0x656C, 0x6E45, 0x6944, 0x6E61, 0 };
+		int use_ascii (int i) {
+		  return ascii_mm[i] + ascii_ii[i];
+		}
+		unsigned short int ebcdic_ii[] =
+		  { 0x89D3, 0xE3E3, 0x8593, 0x95C5, 0x89C4, 0x9581, 0 };
+		unsigned short int ebcdic_mm[] =
+		  { 0xC2C9, 0xC785, 0x95C4, 0x8981, 0x95E2, 0xA8E2, 0 };
+		int use_ebcdic (int i) {
+		  return ebcdic_mm[i] + ebcdic_ii[i];
+		}
+		extern int foo;
+
+int
+main (void)
+{
+return use_ascii (foo) == use_ebcdic (foo);
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  if grep BIGenDianSyS conftest.$ac_objext >/dev/null; then
+	      ac_cv_c_bigendian=yes
+	    fi
+	    if grep LiTTleEnDian conftest.$ac_objext >/dev/null ; then
+	      if test "$ac_cv_c_bigendian" = unknown; then
+		ac_cv_c_bigendian=no
+	      else
+		# finding both strings is unlikely to happen, but who knows?
+		ac_cv_c_bigendian=unknown
+	      fi
+	    fi
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+int
+main (void)
+{
+
+	     /* Are we little or big endian?  From Harbison&Steele.  */
+	     union
+	     {
+	       long int l;
+	       char c[sizeof (long int)];
+	     } u;
+	     u.l = 1;
+	     return u.c[sizeof (long int) - 1] == 1;
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"
+then :
+  ac_cv_c_bigendian=no
+else $as_nop
+  ac_cv_c_bigendian=yes
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+    fi
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_bigendian" >&5
+printf "%s\n" "$ac_cv_c_bigendian" >&6; }
+ case $ac_cv_c_bigendian in #(
+   yes)
+     printf "%s\n" "#define WORDS_BIGENDIAN 1" >>confdefs.h
+;; #(
+   no)
+      ;; #(
+   universal)
+
+printf "%s\n" "#define AC_APPLE_UNIVERSAL_BUILD 1" >>confdefs.h
+
+     ;; #(
+   *)
+     as_fn_error $? "unknown endianness
+ presetting ac_cv_c_bigendian=no (or yes) will help" "$LINENO" 5 ;;
+ esac
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for an ANSI C-conforming const" >&5
+printf %s "checking for an ANSI C-conforming const... " >&6; }
+if test ${ac_cv_c_const+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main (void)
+{
+
+#ifndef __cplusplus
+  /* Ultrix mips cc rejects this sort of thing.  */
+  typedef int charset[2];
+  const charset cs = { 0, 0 };
+  /* SunOS 4.1.1 cc rejects this.  */
+  char const *const *pcpcc;
+  char **ppc;
+  /* NEC SVR4.0.2 mips cc rejects this.  */
+  struct point {int x, y;};
+  static struct point const zero = {0,0};
+  /* IBM XL C 1.02.0.0 rejects this.
+     It does not let you subtract one const X* pointer from another in
+     an arm of an if-expression whose if-part is not a constant
+     expression */
+  const char *g = "string";
+  pcpcc = &g + (g ? g-g : 0);
+  /* HPUX 7.0 cc rejects these. */
+  ++pcpcc;
+  ppc = (char**) pcpcc;
+  pcpcc = (char const *const *) ppc;
+  { /* SCO 3.2v4 cc rejects this sort of thing.  */
+    char tx;
+    char *t = &tx;
+    char const *s = 0 ? (char *) 0 : (char const *) 0;
+
+    *t++ = 0;
+    if (s) return 0;
+  }
+  { /* Someone thinks the Sun supposedly-ANSI compiler will reject this.  */
+    int x[] = {25, 17};
+    const int *foo = &x[0];
+    ++foo;
+  }
+  { /* Sun SC1.0 ANSI compiler rejects this -- but not the above. */
+    typedef const int *iptr;
+    iptr p = 0;
+    ++p;
+  }
+  { /* IBM XL C 1.02.0.0 rejects this sort of thing, saying
+       "k.c", line 2.27: 1506-025 (S) Operand must be a modifiable lvalue. */
+    struct s { int j; const int *ap[3]; } bx;
+    struct s *b = &bx; b->j = 5;
+  }
+  { /* ULTRIX-32 V3.1 (Rev 9) vcc rejects this */
+    const int foo = 10;
+    if (!foo) return 0;
+  }
+  return !cs[0] && !zero.x;
+#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_c_const=yes
+else $as_nop
+  ac_cv_c_const=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_const" >&5
+printf "%s\n" "$ac_cv_c_const" >&6; }
+if test $ac_cv_c_const = no; then
+
+printf "%s\n" "#define const /**/" >>confdefs.h
+
+fi
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for inline" >&5
+printf %s "checking for inline... " >&6; }
+if test ${ac_cv_c_inline+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_c_inline=no
+for ac_kw in inline __inline__ __inline; do
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#ifndef __cplusplus
+typedef int foo_t;
+static $ac_kw foo_t static_foo (void) {return 0; }
+$ac_kw foo_t foo (void) {return 0; }
+#endif
+
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_cv_c_inline=$ac_kw
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+  test "$ac_cv_c_inline" != no && break
+done
+
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_inline" >&5
+printf "%s\n" "$ac_cv_c_inline" >&6; }
+
+case $ac_cv_c_inline in
+  inline | yes) ;;
+  *)
+    case $ac_cv_c_inline in
+      no) ac_val=;;
+      *) ac_val=$ac_cv_c_inline;;
+    esac
+    cat >>confdefs.h <<_ACEOF
+#ifndef __cplusplus
+#define inline $ac_val
+#endif
+_ACEOF
+    ;;
+esac
+
+ac_fn_c_check_type "$LINENO" "ptrdiff_t" "ac_cv_type_ptrdiff_t" "$ac_includes_default"
+if test "x$ac_cv_type_ptrdiff_t" = xyes
+then :
+
+printf "%s\n" "#define HAVE_PTRDIFF_T 1" >>confdefs.h
+
+
+fi
+
+ac_fn_c_check_type "$LINENO" "mode_t" "ac_cv_type_mode_t" "$ac_includes_default"
+if test "x$ac_cv_type_mode_t" = xyes
+then :
+
+else $as_nop
+
+printf "%s\n" "#define mode_t int" >>confdefs.h
+
+fi
+
+
+  ac_fn_c_check_type "$LINENO" "pid_t" "ac_cv_type_pid_t" "$ac_includes_default
+"
+if test "x$ac_cv_type_pid_t" = xyes
+then :
+
+else $as_nop
+                                          cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+          #if defined _WIN64 && !defined __CYGWIN__
+          LLP64
+          #endif
+
+int
+main (void)
+{
+
+  ;
+  return 0;
+}
+
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"
+then :
+  ac_pid_type='int'
+else $as_nop
+  ac_pid_type='__int64'
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+
+printf "%s\n" "#define pid_t $ac_pid_type" >>confdefs.h
+
+
+fi
+
+
+ac_fn_c_check_type "$LINENO" "size_t" "ac_cv_type_size_t" "$ac_includes_default"
+if test "x$ac_cv_type_size_t" = xyes
+then :
+
+else $as_nop
+
+printf "%s\n" "#define size_t unsigned int" >>confdefs.h
+
+fi
+
+ac_fn_c_check_type "$LINENO" "ssize_t" "ac_cv_type_ssize_t" "$ac_includes_default"
+if test "x$ac_cv_type_ssize_t" = xyes
+then :
+
+else $as_nop
+
+printf "%s\n" "#define ssize_t int" >>confdefs.h
+
+fi
+
+ac_fn_c_find_intX_t "$LINENO" "64" "ac_cv_c_int64_t"
+case $ac_cv_c_int64_t in #(
+  no|yes) ;; #(
+  *)
+
+printf "%s\n" "#define int64_t $ac_cv_c_int64_t" >>confdefs.h
+;;
+esac
+
+ac_fn_c_find_uintX_t "$LINENO" "8" "ac_cv_c_uint8_t"
+case $ac_cv_c_uint8_t in #(
+  no|yes) ;; #(
+  *)
+
+printf "%s\n" "#define _UINT8_T 1" >>confdefs.h
+
+
+printf "%s\n" "#define uint8_t $ac_cv_c_uint8_t" >>confdefs.h
+;;
+  esac
+
+ac_fn_c_find_uintX_t "$LINENO" "16" "ac_cv_c_uint16_t"
+case $ac_cv_c_uint16_t in #(
+  no|yes) ;; #(
+  *)
+
+
+printf "%s\n" "#define uint16_t $ac_cv_c_uint16_t" >>confdefs.h
+;;
+  esac
+
+ac_fn_c_find_uintX_t "$LINENO" "32" "ac_cv_c_uint32_t"
+case $ac_cv_c_uint32_t in #(
+  no|yes) ;; #(
+  *)
+
+printf "%s\n" "#define _UINT32_T 1" >>confdefs.h
+
+
+printf "%s\n" "#define uint32_t $ac_cv_c_uint32_t" >>confdefs.h
+;;
+  esac
+
+ac_fn_c_find_uintX_t "$LINENO" "64" "ac_cv_c_uint64_t"
+case $ac_cv_c_uint64_t in #(
+  no|yes) ;; #(
+  *)
+
+printf "%s\n" "#define _UINT64_T 1" >>confdefs.h
+
+
+printf "%s\n" "#define uint64_t $ac_cv_c_uint64_t" >>confdefs.h
+;;
+  esac
+
+
+# Check for the math library.
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for sqrt in -lm" >&5
+printf %s "checking for sqrt in -lm... " >&6; }
+if test ${ac_cv_lib_m_sqrt+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_check_lib_save_LIBS=$LIBS
+LIBS="-lm  $LIBS"
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+/* Override any GCC internal prototype to avoid an error.
+   Use char because int might match the return type of a GCC
+   builtin and then its argument prototype would still apply.  */
+char sqrt ();
+int
+main (void)
+{
+return sqrt ();
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"
+then :
+  ac_cv_lib_m_sqrt=yes
+else $as_nop
+  ac_cv_lib_m_sqrt=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam \
+    conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_m_sqrt" >&5
+printf "%s\n" "$ac_cv_lib_m_sqrt" >&6; }
+if test "x$ac_cv_lib_m_sqrt" = xyes
+then :
+  printf "%s\n" "#define HAVE_LIBM 1" >>confdefs.h
+
+  LIBS="-lm $LIBS"
+
+fi
+
+ac_fn_c_check_func "$LINENO" "pow" "ac_cv_func_pow"
+if test "x$ac_cv_func_pow" = xyes
+then :
+  printf "%s\n" "#define HAVE_POW 1" >>confdefs.h
+
+fi
+ac_fn_c_check_func "$LINENO" "sqrt" "ac_cv_func_sqrt"
+if test "x$ac_cv_func_sqrt" = xyes
+then :
+  printf "%s\n" "#define HAVE_SQRT 1" >>confdefs.h
+
+fi
+
+ac_fn_c_check_func "$LINENO" "ceilf" "ac_cv_func_ceilf"
+if test "x$ac_cv_func_ceilf" = xyes
+then :
+
+else $as_nop
+
+printf "%s\n" "#define ceilf ceil" >>confdefs.h
+
+fi
+
+
+# Check for the dynamic linking library.
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for dlsym in -ldl" >&5
+printf %s "checking for dlsym in -ldl... " >&6; }
+if test ${ac_cv_lib_dl_dlsym+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_check_lib_save_LIBS=$LIBS
+LIBS="-ldl  $LIBS"
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+/* Override any GCC internal prototype to avoid an error.
+   Use char because int might match the return type of a GCC
+   builtin and then its argument prototype would still apply.  */
+char dlsym ();
+int
+main (void)
+{
+return dlsym ();
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"
+then :
+  ac_cv_lib_dl_dlsym=yes
+else $as_nop
+  ac_cv_lib_dl_dlsym=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam \
+    conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dl_dlsym" >&5
+printf "%s\n" "$ac_cv_lib_dl_dlsym" >&6; }
+if test "x$ac_cv_lib_dl_dlsym" = xyes
+then :
+  printf "%s\n" "#define HAVE_LIBDL 1" >>confdefs.h
+
+  LIBS="-ldl $LIBS"
+
+fi
+
+
+# zlib (optional)
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for gzwrite in -lz" >&5
+printf %s "checking for gzwrite in -lz... " >&6; }
+if test ${ac_cv_lib_z_gzwrite+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_check_lib_save_LIBS=$LIBS
+LIBS="-lz  $LIBS"
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+/* Override any GCC internal prototype to avoid an error.
+   Use char because int might match the return type of a GCC
+   builtin and then its argument prototype would still apply.  */
+char gzwrite ();
+int
+main (void)
+{
+return gzwrite ();
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"
+then :
+  ac_cv_lib_z_gzwrite=yes
+else $as_nop
+  ac_cv_lib_z_gzwrite=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam \
+    conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_z_gzwrite" >&5
+printf "%s\n" "$ac_cv_lib_z_gzwrite" >&6; }
+if test "x$ac_cv_lib_z_gzwrite" = xyes
+then :
+  printf "%s\n" "#define HAVE_LIBZ 1" >>confdefs.h
+
+  LIBS="-lz $LIBS"
+
+fi
+
+ if test $ac_cv_header_zlib_h = yes -a $ac_cv_lib_z_gzwrite = yes; then
+  HAVE_LIBZ_TRUE=
+  HAVE_LIBZ_FALSE='#'
+else
+  HAVE_LIBZ_TRUE='#'
+  HAVE_LIBZ_FALSE=
+fi
+
+
+# Check for OpenMP.
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+
+if test -e penmp || test -e mp; then
+  as_fn_error $? "AC_OPENMP clobbers files named 'mp' and 'penmp'. Aborting configure because one of these files already exists." "$LINENO" 5
+fi
+
+# Check whether --enable-openmp was given.
+if test ${enable_openmp+y}
+then :
+  enableval=$enable_openmp;
+fi
+
+  OPENMP_CXXFLAGS=
+  if test "$enable_openmp" != no; then
+    { printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking for $CXX option to support OpenMP" >&5
+printf %s "checking for $CXX option to support OpenMP... " >&6; }
+if test ${ac_cv_prog_cxx_openmp+y}
+then :
+  printf %s "(cached) " >&6
+else $as_nop
+  ac_cv_prog_cxx_openmp='not found'
+                                                                        for ac_option in '' -fopenmp -xopenmp -openmp -mp -omp -qsmp=omp -homp \
+                       -Popenmp --openmp; do
+
+        ac_save_CXXFLAGS=$CXXFLAGS
+        CXXFLAGS="$CXXFLAGS $ac_option"
+        cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+#ifndef _OPENMP
+#error "OpenMP not supported"
+#endif
+#include <omp.h>
+int main (void) { return omp_get_num_threads (); }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"
+then :
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+#ifndef _OPENMP
+#error "OpenMP not supported"
+#endif
+#include <omp.h>
+int main (void) { return omp_get_num_threads (); }
+
+_ACEOF
+if ac_fn_cxx_try_link "$LINENO"
+then :
+  ac_cv_prog_cxx_openmp=$ac_option
+else $as_nop
+  ac_cv_prog_cxx_openmp='unsupported'
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam \
+    conftest$ac_exeext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.beam conftest.$ac_ext
+        CXXFLAGS=$ac_save_CXXFLAGS
+
+        if test "$ac_cv_prog_cxx_openmp" != 'not found'; then
+          break
+        fi
+      done
+      if test "$ac_cv_prog_cxx_openmp" = 'not found'; then
+        ac_cv_prog_cxx_openmp='unsupported'
+      elif test "$ac_cv_prog_cxx_openmp" = ''; then
+        ac_cv_prog_cxx_openmp='none needed'
+      fi
+                        rm -f penmp mp
+fi
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_openmp" >&5
+printf "%s\n" "$ac_cv_prog_cxx_openmp" >&6; }
+    if test "$ac_cv_prog_cxx_openmp" != 'unsupported' && \
+       test "$ac_cv_prog_cxx_openmp" != 'none needed'; then
+      OPENMP_CXXFLAGS="$ac_cv_prog_cxx_openmp"
+    fi
+  fi
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+# Find the absolute path to the source.
+my_abs_srcdir=$(cd $srcdir; pwd)
+
+# Set compiler flags
+CPPFLAGS="-I$my_abs_srcdir $OPENMP_CXXFLAGS $CPPFLAGS"
+
+LDFLAGS="$OPENMP_CXXFLAGS $LDFLAGS"
+
+
+AM_CXXFLAGS='-Wall -Wextra -Werror'
+
+
+
+ac_config_files="$ac_config_files Makefile unittest/Makefile vendor/Makefile"
+
+cat >confcache <<\_ACEOF
+# This file is a shell script that caches the results of configure
+# tests run on this system so they can be shared between configure
+# scripts and configure runs, see configure's option --config-cache.
+# It is not useful on other systems.  If it contains results you don't
+# want to keep, you may remove or edit it.
+#
+# config.status only pays attention to the cache file if you give it
+# the --recheck option to rerun configure.
+#
+# `ac_cv_env_foo' variables (set or unset) will be overridden when
+# loading this file, other *unset* `ac_cv_foo' will be assigned the
+# following values.
+
+_ACEOF
+
+# The following way of writing the cache mishandles newlines in values,
+# but we know of no workaround that is simple, portable, and efficient.
+# So, we kill variables containing newlines.
+# Ultrix sh set writes to stderr and can't be redirected directly,
+# and sets the high bit in the cache file unless we assign to the vars.
+(
+  for ac_var in `(set) 2>&1 | sed -n 's/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'`; do
+    eval ac_val=\$$ac_var
+    case $ac_val in #(
+    *${as_nl}*)
+      case $ac_var in #(
+      *_cv_*) { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
+printf "%s\n" "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
+      esac
+      case $ac_var in #(
+      _ | IFS | as_nl) ;; #(
+      BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
+      *) { eval $ac_var=; unset $ac_var;} ;;
+      esac ;;
+    esac
+  done
+
+  (set) 2>&1 |
+    case $as_nl`(ac_space=' '; set) 2>&1` in #(
+    *${as_nl}ac_space=\ *)
+      # `set' does not quote correctly, so add quotes: double-quote
+      # substitution turns \\\\ into \\, and sed turns \\ into \.
+      sed -n \
+	"s/'/'\\\\''/g;
+	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p"
+      ;; #(
+    *)
+      # `set' quotes correctly as required by POSIX, so do not add quotes.
+      sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
+      ;;
+    esac |
+    sort
+) |
+  sed '
+     /^ac_cv_env_/b end
+     t clear
+     :clear
+     s/^\([^=]*\)=\(.*[{}].*\)$/test ${\1+y} || &/
+     t end
+     s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/
+     :end' >>confcache
+if diff "$cache_file" confcache >/dev/null 2>&1; then :; else
+  if test -w "$cache_file"; then
+    if test "x$cache_file" != "x/dev/null"; then
+      { printf "%s\n" "$as_me:${as_lineno-$LINENO}: updating cache $cache_file" >&5
+printf "%s\n" "$as_me: updating cache $cache_file" >&6;}
+      if test ! -f "$cache_file" || test -h "$cache_file"; then
+	cat confcache >"$cache_file"
+      else
+        case $cache_file in #(
+        */* | ?:*)
+	  mv -f confcache "$cache_file"$$ &&
+	  mv -f "$cache_file"$$ "$cache_file" ;; #(
+        *)
+	  mv -f confcache "$cache_file" ;;
+	esac
+      fi
+    fi
+  else
+    { printf "%s\n" "$as_me:${as_lineno-$LINENO}: not updating unwritable cache $cache_file" >&5
+printf "%s\n" "$as_me: not updating unwritable cache $cache_file" >&6;}
+  fi
+fi
+rm -f confcache
+
+test "x$prefix" = xNONE && prefix=$ac_default_prefix
+# Let make expand exec_prefix.
+test "x$exec_prefix" = xNONE && exec_prefix='${prefix}'
+
+DEFS=-DHAVE_CONFIG_H
+
+ac_libobjs=
+ac_ltlibobjs=
+U=
+for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue
+  # 1. Remove the extension, and $U if already installed.
+  ac_script='s/\$U\././;s/\.o$//;s/\.obj$//'
+  ac_i=`printf "%s\n" "$ac_i" | sed "$ac_script"`
+  # 2. Prepend LIBOBJDIR.  When used with automake>=1.10 LIBOBJDIR
+  #    will be set to the directory where LIBOBJS objects are built.
+  as_fn_append ac_libobjs " \${LIBOBJDIR}$ac_i\$U.$ac_objext"
+  as_fn_append ac_ltlibobjs " \${LIBOBJDIR}$ac_i"'$U.lo'
+done
+LIBOBJS=$ac_libobjs
+
+LTLIBOBJS=$ac_ltlibobjs
+
+
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: checking that generated files are newer than configure" >&5
+printf %s "checking that generated files are newer than configure... " >&6; }
+   if test -n "$am_sleep_pid"; then
+     # Hide warnings about reused PIDs.
+     wait $am_sleep_pid 2>/dev/null
+   fi
+   { printf "%s\n" "$as_me:${as_lineno-$LINENO}: result: done" >&5
+printf "%s\n" "done" >&6; }
+ if test -n "$EXEEXT"; then
+  am__EXEEXT_TRUE=
+  am__EXEEXT_FALSE='#'
+else
+  am__EXEEXT_TRUE='#'
+  am__EXEEXT_FALSE=
+fi
+
+if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then
+  as_fn_error $? "conditional \"AMDEP\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${am__fastdepCC_TRUE}" && test -z "${am__fastdepCC_FALSE}"; then
+  as_fn_error $? "conditional \"am__fastdepCC\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then
+  as_fn_error $? "conditional \"am__fastdepCXX\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+
+if test -z "${HAVE_LIBZ_TRUE}" && test -z "${HAVE_LIBZ_FALSE}"; then
+  as_fn_error $? "conditional \"HAVE_LIBZ\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+
+: "${CONFIG_STATUS=./config.status}"
+ac_write_fail=0
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files $CONFIG_STATUS"
+{ printf "%s\n" "$as_me:${as_lineno-$LINENO}: creating $CONFIG_STATUS" >&5
+printf "%s\n" "$as_me: creating $CONFIG_STATUS" >&6;}
+as_write_fail=0
+cat >$CONFIG_STATUS <<_ASEOF || as_write_fail=1
+#! $SHELL
+# Generated by $as_me.
+# Run this file to recreate the current configuration.
+# Compiler output produced by configure, useful for debugging
+# configure, is in config.log if it exists.
+
+debug=false
+ac_cs_recheck=false
+ac_cs_silent=false
+
+SHELL=\${CONFIG_SHELL-$SHELL}
+export SHELL
+_ASEOF
+cat >>$CONFIG_STATUS <<\_ASEOF || as_write_fail=1
+## -------------------- ##
+## M4sh Initialization. ##
+## -------------------- ##
+
+# Be more Bourne compatible
+DUALCASE=1; export DUALCASE # for MKS sh
+as_nop=:
+if test ${ZSH_VERSION+y} && (emulate sh) >/dev/null 2>&1
+then :
+  emulate sh
+  NULLCMD=:
+  # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
+  # is contrary to our usage.  Disable this feature.
+  alias -g '${1+"$@"}'='"$@"'
+  setopt NO_GLOB_SUBST
+else $as_nop
+  case `(set -o) 2>/dev/null` in #(
+  *posix*) :
+    set -o posix ;; #(
+  *) :
+     ;;
+esac
+fi
+
+
+
+# Reset variables that may have inherited troublesome values from
+# the environment.
+
+# IFS needs to be set, to space, tab, and newline, in precisely that order.
+# (If _AS_PATH_WALK were called with IFS unset, it would have the
+# side effect of setting IFS to empty, thus disabling word splitting.)
+# Quoting is to prevent editors from complaining about space-tab.
+as_nl='
+'
+export as_nl
+IFS=" ""	$as_nl"
+
+PS1='$ '
+PS2='> '
+PS4='+ '
+
+# Ensure predictable behavior from utilities with locale-dependent output.
+LC_ALL=C
+export LC_ALL
+LANGUAGE=C
+export LANGUAGE
+
+# We cannot yet rely on "unset" to work, but we need these variables
+# to be unset--not just set to an empty or harmless value--now, to
+# avoid bugs in old shells (e.g. pre-3.0 UWIN ksh).  This construct
+# also avoids known problems related to "unset" and subshell syntax
+# in other old shells (e.g. bash 2.01 and pdksh 5.2.14).
+for as_var in BASH_ENV ENV MAIL MAILPATH CDPATH
+do eval test \${$as_var+y} \
+  && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
+done
+
+# Ensure that fds 0, 1, and 2 are open.
+if (exec 3>&0) 2>/dev/null; then :; else exec 0</dev/null; fi
+if (exec 3>&1) 2>/dev/null; then :; else exec 1>/dev/null; fi
+if (exec 3>&2)            ; then :; else exec 2>/dev/null; fi
+
+# The user is always right.
+if ${PATH_SEPARATOR+false} :; then
+  PATH_SEPARATOR=:
+  (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
+    (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
+      PATH_SEPARATOR=';'
+  }
+fi
+
+
+# Find who we are.  Look in the path if we contain no directory separator.
+as_myself=
+case $0 in #((
+  *[\\/]* ) as_myself=$0 ;;
+  *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  case $as_dir in #(((
+    '') as_dir=./ ;;
+    */) ;;
+    *) as_dir=$as_dir/ ;;
+  esac
+    test -r "$as_dir$0" && as_myself=$as_dir$0 && break
+  done
+IFS=$as_save_IFS
+
+     ;;
+esac
+# We did not find ourselves, most probably we were run as `sh COMMAND'
+# in which case we are not to be found in the path.
+if test "x$as_myself" = x; then
+  as_myself=$0
+fi
+if test ! -f "$as_myself"; then
+  printf "%s\n" "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
+  exit 1
+fi
+
+
+
+# as_fn_error STATUS ERROR [LINENO LOG_FD]
+# ----------------------------------------
+# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
+# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
+# script with STATUS, using 1 if that was 0.
+as_fn_error ()
+{
+  as_status=$1; test $as_status -eq 0 && as_status=1
+  if test "$4"; then
+    as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+    printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
+  fi
+  printf "%s\n" "$as_me: error: $2" >&2
+  as_fn_exit $as_status
+} # as_fn_error
+
+
+
+# as_fn_set_status STATUS
+# -----------------------
+# Set $? to STATUS, without forking.
+as_fn_set_status ()
+{
+  return $1
+} # as_fn_set_status
+
+# as_fn_exit STATUS
+# -----------------
+# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
+as_fn_exit ()
+{
+  set +e
+  as_fn_set_status $1
+  exit $1
+} # as_fn_exit
+
+# as_fn_unset VAR
+# ---------------
+# Portably unset VAR.
+as_fn_unset ()
+{
+  { eval $1=; unset $1;}
+}
+as_unset=as_fn_unset
+
+# as_fn_append VAR VALUE
+# ----------------------
+# Append the text in VALUE to the end of the definition contained in VAR. Take
+# advantage of any shell optimizations that allow amortized linear growth over
+# repeated appends, instead of the typical quadratic growth present in naive
+# implementations.
+if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null
+then :
+  eval 'as_fn_append ()
+  {
+    eval $1+=\$2
+  }'
+else $as_nop
+  as_fn_append ()
+  {
+    eval $1=\$$1\$2
+  }
+fi # as_fn_append
+
+# as_fn_arith ARG...
+# ------------------
+# Perform arithmetic evaluation on the ARGs, and store the result in the
+# global $as_val. Take advantage of shells that can avoid forks. The arguments
+# must be portable across $(()) and expr.
+if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null
+then :
+  eval 'as_fn_arith ()
+  {
+    as_val=$(( $* ))
+  }'
+else $as_nop
+  as_fn_arith ()
+  {
+    as_val=`expr "$@" || test $? -eq 1`
+  }
+fi # as_fn_arith
+
+
+if expr a : '\(a\)' >/dev/null 2>&1 &&
+   test "X`expr 00001 : '.*\(...\)'`" = X001; then
+  as_expr=expr
+else
+  as_expr=false
+fi
+
+if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
+  as_basename=basename
+else
+  as_basename=false
+fi
+
+if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
+  as_dirname=dirname
+else
+  as_dirname=false
+fi
+
+as_me=`$as_basename -- "$0" ||
+$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
+	 X"$0" : 'X\(//\)$' \| \
+	 X"$0" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X/"$0" |
+    sed '/^.*\/\([^/][^/]*\)\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\/\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\/\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
+
+
+# Determine whether it's possible to make 'echo' print without a newline.
+# These variables are no longer used directly by Autoconf, but are AC_SUBSTed
+# for compatibility with existing Makefiles.
+ECHO_C= ECHO_N= ECHO_T=
+case `echo -n x` in #(((((
+-n*)
+  case `echo 'xy\c'` in
+  *c*) ECHO_T='	';;	# ECHO_T is single tab character.
+  xy)  ECHO_C='\c';;
+  *)   echo `echo ksh88 bug on AIX 6.1` > /dev/null
+       ECHO_T='	';;
+  esac;;
+*)
+  ECHO_N='-n';;
+esac
+
+# For backward compatibility with old third-party macros, we provide
+# the shell variables $as_echo and $as_echo_n.  New code should use
+# AS_ECHO(["message"]) and AS_ECHO_N(["message"]), respectively.
+as_echo='printf %s\n'
+as_echo_n='printf %s'
+
+rm -f conf$$ conf$$.exe conf$$.file
+if test -d conf$$.dir; then
+  rm -f conf$$.dir/conf$$.file
+else
+  rm -f conf$$.dir
+  mkdir conf$$.dir 2>/dev/null
+fi
+if (echo >conf$$.file) 2>/dev/null; then
+  if ln -s conf$$.file conf$$ 2>/dev/null; then
+    as_ln_s='ln -s'
+    # ... but there are two gotchas:
+    # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
+    # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
+    # In both cases, we have to default to `cp -pR'.
+    ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
+      as_ln_s='cp -pR'
+  elif ln conf$$.file conf$$ 2>/dev/null; then
+    as_ln_s=ln
+  else
+    as_ln_s='cp -pR'
+  fi
+else
+  as_ln_s='cp -pR'
+fi
+rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
+rmdir conf$$.dir 2>/dev/null
+
+
+# as_fn_mkdir_p
+# -------------
+# Create "$as_dir" as a directory, including parents if necessary.
+as_fn_mkdir_p ()
+{
+
+  case $as_dir in #(
+  -*) as_dir=./$as_dir;;
+  esac
+  test -d "$as_dir" || eval $as_mkdir_p || {
+    as_dirs=
+    while :; do
+      case $as_dir in #(
+      *\'*) as_qdir=`printf "%s\n" "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
+      *) as_qdir=$as_dir;;
+      esac
+      as_dirs="'$as_qdir' $as_dirs"
+      as_dir=`$as_dirname -- "$as_dir" ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$as_dir" : 'X\(//\)[^/]' \| \
+	 X"$as_dir" : 'X\(//\)$' \| \
+	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+      test -d "$as_dir" && break
+    done
+    test -z "$as_dirs" || eval "mkdir $as_dirs"
+  } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
+
+
+} # as_fn_mkdir_p
+if mkdir -p . 2>/dev/null; then
+  as_mkdir_p='mkdir -p "$as_dir"'
+else
+  test -d ./-p && rmdir ./-p
+  as_mkdir_p=false
+fi
+
+
+# as_fn_executable_p FILE
+# -----------------------
+# Test if FILE is an executable regular file.
+as_fn_executable_p ()
+{
+  test -f "$1" && test -x "$1"
+} # as_fn_executable_p
+as_test_x='test -x'
+as_executable_p=as_fn_executable_p
+
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
+
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
+
+
+exec 6>&1
+## ----------------------------------- ##
+## Main body of $CONFIG_STATUS script. ##
+## ----------------------------------- ##
+_ASEOF
+test $as_write_fail = 0 && chmod +x $CONFIG_STATUS || ac_write_fail=1
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# Save the log message, to keep $0 and so on meaningful, and to
+# report actual input values of CONFIG_FILES etc. instead of their
+# values after options handling.
+ac_log="
+This file was extended by NTHASH $as_me 2.1.0, which was
+generated by GNU Autoconf 2.71.  Invocation command line was
+
+  CONFIG_FILES    = $CONFIG_FILES
+  CONFIG_HEADERS  = $CONFIG_HEADERS
+  CONFIG_LINKS    = $CONFIG_LINKS
+  CONFIG_COMMANDS = $CONFIG_COMMANDS
+  $ $0 $@
+
+on `(hostname || uname -n) 2>/dev/null | sed 1q`
+"
+
+_ACEOF
+
+case $ac_config_files in *"
+"*) set x $ac_config_files; shift; ac_config_files=$*;;
+esac
+
+case $ac_config_headers in *"
+"*) set x $ac_config_headers; shift; ac_config_headers=$*;;
+esac
+
+
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+# Files that config.status was made for.
+config_files="$ac_config_files"
+config_headers="$ac_config_headers"
+config_commands="$ac_config_commands"
+
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+ac_cs_usage="\
+\`$as_me' instantiates files and other configuration actions
+from templates according to the current configuration.  Unless the files
+and actions are specified as TAGs, all are instantiated by default.
+
+Usage: $0 [OPTION]... [TAG]...
+
+  -h, --help       print this help, then exit
+  -V, --version    print version number and configuration settings, then exit
+      --config     print configuration, then exit
+  -q, --quiet, --silent
+                   do not print progress messages
+  -d, --debug      don't remove temporary files
+      --recheck    update $as_me by reconfiguring in the same conditions
+      --file=FILE[:TEMPLATE]
+                   instantiate the configuration file FILE
+      --header=FILE[:TEMPLATE]
+                   instantiate the configuration header FILE
+
+Configuration files:
+$config_files
+
+Configuration headers:
+$config_headers
+
+Configuration commands:
+$config_commands
+
+Report bugs to <hmohamadi@bcgsc.ca>.
+NTHASH home page: <https://github.com/bcgsc/ntHash>."
+
+_ACEOF
+ac_cs_config=`printf "%s\n" "$ac_configure_args" | sed "$ac_safe_unquote"`
+ac_cs_config_escaped=`printf "%s\n" "$ac_cs_config" | sed "s/^ //; s/'/'\\\\\\\\''/g"`
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ac_cs_config='$ac_cs_config_escaped'
+ac_cs_version="\\
+NTHASH config.status 2.1.0
+configured by $0, generated by GNU Autoconf 2.71,
+  with options \\"\$ac_cs_config\\"
+
+Copyright (C) 2021 Free Software Foundation, Inc.
+This config.status script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it."
+
+ac_pwd='$ac_pwd'
+srcdir='$srcdir'
+INSTALL='$INSTALL'
+MKDIR_P='$MKDIR_P'
+AWK='$AWK'
+test -n "\$AWK" || AWK=awk
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# The default lists apply if the user does not specify any file.
+ac_need_defaults=:
+while test $# != 0
+do
+  case $1 in
+  --*=?*)
+    ac_option=`expr "X$1" : 'X\([^=]*\)='`
+    ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'`
+    ac_shift=:
+    ;;
+  --*=)
+    ac_option=`expr "X$1" : 'X\([^=]*\)='`
+    ac_optarg=
+    ac_shift=:
+    ;;
+  *)
+    ac_option=$1
+    ac_optarg=$2
+    ac_shift=shift
+    ;;
+  esac
+
+  case $ac_option in
+  # Handling of the options.
+  -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r)
+    ac_cs_recheck=: ;;
+  --version | --versio | --versi | --vers | --ver | --ve | --v | -V )
+    printf "%s\n" "$ac_cs_version"; exit ;;
+  --config | --confi | --conf | --con | --co | --c )
+    printf "%s\n" "$ac_cs_config"; exit ;;
+  --debug | --debu | --deb | --de | --d | -d )
+    debug=: ;;
+  --file | --fil | --fi | --f )
+    $ac_shift
+    case $ac_optarg in
+    *\'*) ac_optarg=`printf "%s\n" "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
+    '') as_fn_error $? "missing file argument" ;;
+    esac
+    as_fn_append CONFIG_FILES " '$ac_optarg'"
+    ac_need_defaults=false;;
+  --header | --heade | --head | --hea )
+    $ac_shift
+    case $ac_optarg in
+    *\'*) ac_optarg=`printf "%s\n" "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
+    esac
+    as_fn_append CONFIG_HEADERS " '$ac_optarg'"
+    ac_need_defaults=false;;
+  --he | --h)
+    # Conflict between --help and --header
+    as_fn_error $? "ambiguous option: \`$1'
+Try \`$0 --help' for more information.";;
+  --help | --hel | -h )
+    printf "%s\n" "$ac_cs_usage"; exit ;;
+  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+  | -silent | --silent | --silen | --sile | --sil | --si | --s)
+    ac_cs_silent=: ;;
+
+  # This is an error.
+  -*) as_fn_error $? "unrecognized option: \`$1'
+Try \`$0 --help' for more information." ;;
+
+  *) as_fn_append ac_config_targets " $1"
+     ac_need_defaults=false ;;
+
+  esac
+  shift
+done
+
+ac_configure_extra_args=
+
+if $ac_cs_silent; then
+  exec 6>/dev/null
+  ac_configure_extra_args="$ac_configure_extra_args --silent"
+fi
+
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+if \$ac_cs_recheck; then
+  set X $SHELL '$0' $ac_configure_args \$ac_configure_extra_args --no-create --no-recursion
+  shift
+  \printf "%s\n" "running CONFIG_SHELL=$SHELL \$*" >&6
+  CONFIG_SHELL='$SHELL'
+  export CONFIG_SHELL
+  exec "\$@"
+fi
+
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+exec 5>>config.log
+{
+  echo
+  sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX
+## Running $as_me. ##
+_ASBOX
+  printf "%s\n" "$ac_log"
+} >&5
+
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+#
+# INIT-COMMANDS
+#
+AMDEP_TRUE="$AMDEP_TRUE" MAKE="${MAKE-make}"
+
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+
+# Handling of arguments.
+for ac_config_target in $ac_config_targets
+do
+  case $ac_config_target in
+    "config.h") CONFIG_HEADERS="$CONFIG_HEADERS config.h" ;;
+    "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
+    "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;;
+    "unittest/Makefile") CONFIG_FILES="$CONFIG_FILES unittest/Makefile" ;;
+    "vendor/Makefile") CONFIG_FILES="$CONFIG_FILES vendor/Makefile" ;;
+
+  *) as_fn_error $? "invalid argument: \`$ac_config_target'" "$LINENO" 5;;
+  esac
+done
+
+
+# If the user did not use the arguments to specify the items to instantiate,
+# then the envvar interface is used.  Set only those that are not.
+# We use the long form for the default assignment because of an extremely
+# bizarre bug on SunOS 4.1.3.
+if $ac_need_defaults; then
+  test ${CONFIG_FILES+y} || CONFIG_FILES=$config_files
+  test ${CONFIG_HEADERS+y} || CONFIG_HEADERS=$config_headers
+  test ${CONFIG_COMMANDS+y} || CONFIG_COMMANDS=$config_commands
+fi
+
+# Have a temporary directory for convenience.  Make it in the build tree
+# simply because there is no reason against having it here, and in addition,
+# creating and moving files from /tmp can sometimes cause problems.
+# Hook for its removal unless debugging.
+# Note that there is a small window in which the directory will not be cleaned:
+# after its creation but before its name has been assigned to `$tmp'.
+$debug ||
+{
+  tmp= ac_tmp=
+  trap 'exit_status=$?
+  : "${ac_tmp:=$tmp}"
+  { test ! -d "$ac_tmp" || rm -fr "$ac_tmp"; } && exit $exit_status
+' 0
+  trap 'as_fn_exit 1' 1 2 13 15
+}
+# Create a (secure) tmp directory for tmp files.
+
+{
+  tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` &&
+  test -d "$tmp"
+}  ||
+{
+  tmp=./conf$$-$RANDOM
+  (umask 077 && mkdir "$tmp")
+} || as_fn_error $? "cannot create a temporary directory in ." "$LINENO" 5
+ac_tmp=$tmp
+
+# Set up the scripts for CONFIG_FILES section.
+# No need to generate them if there are no CONFIG_FILES.
+# This happens for instance with `./config.status config.h'.
+if test -n "$CONFIG_FILES"; then
+
+
+ac_cr=`echo X | tr X '\015'`
+# On cygwin, bash can eat \r inside `` if the user requested igncr.
+# But we know of no other shell where ac_cr would be empty at this
+# point, so we can use a bashism as a fallback.
+if test "x$ac_cr" = x; then
+  eval ac_cr=\$\'\\r\'
+fi
+ac_cs_awk_cr=`$AWK 'BEGIN { print "a\rb" }' </dev/null 2>/dev/null`
+if test "$ac_cs_awk_cr" = "a${ac_cr}b"; then
+  ac_cs_awk_cr='\\r'
+else
+  ac_cs_awk_cr=$ac_cr
+fi
+
+echo 'BEGIN {' >"$ac_tmp/subs1.awk" &&
+_ACEOF
+
+
+{
+  echo "cat >conf$$subs.awk <<_ACEOF" &&
+  echo "$ac_subst_vars" | sed 's/.*/&!$&$ac_delim/' &&
+  echo "_ACEOF"
+} >conf$$subs.sh ||
+  as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+ac_delim_num=`echo "$ac_subst_vars" | grep -c '^'`
+ac_delim='%!_!# '
+for ac_last_try in false false false false false :; do
+  . ./conf$$subs.sh ||
+    as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+
+  ac_delim_n=`sed -n "s/.*$ac_delim\$/X/p" conf$$subs.awk | grep -c X`
+  if test $ac_delim_n = $ac_delim_num; then
+    break
+  elif $ac_last_try; then
+    as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+  else
+    ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
+  fi
+done
+rm -f conf$$subs.sh
+
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+cat >>"\$ac_tmp/subs1.awk" <<\\_ACAWK &&
+_ACEOF
+sed -n '
+h
+s/^/S["/; s/!.*/"]=/
+p
+g
+s/^[^!]*!//
+:repl
+t repl
+s/'"$ac_delim"'$//
+t delim
+:nl
+h
+s/\(.\{148\}\)..*/\1/
+t more1
+s/["\\]/\\&/g; s/^/"/; s/$/\\n"\\/
+p
+n
+b repl
+:more1
+s/["\\]/\\&/g; s/^/"/; s/$/"\\/
+p
+g
+s/.\{148\}//
+t nl
+:delim
+h
+s/\(.\{148\}\)..*/\1/
+t more2
+s/["\\]/\\&/g; s/^/"/; s/$/"/
+p
+b
+:more2
+s/["\\]/\\&/g; s/^/"/; s/$/"\\/
+p
+g
+s/.\{148\}//
+t delim
+' <conf$$subs.awk | sed '
+/^[^""]/{
+  N
+  s/\n//
+}
+' >>$CONFIG_STATUS || ac_write_fail=1
+rm -f conf$$subs.awk
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+_ACAWK
+cat >>"\$ac_tmp/subs1.awk" <<_ACAWK &&
+  for (key in S) S_is_set[key] = 1
+  FS = ""
+
+}
+{
+  line = $ 0
+  nfields = split(line, field, "@")
+  substed = 0
+  len = length(field[1])
+  for (i = 2; i < nfields; i++) {
+    key = field[i]
+    keylen = length(key)
+    if (S_is_set[key]) {
+      value = S[key]
+      line = substr(line, 1, len) "" value "" substr(line, len + keylen + 3)
+      len += length(value) + length(field[++i])
+      substed = 1
+    } else
+      len += 1 + keylen
+  }
+
+  print line
+}
+
+_ACAWK
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+if sed "s/$ac_cr//" < /dev/null > /dev/null 2>&1; then
+  sed "s/$ac_cr\$//; s/$ac_cr/$ac_cs_awk_cr/g"
+else
+  cat
+fi < "$ac_tmp/subs1.awk" > "$ac_tmp/subs.awk" \
+  || as_fn_error $? "could not setup config files machinery" "$LINENO" 5
+_ACEOF
+
+# VPATH may cause trouble with some makes, so we remove sole $(srcdir),
+# ${srcdir} and @srcdir@ entries from VPATH if srcdir is ".", strip leading and
+# trailing colons and then remove the whole line if VPATH becomes empty
+# (actually we leave an empty line to preserve line numbers).
+if test "x$srcdir" = x.; then
+  ac_vpsub='/^[	 ]*VPATH[	 ]*=[	 ]*/{
+h
+s///
+s/^/:/
+s/[	 ]*$/:/
+s/:\$(srcdir):/:/g
+s/:\${srcdir}:/:/g
+s/:@srcdir@:/:/g
+s/^:*//
+s/:*$//
+x
+s/\(=[	 ]*\).*/\1/
+G
+s/\n//
+s/^[^=]*=[	 ]*$//
+}'
+fi
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+fi # test -n "$CONFIG_FILES"
+
+# Set up the scripts for CONFIG_HEADERS section.
+# No need to generate them if there are no CONFIG_HEADERS.
+# This happens for instance with `./config.status Makefile'.
+if test -n "$CONFIG_HEADERS"; then
+cat >"$ac_tmp/defines.awk" <<\_ACAWK ||
+BEGIN {
+_ACEOF
+
+# Transform confdefs.h into an awk script `defines.awk', embedded as
+# here-document in config.status, that substitutes the proper values into
+# config.h.in to produce config.h.
+
+# Create a delimiter string that does not exist in confdefs.h, to ease
+# handling of long lines.
+ac_delim='%!_!# '
+for ac_last_try in false false :; do
+  ac_tt=`sed -n "/$ac_delim/p" confdefs.h`
+  if test -z "$ac_tt"; then
+    break
+  elif $ac_last_try; then
+    as_fn_error $? "could not make $CONFIG_HEADERS" "$LINENO" 5
+  else
+    ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
+  fi
+done
+
+# For the awk script, D is an array of macro values keyed by name,
+# likewise P contains macro parameters if any.  Preserve backslash
+# newline sequences.
+
+ac_word_re=[_$as_cr_Letters][_$as_cr_alnum]*
+sed -n '
+s/.\{148\}/&'"$ac_delim"'/g
+t rset
+:rset
+s/^[	 ]*#[	 ]*define[	 ][	 ]*/ /
+t def
+d
+:def
+s/\\$//
+t bsnl
+s/["\\]/\\&/g
+s/^ \('"$ac_word_re"'\)\(([^()]*)\)[	 ]*\(.*\)/P["\1"]="\2"\
+D["\1"]=" \3"/p
+s/^ \('"$ac_word_re"'\)[	 ]*\(.*\)/D["\1"]=" \2"/p
+d
+:bsnl
+s/["\\]/\\&/g
+s/^ \('"$ac_word_re"'\)\(([^()]*)\)[	 ]*\(.*\)/P["\1"]="\2"\
+D["\1"]=" \3\\\\\\n"\\/p
+t cont
+s/^ \('"$ac_word_re"'\)[	 ]*\(.*\)/D["\1"]=" \2\\\\\\n"\\/p
+t cont
+d
+:cont
+n
+s/.\{148\}/&'"$ac_delim"'/g
+t clear
+:clear
+s/\\$//
+t bsnlc
+s/["\\]/\\&/g; s/^/"/; s/$/"/p
+d
+:bsnlc
+s/["\\]/\\&/g; s/^/"/; s/$/\\\\\\n"\\/p
+b cont
+' <confdefs.h | sed '
+s/'"$ac_delim"'/"\\\
+"/g' >>$CONFIG_STATUS || ac_write_fail=1
+
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+  for (key in D) D_is_set[key] = 1
+  FS = ""
+}
+/^[\t ]*#[\t ]*(define|undef)[\t ]+$ac_word_re([\t (]|\$)/ {
+  line = \$ 0
+  split(line, arg, " ")
+  if (arg[1] == "#") {
+    defundef = arg[2]
+    mac1 = arg[3]
+  } else {
+    defundef = substr(arg[1], 2)
+    mac1 = arg[2]
+  }
+  split(mac1, mac2, "(") #)
+  macro = mac2[1]
+  prefix = substr(line, 1, index(line, defundef) - 1)
+  if (D_is_set[macro]) {
+    # Preserve the white space surrounding the "#".
+    print prefix "define", macro P[macro] D[macro]
+    next
+  } else {
+    # Replace #undef with comments.  This is necessary, for example,
+    # in the case of _POSIX_SOURCE, which is predefined and required
+    # on some systems where configure will not decide to define it.
+    if (defundef == "undef") {
+      print "/*", prefix defundef, macro, "*/"
+      next
+    }
+  }
+}
+{ print }
+_ACAWK
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+  as_fn_error $? "could not setup config headers machinery" "$LINENO" 5
+fi # test -n "$CONFIG_HEADERS"
+
+
+eval set X "  :F $CONFIG_FILES  :H $CONFIG_HEADERS    :C $CONFIG_COMMANDS"
+shift
+for ac_tag
+do
+  case $ac_tag in
+  :[FHLC]) ac_mode=$ac_tag; continue;;
+  esac
+  case $ac_mode$ac_tag in
+  :[FHL]*:*);;
+  :L* | :C*:*) as_fn_error $? "invalid tag \`$ac_tag'" "$LINENO" 5;;
+  :[FH]-) ac_tag=-:-;;
+  :[FH]*) ac_tag=$ac_tag:$ac_tag.in;;
+  esac
+  ac_save_IFS=$IFS
+  IFS=:
+  set x $ac_tag
+  IFS=$ac_save_IFS
+  shift
+  ac_file=$1
+  shift
+
+  case $ac_mode in
+  :L) ac_source=$1;;
+  :[FH])
+    ac_file_inputs=
+    for ac_f
+    do
+      case $ac_f in
+      -) ac_f="$ac_tmp/stdin";;
+      *) # Look for the file first in the build tree, then in the source tree
+	 # (if the path is not absolute).  The absolute path cannot be DOS-style,
+	 # because $ac_f cannot contain `:'.
+	 test -f "$ac_f" ||
+	   case $ac_f in
+	   [\\/$]*) false;;
+	   *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";;
+	   esac ||
+	   as_fn_error 1 "cannot find input file: \`$ac_f'" "$LINENO" 5;;
+      esac
+      case $ac_f in *\'*) ac_f=`printf "%s\n" "$ac_f" | sed "s/'/'\\\\\\\\''/g"`;; esac
+      as_fn_append ac_file_inputs " '$ac_f'"
+    done
+
+    # Let's still pretend it is `configure' which instantiates (i.e., don't
+    # use $as_me), people would be surprised to read:
+    #    /* config.h.  Generated by config.status.  */
+    configure_input='Generated from '`
+	  printf "%s\n" "$*" | sed 's|^[^:]*/||;s|:[^:]*/|, |g'
+	`' by configure.'
+    if test x"$ac_file" != x-; then
+      configure_input="$ac_file.  $configure_input"
+      { printf "%s\n" "$as_me:${as_lineno-$LINENO}: creating $ac_file" >&5
+printf "%s\n" "$as_me: creating $ac_file" >&6;}
+    fi
+    # Neutralize special characters interpreted by sed in replacement strings.
+    case $configure_input in #(
+    *\&* | *\|* | *\\* )
+       ac_sed_conf_input=`printf "%s\n" "$configure_input" |
+       sed 's/[\\\\&|]/\\\\&/g'`;; #(
+    *) ac_sed_conf_input=$configure_input;;
+    esac
+
+    case $ac_tag in
+    *:-:* | *:-) cat >"$ac_tmp/stdin" \
+      || as_fn_error $? "could not create $ac_file" "$LINENO" 5 ;;
+    esac
+    ;;
+  esac
+
+  ac_dir=`$as_dirname -- "$ac_file" ||
+$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$ac_file" : 'X\(//\)[^/]' \| \
+	 X"$ac_file" : 'X\(//\)$' \| \
+	 X"$ac_file" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X"$ac_file" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+  as_dir="$ac_dir"; as_fn_mkdir_p
+  ac_builddir=.
+
+case "$ac_dir" in
+.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
+*)
+  ac_dir_suffix=/`printf "%s\n" "$ac_dir" | sed 's|^\.[\\/]||'`
+  # A ".." for each directory in $ac_dir_suffix.
+  ac_top_builddir_sub=`printf "%s\n" "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
+  case $ac_top_builddir_sub in
+  "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
+  *)  ac_top_build_prefix=$ac_top_builddir_sub/ ;;
+  esac ;;
+esac
+ac_abs_top_builddir=$ac_pwd
+ac_abs_builddir=$ac_pwd$ac_dir_suffix
+# for backward compatibility:
+ac_top_builddir=$ac_top_build_prefix
+
+case $srcdir in
+  .)  # We are building in place.
+    ac_srcdir=.
+    ac_top_srcdir=$ac_top_builddir_sub
+    ac_abs_top_srcdir=$ac_pwd ;;
+  [\\/]* | ?:[\\/]* )  # Absolute name.
+    ac_srcdir=$srcdir$ac_dir_suffix;
+    ac_top_srcdir=$srcdir
+    ac_abs_top_srcdir=$srcdir ;;
+  *) # Relative name.
+    ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
+    ac_top_srcdir=$ac_top_build_prefix$srcdir
+    ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
+esac
+ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
+
+
+  case $ac_mode in
+  :F)
+  #
+  # CONFIG_FILE
+  #
+
+  case $INSTALL in
+  [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;;
+  *) ac_INSTALL=$ac_top_build_prefix$INSTALL ;;
+  esac
+  ac_MKDIR_P=$MKDIR_P
+  case $MKDIR_P in
+  [\\/$]* | ?:[\\/]* ) ;;
+  */*) ac_MKDIR_P=$ac_top_build_prefix$MKDIR_P ;;
+  esac
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# If the template does not know about datarootdir, expand it.
+# FIXME: This hack should be removed a few years after 2.60.
+ac_datarootdir_hack=; ac_datarootdir_seen=
+ac_sed_dataroot='
+/datarootdir/ {
+  p
+  q
+}
+/@datadir@/p
+/@docdir@/p
+/@infodir@/p
+/@localedir@/p
+/@mandir@/p'
+case `eval "sed -n \"\$ac_sed_dataroot\" $ac_file_inputs"` in
+*datarootdir*) ac_datarootdir_seen=yes;;
+*@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*)
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5
+printf "%s\n" "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;}
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+  ac_datarootdir_hack='
+  s&@datadir@&$datadir&g
+  s&@docdir@&$docdir&g
+  s&@infodir@&$infodir&g
+  s&@localedir@&$localedir&g
+  s&@mandir@&$mandir&g
+  s&\\\${datarootdir}&$datarootdir&g' ;;
+esac
+_ACEOF
+
+# Neutralize VPATH when `$srcdir' = `.'.
+# Shell code in configure.ac might set extrasub.
+# FIXME: do we really want to maintain this feature?
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ac_sed_extra="$ac_vpsub
+$extrasub
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+:t
+/@[a-zA-Z_][a-zA-Z_0-9]*@/!b
+s|@configure_input@|$ac_sed_conf_input|;t t
+s&@top_builddir@&$ac_top_builddir_sub&;t t
+s&@top_build_prefix@&$ac_top_build_prefix&;t t
+s&@srcdir@&$ac_srcdir&;t t
+s&@abs_srcdir@&$ac_abs_srcdir&;t t
+s&@top_srcdir@&$ac_top_srcdir&;t t
+s&@abs_top_srcdir@&$ac_abs_top_srcdir&;t t
+s&@builddir@&$ac_builddir&;t t
+s&@abs_builddir@&$ac_abs_builddir&;t t
+s&@abs_top_builddir@&$ac_abs_top_builddir&;t t
+s&@INSTALL@&$ac_INSTALL&;t t
+s&@MKDIR_P@&$ac_MKDIR_P&;t t
+$ac_datarootdir_hack
+"
+eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$ac_tmp/subs.awk" \
+  >$ac_tmp/out || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+
+test -z "$ac_datarootdir_hack$ac_datarootdir_seen" &&
+  { ac_out=`sed -n '/\${datarootdir}/p' "$ac_tmp/out"`; test -n "$ac_out"; } &&
+  { ac_out=`sed -n '/^[	 ]*datarootdir[	 ]*:*=/p' \
+      "$ac_tmp/out"`; test -z "$ac_out"; } &&
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file contains a reference to the variable \`datarootdir'
+which seems to be undefined.  Please make sure it is defined" >&5
+printf "%s\n" "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir'
+which seems to be undefined.  Please make sure it is defined" >&2;}
+
+  rm -f "$ac_tmp/stdin"
+  case $ac_file in
+  -) cat "$ac_tmp/out" && rm -f "$ac_tmp/out";;
+  *) rm -f "$ac_file" && mv "$ac_tmp/out" "$ac_file";;
+  esac \
+  || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+ ;;
+  :H)
+  #
+  # CONFIG_HEADER
+  #
+  if test x"$ac_file" != x-; then
+    {
+      printf "%s\n" "/* $configure_input  */" >&1 \
+      && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs"
+    } >"$ac_tmp/config.h" \
+      || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+    if diff "$ac_file" "$ac_tmp/config.h" >/dev/null 2>&1; then
+      { printf "%s\n" "$as_me:${as_lineno-$LINENO}: $ac_file is unchanged" >&5
+printf "%s\n" "$as_me: $ac_file is unchanged" >&6;}
+    else
+      rm -f "$ac_file"
+      mv "$ac_tmp/config.h" "$ac_file" \
+	|| as_fn_error $? "could not create $ac_file" "$LINENO" 5
+    fi
+  else
+    printf "%s\n" "/* $configure_input  */" >&1 \
+      && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs" \
+      || as_fn_error $? "could not create -" "$LINENO" 5
+  fi
+# Compute "$ac_file"'s index in $config_headers.
+_am_arg="$ac_file"
+_am_stamp_count=1
+for _am_header in $config_headers :; do
+  case $_am_header in
+    $_am_arg | $_am_arg:* )
+      break ;;
+    * )
+      _am_stamp_count=`expr $_am_stamp_count + 1` ;;
+  esac
+done
+echo "timestamp for $_am_arg" >`$as_dirname -- "$_am_arg" ||
+$as_expr X"$_am_arg" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$_am_arg" : 'X\(//\)[^/]' \| \
+	 X"$_am_arg" : 'X\(//\)$' \| \
+	 X"$_am_arg" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X"$_am_arg" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`/stamp-h$_am_stamp_count
+ ;;
+
+  :C)  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: executing $ac_file commands" >&5
+printf "%s\n" "$as_me: executing $ac_file commands" >&6;}
+ ;;
+  esac
+
+
+  case $ac_file$ac_mode in
+    "depfiles":C) test x"$AMDEP_TRUE" != x"" || {
+  # Older Autoconf quotes --file arguments for eval, but not when files
+  # are listed without --file.  Let's play safe and only enable the eval
+  # if we detect the quoting.
+  # TODO: see whether this extra hack can be removed once we start
+  # requiring Autoconf 2.70 or later.
+  case $CONFIG_FILES in #(
+  *\'*) :
+    eval set x "$CONFIG_FILES" ;; #(
+  *) :
+    set x $CONFIG_FILES ;; #(
+  *) :
+     ;;
+esac
+  shift
+  # Used to flag and report bootstrapping failures.
+  am_rc=0
+  for am_mf
+  do
+    # Strip MF so we end up with the name of the file.
+    am_mf=`printf "%s\n" "$am_mf" | sed -e 's/:.*$//'`
+    # Check whether this is an Automake generated Makefile which includes
+    # dependency-tracking related rules and includes.
+    # Grep'ing the whole file directly is not great: AIX grep has a line
+    # limit of 2048, but all sed's we know have understand at least 4000.
+    sed -n 's,^am--depfiles:.*,X,p' "$am_mf" | grep X >/dev/null 2>&1 \
+      || continue
+    am_dirpart=`$as_dirname -- "$am_mf" ||
+$as_expr X"$am_mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$am_mf" : 'X\(//\)[^/]' \| \
+	 X"$am_mf" : 'X\(//\)$' \| \
+	 X"$am_mf" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X"$am_mf" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+    am_filepart=`$as_basename -- "$am_mf" ||
+$as_expr X/"$am_mf" : '.*/\([^/][^/]*\)/*$' \| \
+	 X"$am_mf" : 'X\(//\)$' \| \
+	 X"$am_mf" : 'X\(/\)' \| . 2>/dev/null ||
+printf "%s\n" X/"$am_mf" |
+    sed '/^.*\/\([^/][^/]*\)\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\/\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\/\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+    { echo "$as_me:$LINENO: cd "$am_dirpart" \
+      && sed -e '/# am--include-marker/d' "$am_filepart" \
+        | $MAKE -f - am--depfiles" >&5
+   (cd "$am_dirpart" \
+      && sed -e '/# am--include-marker/d' "$am_filepart" \
+        | $MAKE -f - am--depfiles) >&5 2>&5
+   ac_status=$?
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
+   (exit $ac_status); } || am_rc=$?
+  done
+  if test $am_rc -ne 0; then
+    { { printf "%s\n" "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+printf "%s\n" "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "Something went wrong bootstrapping makefile fragments
+    for automatic dependency tracking.  If GNU make was not used, consider
+    re-running the configure script with MAKE=\"gmake\" (or whatever is
+    necessary).  You can also try re-running configure with the
+    '--disable-dependency-tracking' option to at least be able to build
+    the package (albeit without support for automatic dependency tracking).
+See \`config.log' for more details" "$LINENO" 5; }
+  fi
+  { am_dirpart=; unset am_dirpart;}
+  { am_filepart=; unset am_filepart;}
+  { am_mf=; unset am_mf;}
+  { am_rc=; unset am_rc;}
+  rm -f conftest-deps.mk
+}
+ ;;
+
+  esac
+done # for ac_tag
+
+
+as_fn_exit 0
+_ACEOF
+ac_clean_files=$ac_clean_files_save
+
+test $ac_write_fail = 0 ||
+  as_fn_error $? "write failure creating $CONFIG_STATUS" "$LINENO" 5
+
+
+# configure is writing to config.log, and then calls config.status.
+# config.status does its own redirection, appending to config.log.
+# Unfortunately, on DOS this fails, as config.log is still kept open
+# by configure, so config.status won't be able to write to it; its
+# output is simply discarded.  So we exec the FD to /dev/null,
+# effectively closing config.log, so it can be properly (re)opened and
+# appended to by config.status.  When coming back to configure, we
+# need to make the FD available again.
+if test "$no_create" != yes; then
+  ac_cs_success=:
+  ac_config_status_args=
+  test "$silent" = yes &&
+    ac_config_status_args="$ac_config_status_args --quiet"
+  exec 5>/dev/null
+  $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false
+  exec 5>>config.log
+  # Use ||, not &&, to avoid exiting from the if with $? = 1, which
+  # would make configure fail if this is the last instruction.
+  $ac_cs_success || as_fn_exit 1
+fi
+if test -n "$ac_unrecognized_opts" && test "$enable_option_checking" != no; then
+  { printf "%s\n" "$as_me:${as_lineno-$LINENO}: WARNING: unrecognized options: $ac_unrecognized_opts" >&5
+printf "%s\n" "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2;}
+fi
+
+
diff --git a/depcomp b/depcomp
new file mode 100755
index 0000000..715e343
--- /dev/null
+++ b/depcomp
@@ -0,0 +1,791 @@
+#! /bin/sh
+# depcomp - compile a program generating dependencies as side-effects
+
+scriptversion=2018-03-07.03; # UTC
+
+# Copyright (C) 1999-2021 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# Originally written by Alexandre Oliva <oliva@dcc.unicamp.br>.
+
+case $1 in
+  '')
+    echo "$0: No command.  Try '$0 --help' for more information." 1>&2
+    exit 1;
+    ;;
+  -h | --h*)
+    cat <<\EOF
+Usage: depcomp [--help] [--version] PROGRAM [ARGS]
+
+Run PROGRAMS ARGS to compile a file, generating dependencies
+as side-effects.
+
+Environment variables:
+  depmode     Dependency tracking mode.
+  source      Source file read by 'PROGRAMS ARGS'.
+  object      Object file output by 'PROGRAMS ARGS'.
+  DEPDIR      directory where to store dependencies.
+  depfile     Dependency file to output.
+  tmpdepfile  Temporary file to use when outputting dependencies.
+  libtool     Whether libtool is used (yes/no).
+
+Report bugs to <bug-automake@gnu.org>.
+EOF
+    exit $?
+    ;;
+  -v | --v*)
+    echo "depcomp $scriptversion"
+    exit $?
+    ;;
+esac
+
+# Get the directory component of the given path, and save it in the
+# global variables '$dir'.  Note that this directory component will
+# be either empty or ending with a '/' character.  This is deliberate.
+set_dir_from ()
+{
+  case $1 in
+    */*) dir=`echo "$1" | sed -e 's|/[^/]*$|/|'`;;
+      *) dir=;;
+  esac
+}
+
+# Get the suffix-stripped basename of the given path, and save it the
+# global variable '$base'.
+set_base_from ()
+{
+  base=`echo "$1" | sed -e 's|^.*/||' -e 's/\.[^.]*$//'`
+}
+
+# If no dependency file was actually created by the compiler invocation,
+# we still have to create a dummy depfile, to avoid errors with the
+# Makefile "include basename.Plo" scheme.
+make_dummy_depfile ()
+{
+  echo "#dummy" > "$depfile"
+}
+
+# Factor out some common post-processing of the generated depfile.
+# Requires the auxiliary global variable '$tmpdepfile' to be set.
+aix_post_process_depfile ()
+{
+  # If the compiler actually managed to produce a dependency file,
+  # post-process it.
+  if test -f "$tmpdepfile"; then
+    # Each line is of the form 'foo.o: dependency.h'.
+    # Do two passes, one to just change these to
+    #   $object: dependency.h
+    # and one to simply output
+    #   dependency.h:
+    # which is needed to avoid the deleted-header problem.
+    { sed -e "s,^.*\.[$lower]*:,$object:," < "$tmpdepfile"
+      sed -e "s,^.*\.[$lower]*:[$tab ]*,," -e 's,$,:,' < "$tmpdepfile"
+    } > "$depfile"
+    rm -f "$tmpdepfile"
+  else
+    make_dummy_depfile
+  fi
+}
+
+# A tabulation character.
+tab='	'
+# A newline character.
+nl='
+'
+# Character ranges might be problematic outside the C locale.
+# These definitions help.
+upper=ABCDEFGHIJKLMNOPQRSTUVWXYZ
+lower=abcdefghijklmnopqrstuvwxyz
+digits=0123456789
+alpha=${upper}${lower}
+
+if test -z "$depmode" || test -z "$source" || test -z "$object"; then
+  echo "depcomp: Variables source, object and depmode must be set" 1>&2
+  exit 1
+fi
+
+# Dependencies for sub/bar.o or sub/bar.obj go into sub/.deps/bar.Po.
+depfile=${depfile-`echo "$object" |
+  sed 's|[^\\/]*$|'${DEPDIR-.deps}'/&|;s|\.\([^.]*\)$|.P\1|;s|Pobj$|Po|'`}
+tmpdepfile=${tmpdepfile-`echo "$depfile" | sed 's/\.\([^.]*\)$/.T\1/'`}
+
+rm -f "$tmpdepfile"
+
+# Avoid interferences from the environment.
+gccflag= dashmflag=
+
+# Some modes work just like other modes, but use different flags.  We
+# parameterize here, but still list the modes in the big case below,
+# to make depend.m4 easier to write.  Note that we *cannot* use a case
+# here, because this file can only contain one case statement.
+if test "$depmode" = hp; then
+  # HP compiler uses -M and no extra arg.
+  gccflag=-M
+  depmode=gcc
+fi
+
+if test "$depmode" = dashXmstdout; then
+  # This is just like dashmstdout with a different argument.
+  dashmflag=-xM
+  depmode=dashmstdout
+fi
+
+cygpath_u="cygpath -u -f -"
+if test "$depmode" = msvcmsys; then
+  # This is just like msvisualcpp but w/o cygpath translation.
+  # Just convert the backslash-escaped backslashes to single forward
+  # slashes to satisfy depend.m4
+  cygpath_u='sed s,\\\\,/,g'
+  depmode=msvisualcpp
+fi
+
+if test "$depmode" = msvc7msys; then
+  # This is just like msvc7 but w/o cygpath translation.
+  # Just convert the backslash-escaped backslashes to single forward
+  # slashes to satisfy depend.m4
+  cygpath_u='sed s,\\\\,/,g'
+  depmode=msvc7
+fi
+
+if test "$depmode" = xlc; then
+  # IBM C/C++ Compilers xlc/xlC can output gcc-like dependency information.
+  gccflag=-qmakedep=gcc,-MF
+  depmode=gcc
+fi
+
+case "$depmode" in
+gcc3)
+## gcc 3 implements dependency tracking that does exactly what
+## we want.  Yay!  Note: for some reason libtool 1.4 doesn't like
+## it if -MD -MP comes after the -MF stuff.  Hmm.
+## Unfortunately, FreeBSD c89 acceptance of flags depends upon
+## the command line argument order; so add the flags where they
+## appear in depend2.am.  Note that the slowdown incurred here
+## affects only configure: in makefiles, %FASTDEP% shortcuts this.
+  for arg
+  do
+    case $arg in
+    -c) set fnord "$@" -MT "$object" -MD -MP -MF "$tmpdepfile" "$arg" ;;
+    *)  set fnord "$@" "$arg" ;;
+    esac
+    shift # fnord
+    shift # $arg
+  done
+  "$@"
+  stat=$?
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  mv "$tmpdepfile" "$depfile"
+  ;;
+
+gcc)
+## Note that this doesn't just cater to obsosete pre-3.x GCC compilers.
+## but also to in-use compilers like IMB xlc/xlC and the HP C compiler.
+## (see the conditional assignment to $gccflag above).
+## There are various ways to get dependency output from gcc.  Here's
+## why we pick this rather obscure method:
+## - Don't want to use -MD because we'd like the dependencies to end
+##   up in a subdir.  Having to rename by hand is ugly.
+##   (We might end up doing this anyway to support other compilers.)
+## - The DEPENDENCIES_OUTPUT environment variable makes gcc act like
+##   -MM, not -M (despite what the docs say).  Also, it might not be
+##   supported by the other compilers which use the 'gcc' depmode.
+## - Using -M directly means running the compiler twice (even worse
+##   than renaming).
+  if test -z "$gccflag"; then
+    gccflag=-MD,
+  fi
+  "$@" -Wp,"$gccflag$tmpdepfile"
+  stat=$?
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  # The second -e expression handles DOS-style file names with drive
+  # letters.
+  sed -e 's/^[^:]*: / /' \
+      -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile"
+## This next piece of magic avoids the "deleted header file" problem.
+## The problem is that when a header file which appears in a .P file
+## is deleted, the dependency causes make to die (because there is
+## typically no way to rebuild the header).  We avoid this by adding
+## dummy dependencies for each header file.  Too bad gcc doesn't do
+## this for us directly.
+## Some versions of gcc put a space before the ':'.  On the theory
+## that the space means something, we add a space to the output as
+## well.  hp depmode also adds that space, but also prefixes the VPATH
+## to the object.  Take care to not repeat it in the output.
+## Some versions of the HPUX 10.20 sed can't process this invocation
+## correctly.  Breaking it into two sed invocations is a workaround.
+  tr ' ' "$nl" < "$tmpdepfile" \
+    | sed -e 's/^\\$//' -e '/^$/d' -e "s|.*$object$||" -e '/:$/d' \
+    | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+hp)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
+sgi)
+  if test "$libtool" = yes; then
+    "$@" "-Wp,-MDupdate,$tmpdepfile"
+  else
+    "$@" -MDupdate "$tmpdepfile"
+  fi
+  stat=$?
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+
+  if test -f "$tmpdepfile"; then  # yes, the sourcefile depend on other files
+    echo "$object : \\" > "$depfile"
+    # Clip off the initial element (the dependent).  Don't try to be
+    # clever and replace this with sed code, as IRIX sed won't handle
+    # lines with more than a fixed number of characters (4096 in
+    # IRIX 6.2 sed, 8192 in IRIX 6.5).  We also remove comment lines;
+    # the IRIX cc adds comments like '#:fec' to the end of the
+    # dependency line.
+    tr ' ' "$nl" < "$tmpdepfile" \
+      | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' \
+      | tr "$nl" ' ' >> "$depfile"
+    echo >> "$depfile"
+    # The second pass generates a dummy entry for each header file.
+    tr ' ' "$nl" < "$tmpdepfile" \
+      | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \
+      >> "$depfile"
+  else
+    make_dummy_depfile
+  fi
+  rm -f "$tmpdepfile"
+  ;;
+
+xlc)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
+aix)
+  # The C for AIX Compiler uses -M and outputs the dependencies
+  # in a .u file.  In older versions, this file always lives in the
+  # current directory.  Also, the AIX compiler puts '$object:' at the
+  # start of each line; $object doesn't have directory information.
+  # Version 6 uses the directory in both cases.
+  set_dir_from "$object"
+  set_base_from "$object"
+  if test "$libtool" = yes; then
+    tmpdepfile1=$dir$base.u
+    tmpdepfile2=$base.u
+    tmpdepfile3=$dir.libs/$base.u
+    "$@" -Wc,-M
+  else
+    tmpdepfile1=$dir$base.u
+    tmpdepfile2=$dir$base.u
+    tmpdepfile3=$dir$base.u
+    "$@" -M
+  fi
+  stat=$?
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+    exit $stat
+  fi
+
+  for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+  do
+    test -f "$tmpdepfile" && break
+  done
+  aix_post_process_depfile
+  ;;
+
+tcc)
+  # tcc (Tiny C Compiler) understand '-MD -MF file' since version 0.9.26
+  # FIXME: That version still under development at the moment of writing.
+  #        Make that this statement remains true also for stable, released
+  #        versions.
+  # It will wrap lines (doesn't matter whether long or short) with a
+  # trailing '\', as in:
+  #
+  #   foo.o : \
+  #    foo.c \
+  #    foo.h \
+  #
+  # It will put a trailing '\' even on the last line, and will use leading
+  # spaces rather than leading tabs (at least since its commit 0394caf7
+  # "Emit spaces for -MD").
+  "$@" -MD -MF "$tmpdepfile"
+  stat=$?
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  # Each non-empty line is of the form 'foo.o : \' or ' dep.h \'.
+  # We have to change lines of the first kind to '$object: \'.
+  sed -e "s|.*:|$object :|" < "$tmpdepfile" > "$depfile"
+  # And for each line of the second kind, we have to emit a 'dep.h:'
+  # dummy dependency, to avoid the deleted-header problem.
+  sed -n -e 's|^  *\(.*\) *\\$|\1:|p' < "$tmpdepfile" >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+## The order of this option in the case statement is important, since the
+## shell code in configure will try each of these formats in the order
+## listed in this file.  A plain '-MD' option would be understood by many
+## compilers, so we must ensure this comes after the gcc and icc options.
+pgcc)
+  # Portland's C compiler understands '-MD'.
+  # Will always output deps to 'file.d' where file is the root name of the
+  # source file under compilation, even if file resides in a subdirectory.
+  # The object file name does not affect the name of the '.d' file.
+  # pgcc 10.2 will output
+  #    foo.o: sub/foo.c sub/foo.h
+  # and will wrap long lines using '\' :
+  #    foo.o: sub/foo.c ... \
+  #     sub/foo.h ... \
+  #     ...
+  set_dir_from "$object"
+  # Use the source, not the object, to determine the base name, since
+  # that's sadly what pgcc will do too.
+  set_base_from "$source"
+  tmpdepfile=$base.d
+
+  # For projects that build the same source file twice into different object
+  # files, the pgcc approach of using the *source* file root name can cause
+  # problems in parallel builds.  Use a locking strategy to avoid stomping on
+  # the same $tmpdepfile.
+  lockdir=$base.d-lock
+  trap "
+    echo '$0: caught signal, cleaning up...' >&2
+    rmdir '$lockdir'
+    exit 1
+  " 1 2 13 15
+  numtries=100
+  i=$numtries
+  while test $i -gt 0; do
+    # mkdir is a portable test-and-set.
+    if mkdir "$lockdir" 2>/dev/null; then
+      # This process acquired the lock.
+      "$@" -MD
+      stat=$?
+      # Release the lock.
+      rmdir "$lockdir"
+      break
+    else
+      # If the lock is being held by a different process, wait
+      # until the winning process is done or we timeout.
+      while test -d "$lockdir" && test $i -gt 0; do
+        sleep 1
+        i=`expr $i - 1`
+      done
+    fi
+    i=`expr $i - 1`
+  done
+  trap - 1 2 13 15
+  if test $i -le 0; then
+    echo "$0: failed to acquire lock after $numtries attempts" >&2
+    echo "$0: check lockdir '$lockdir'" >&2
+    exit 1
+  fi
+
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  # Each line is of the form `foo.o: dependent.h',
+  # or `foo.o: dep1.h dep2.h \', or ` dep3.h dep4.h \'.
+  # Do two passes, one to just change these to
+  # `$object: dependent.h' and one to simply `dependent.h:'.
+  sed "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile"
+  # Some versions of the HPUX 10.20 sed can't process this invocation
+  # correctly.  Breaking it into two sed invocations is a workaround.
+  sed 's,^[^:]*: \(.*\)$,\1,;s/^\\$//;/^$/d;/:$/d' < "$tmpdepfile" \
+    | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+hp2)
+  # The "hp" stanza above does not work with aCC (C++) and HP's ia64
+  # compilers, which have integrated preprocessors.  The correct option
+  # to use with these is +Maked; it writes dependencies to a file named
+  # 'foo.d', which lands next to the object file, wherever that
+  # happens to be.
+  # Much of this is similar to the tru64 case; see comments there.
+  set_dir_from  "$object"
+  set_base_from "$object"
+  if test "$libtool" = yes; then
+    tmpdepfile1=$dir$base.d
+    tmpdepfile2=$dir.libs/$base.d
+    "$@" -Wc,+Maked
+  else
+    tmpdepfile1=$dir$base.d
+    tmpdepfile2=$dir$base.d
+    "$@" +Maked
+  fi
+  stat=$?
+  if test $stat -ne 0; then
+     rm -f "$tmpdepfile1" "$tmpdepfile2"
+     exit $stat
+  fi
+
+  for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2"
+  do
+    test -f "$tmpdepfile" && break
+  done
+  if test -f "$tmpdepfile"; then
+    sed -e "s,^.*\.[$lower]*:,$object:," "$tmpdepfile" > "$depfile"
+    # Add 'dependent.h:' lines.
+    sed -ne '2,${
+               s/^ *//
+               s/ \\*$//
+               s/$/:/
+               p
+             }' "$tmpdepfile" >> "$depfile"
+  else
+    make_dummy_depfile
+  fi
+  rm -f "$tmpdepfile" "$tmpdepfile2"
+  ;;
+
+tru64)
+  # The Tru64 compiler uses -MD to generate dependencies as a side
+  # effect.  'cc -MD -o foo.o ...' puts the dependencies into 'foo.o.d'.
+  # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put
+  # dependencies in 'foo.d' instead, so we check for that too.
+  # Subdirectories are respected.
+  set_dir_from  "$object"
+  set_base_from "$object"
+
+  if test "$libtool" = yes; then
+    # Libtool generates 2 separate objects for the 2 libraries.  These
+    # two compilations output dependencies in $dir.libs/$base.o.d and
+    # in $dir$base.o.d.  We have to check for both files, because
+    # one of the two compilations can be disabled.  We should prefer
+    # $dir$base.o.d over $dir.libs/$base.o.d because the latter is
+    # automatically cleaned when .libs/ is deleted, while ignoring
+    # the former would cause a distcleancheck panic.
+    tmpdepfile1=$dir$base.o.d          # libtool 1.5
+    tmpdepfile2=$dir.libs/$base.o.d    # Likewise.
+    tmpdepfile3=$dir.libs/$base.d      # Compaq CCC V6.2-504
+    "$@" -Wc,-MD
+  else
+    tmpdepfile1=$dir$base.d
+    tmpdepfile2=$dir$base.d
+    tmpdepfile3=$dir$base.d
+    "$@" -MD
+  fi
+
+  stat=$?
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+    exit $stat
+  fi
+
+  for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+  do
+    test -f "$tmpdepfile" && break
+  done
+  # Same post-processing that is required for AIX mode.
+  aix_post_process_depfile
+  ;;
+
+msvc7)
+  if test "$libtool" = yes; then
+    showIncludes=-Wc,-showIncludes
+  else
+    showIncludes=-showIncludes
+  fi
+  "$@" $showIncludes > "$tmpdepfile"
+  stat=$?
+  grep -v '^Note: including file: ' "$tmpdepfile"
+  if test $stat -ne 0; then
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  # The first sed program below extracts the file names and escapes
+  # backslashes for cygpath.  The second sed program outputs the file
+  # name when reading, but also accumulates all include files in the
+  # hold buffer in order to output them again at the end.  This only
+  # works with sed implementations that can handle large buffers.
+  sed < "$tmpdepfile" -n '
+/^Note: including file:  *\(.*\)/ {
+  s//\1/
+  s/\\/\\\\/g
+  p
+}' | $cygpath_u | sort -u | sed -n '
+s/ /\\ /g
+s/\(.*\)/'"$tab"'\1 \\/p
+s/.\(.*\) \\/\1:/
+H
+$ {
+  s/.*/'"$tab"'/
+  G
+  p
+}' >> "$depfile"
+  echo >> "$depfile" # make sure the fragment doesn't end with a backslash
+  rm -f "$tmpdepfile"
+  ;;
+
+msvc7msys)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
+#nosideeffect)
+  # This comment above is used by automake to tell side-effect
+  # dependency tracking mechanisms from slower ones.
+
+dashmstdout)
+  # Important note: in order to support this mode, a compiler *must*
+  # always write the preprocessed file to stdout, regardless of -o.
+  "$@" || exit $?
+
+  # Remove the call to Libtool.
+  if test "$libtool" = yes; then
+    while test "X$1" != 'X--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+
+  # Remove '-o $object'.
+  IFS=" "
+  for arg
+  do
+    case $arg in
+    -o)
+      shift
+      ;;
+    $object)
+      shift
+      ;;
+    *)
+      set fnord "$@" "$arg"
+      shift # fnord
+      shift # $arg
+      ;;
+    esac
+  done
+
+  test -z "$dashmflag" && dashmflag=-M
+  # Require at least two characters before searching for ':'
+  # in the target name.  This is to cope with DOS-style filenames:
+  # a dependency such as 'c:/foo/bar' could be seen as target 'c' otherwise.
+  "$@" $dashmflag |
+    sed "s|^[$tab ]*[^:$tab ][^:][^:]*:[$tab ]*|$object: |" > "$tmpdepfile"
+  rm -f "$depfile"
+  cat < "$tmpdepfile" > "$depfile"
+  # Some versions of the HPUX 10.20 sed can't process this sed invocation
+  # correctly.  Breaking it into two sed invocations is a workaround.
+  tr ' ' "$nl" < "$tmpdepfile" \
+    | sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' \
+    | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+dashXmstdout)
+  # This case only exists to satisfy depend.m4.  It is never actually
+  # run, as this mode is specially recognized in the preamble.
+  exit 1
+  ;;
+
+makedepend)
+  "$@" || exit $?
+  # Remove any Libtool call
+  if test "$libtool" = yes; then
+    while test "X$1" != 'X--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+  # X makedepend
+  shift
+  cleared=no eat=no
+  for arg
+  do
+    case $cleared in
+    no)
+      set ""; shift
+      cleared=yes ;;
+    esac
+    if test $eat = yes; then
+      eat=no
+      continue
+    fi
+    case "$arg" in
+    -D*|-I*)
+      set fnord "$@" "$arg"; shift ;;
+    # Strip any option that makedepend may not understand.  Remove
+    # the object too, otherwise makedepend will parse it as a source file.
+    -arch)
+      eat=yes ;;
+    -*|$object)
+      ;;
+    *)
+      set fnord "$@" "$arg"; shift ;;
+    esac
+  done
+  obj_suffix=`echo "$object" | sed 's/^.*\././'`
+  touch "$tmpdepfile"
+  ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"
+  rm -f "$depfile"
+  # makedepend may prepend the VPATH from the source file name to the object.
+  # No need to regex-escape $object, excess matching of '.' is harmless.
+  sed "s|^.*\($object *:\)|\1|" "$tmpdepfile" > "$depfile"
+  # Some versions of the HPUX 10.20 sed can't process the last invocation
+  # correctly.  Breaking it into two sed invocations is a workaround.
+  sed '1,2d' "$tmpdepfile" \
+    | tr ' ' "$nl" \
+    | sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' \
+    | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile" "$tmpdepfile".bak
+  ;;
+
+cpp)
+  # Important note: in order to support this mode, a compiler *must*
+  # always write the preprocessed file to stdout.
+  "$@" || exit $?
+
+  # Remove the call to Libtool.
+  if test "$libtool" = yes; then
+    while test "X$1" != 'X--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+
+  # Remove '-o $object'.
+  IFS=" "
+  for arg
+  do
+    case $arg in
+    -o)
+      shift
+      ;;
+    $object)
+      shift
+      ;;
+    *)
+      set fnord "$@" "$arg"
+      shift # fnord
+      shift # $arg
+      ;;
+    esac
+  done
+
+  "$@" -E \
+    | sed -n -e '/^# [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
+             -e '/^#line [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
+    | sed '$ s: \\$::' > "$tmpdepfile"
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  cat < "$tmpdepfile" >> "$depfile"
+  sed < "$tmpdepfile" '/^$/d;s/^ //;s/ \\$//;s/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+msvisualcpp)
+  # Important note: in order to support this mode, a compiler *must*
+  # always write the preprocessed file to stdout.
+  "$@" || exit $?
+
+  # Remove the call to Libtool.
+  if test "$libtool" = yes; then
+    while test "X$1" != 'X--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+
+  IFS=" "
+  for arg
+  do
+    case "$arg" in
+    -o)
+      shift
+      ;;
+    $object)
+      shift
+      ;;
+    "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI")
+        set fnord "$@"
+        shift
+        shift
+        ;;
+    *)
+        set fnord "$@" "$arg"
+        shift
+        shift
+        ;;
+    esac
+  done
+  "$@" -E 2>/dev/null |
+  sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::\1:p' | $cygpath_u | sort -u > "$tmpdepfile"
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::'"$tab"'\1 \\:p' >> "$depfile"
+  echo "$tab" >> "$depfile"
+  sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::\1\::p' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+msvcmsys)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
+none)
+  exec "$@"
+  ;;
+
+*)
+  echo "Unknown depmode $depmode" 1>&2
+  exit 1
+  ;;
+esac
+
+exit 0
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC0"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/install-sh b/install-sh
new file mode 100755
index 0000000..ec298b5
--- /dev/null
+++ b/install-sh
@@ -0,0 +1,541 @@
+#!/bin/sh
+# install - install a program, script, or datafile
+
+scriptversion=2020-11-14.01; # UTC
+
+# This originates from X11R5 (mit/util/scripts/install.sh), which was
+# later released in X11R6 (xc/config/util/install.sh) with the
+# following copyright and license.
+#
+# Copyright (C) 1994 X Consortium
+#
+# Permission is hereby granted, free of charge, to any person obtaining a copy
+# of this software and associated documentation files (the "Software"), to
+# deal in the Software without restriction, including without limitation the
+# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
+# sell copies of the Software, and to permit persons to whom the Software is
+# furnished to do so, subject to the following conditions:
+#
+# The above copyright notice and this permission notice shall be included in
+# all copies or substantial portions of the Software.
+#
+# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.  IN NO EVENT SHALL THE
+# X CONSORTIUM BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN
+# AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNEC-
+# TION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+#
+# Except as contained in this notice, the name of the X Consortium shall not
+# be used in advertising or otherwise to promote the sale, use or other deal-
+# ings in this Software without prior written authorization from the X Consor-
+# tium.
+#
+#
+# FSF changes to this file are in the public domain.
+#
+# Calling this script install-sh is preferred over install.sh, to prevent
+# 'make' implicit rules from creating a file called install from it
+# when there is no Makefile.
+#
+# This script is compatible with the BSD install script, but was written
+# from scratch.
+
+tab='	'
+nl='
+'
+IFS=" $tab$nl"
+
+# Set DOITPROG to "echo" to test this script.
+
+doit=${DOITPROG-}
+doit_exec=${doit:-exec}
+
+# Put in absolute file names if you don't have them in your path;
+# or use environment vars.
+
+chgrpprog=${CHGRPPROG-chgrp}
+chmodprog=${CHMODPROG-chmod}
+chownprog=${CHOWNPROG-chown}
+cmpprog=${CMPPROG-cmp}
+cpprog=${CPPROG-cp}
+mkdirprog=${MKDIRPROG-mkdir}
+mvprog=${MVPROG-mv}
+rmprog=${RMPROG-rm}
+stripprog=${STRIPPROG-strip}
+
+posix_mkdir=
+
+# Desired mode of installed file.
+mode=0755
+
+# Create dirs (including intermediate dirs) using mode 755.
+# This is like GNU 'install' as of coreutils 8.32 (2020).
+mkdir_umask=22
+
+backupsuffix=
+chgrpcmd=
+chmodcmd=$chmodprog
+chowncmd=
+mvcmd=$mvprog
+rmcmd="$rmprog -f"
+stripcmd=
+
+src=
+dst=
+dir_arg=
+dst_arg=
+
+copy_on_change=false
+is_target_a_directory=possibly
+
+usage="\
+Usage: $0 [OPTION]... [-T] SRCFILE DSTFILE
+   or: $0 [OPTION]... SRCFILES... DIRECTORY
+   or: $0 [OPTION]... -t DIRECTORY SRCFILES...
+   or: $0 [OPTION]... -d DIRECTORIES...
+
+In the 1st form, copy SRCFILE to DSTFILE.
+In the 2nd and 3rd, copy all SRCFILES to DIRECTORY.
+In the 4th, create DIRECTORIES.
+
+Options:
+     --help     display this help and exit.
+     --version  display version info and exit.
+
+  -c            (ignored)
+  -C            install only if different (preserve data modification time)
+  -d            create directories instead of installing files.
+  -g GROUP      $chgrpprog installed files to GROUP.
+  -m MODE       $chmodprog installed files to MODE.
+  -o USER       $chownprog installed files to USER.
+  -p            pass -p to $cpprog.
+  -s            $stripprog installed files.
+  -S SUFFIX     attempt to back up existing files, with suffix SUFFIX.
+  -t DIRECTORY  install into DIRECTORY.
+  -T            report an error if DSTFILE is a directory.
+
+Environment variables override the default commands:
+  CHGRPPROG CHMODPROG CHOWNPROG CMPPROG CPPROG MKDIRPROG MVPROG
+  RMPROG STRIPPROG
+
+By default, rm is invoked with -f; when overridden with RMPROG,
+it's up to you to specify -f if you want it.
+
+If -S is not specified, no backups are attempted.
+
+Email bug reports to bug-automake@gnu.org.
+Automake home page: https://www.gnu.org/software/automake/
+"
+
+while test $# -ne 0; do
+  case $1 in
+    -c) ;;
+
+    -C) copy_on_change=true;;
+
+    -d) dir_arg=true;;
+
+    -g) chgrpcmd="$chgrpprog $2"
+        shift;;
+
+    --help) echo "$usage"; exit $?;;
+
+    -m) mode=$2
+        case $mode in
+          *' '* | *"$tab"* | *"$nl"* | *'*'* | *'?'* | *'['*)
+            echo "$0: invalid mode: $mode" >&2
+            exit 1;;
+        esac
+        shift;;
+
+    -o) chowncmd="$chownprog $2"
+        shift;;
+
+    -p) cpprog="$cpprog -p";;
+
+    -s) stripcmd=$stripprog;;
+
+    -S) backupsuffix="$2"
+        shift;;
+
+    -t)
+        is_target_a_directory=always
+        dst_arg=$2
+        # Protect names problematic for 'test' and other utilities.
+        case $dst_arg in
+          -* | [=\(\)!]) dst_arg=./$dst_arg;;
+        esac
+        shift;;
+
+    -T) is_target_a_directory=never;;
+
+    --version) echo "$0 $scriptversion"; exit $?;;
+
+    --) shift
+        break;;
+
+    -*) echo "$0: invalid option: $1" >&2
+        exit 1;;
+
+    *)  break;;
+  esac
+  shift
+done
+
+# We allow the use of options -d and -T together, by making -d
+# take the precedence; this is for compatibility with GNU install.
+
+if test -n "$dir_arg"; then
+  if test -n "$dst_arg"; then
+    echo "$0: target directory not allowed when installing a directory." >&2
+    exit 1
+  fi
+fi
+
+if test $# -ne 0 && test -z "$dir_arg$dst_arg"; then
+  # When -d is used, all remaining arguments are directories to create.
+  # When -t is used, the destination is already specified.
+  # Otherwise, the last argument is the destination.  Remove it from $@.
+  for arg
+  do
+    if test -n "$dst_arg"; then
+      # $@ is not empty: it contains at least $arg.
+      set fnord "$@" "$dst_arg"
+      shift # fnord
+    fi
+    shift # arg
+    dst_arg=$arg
+    # Protect names problematic for 'test' and other utilities.
+    case $dst_arg in
+      -* | [=\(\)!]) dst_arg=./$dst_arg;;
+    esac
+  done
+fi
+
+if test $# -eq 0; then
+  if test -z "$dir_arg"; then
+    echo "$0: no input file specified." >&2
+    exit 1
+  fi
+  # It's OK to call 'install-sh -d' without argument.
+  # This can happen when creating conditional directories.
+  exit 0
+fi
+
+if test -z "$dir_arg"; then
+  if test $# -gt 1 || test "$is_target_a_directory" = always; then
+    if test ! -d "$dst_arg"; then
+      echo "$0: $dst_arg: Is not a directory." >&2
+      exit 1
+    fi
+  fi
+fi
+
+if test -z "$dir_arg"; then
+  do_exit='(exit $ret); exit $ret'
+  trap "ret=129; $do_exit" 1
+  trap "ret=130; $do_exit" 2
+  trap "ret=141; $do_exit" 13
+  trap "ret=143; $do_exit" 15
+
+  # Set umask so as not to create temps with too-generous modes.
+  # However, 'strip' requires both read and write access to temps.
+  case $mode in
+    # Optimize common cases.
+    *644) cp_umask=133;;
+    *755) cp_umask=22;;
+
+    *[0-7])
+      if test -z "$stripcmd"; then
+        u_plus_rw=
+      else
+        u_plus_rw='% 200'
+      fi
+      cp_umask=`expr '(' 777 - $mode % 1000 ')' $u_plus_rw`;;
+    *)
+      if test -z "$stripcmd"; then
+        u_plus_rw=
+      else
+        u_plus_rw=,u+rw
+      fi
+      cp_umask=$mode$u_plus_rw;;
+  esac
+fi
+
+for src
+do
+  # Protect names problematic for 'test' and other utilities.
+  case $src in
+    -* | [=\(\)!]) src=./$src;;
+  esac
+
+  if test -n "$dir_arg"; then
+    dst=$src
+    dstdir=$dst
+    test -d "$dstdir"
+    dstdir_status=$?
+    # Don't chown directories that already exist.
+    if test $dstdir_status = 0; then
+      chowncmd=""
+    fi
+  else
+
+    # Waiting for this to be detected by the "$cpprog $src $dsttmp" command
+    # might cause directories to be created, which would be especially bad
+    # if $src (and thus $dsttmp) contains '*'.
+    if test ! -f "$src" && test ! -d "$src"; then
+      echo "$0: $src does not exist." >&2
+      exit 1
+    fi
+
+    if test -z "$dst_arg"; then
+      echo "$0: no destination specified." >&2
+      exit 1
+    fi
+    dst=$dst_arg
+
+    # If destination is a directory, append the input filename.
+    if test -d "$dst"; then
+      if test "$is_target_a_directory" = never; then
+        echo "$0: $dst_arg: Is a directory" >&2
+        exit 1
+      fi
+      dstdir=$dst
+      dstbase=`basename "$src"`
+      case $dst in
+	*/) dst=$dst$dstbase;;
+	*)  dst=$dst/$dstbase;;
+      esac
+      dstdir_status=0
+    else
+      dstdir=`dirname "$dst"`
+      test -d "$dstdir"
+      dstdir_status=$?
+    fi
+  fi
+
+  case $dstdir in
+    */) dstdirslash=$dstdir;;
+    *)  dstdirslash=$dstdir/;;
+  esac
+
+  obsolete_mkdir_used=false
+
+  if test $dstdir_status != 0; then
+    case $posix_mkdir in
+      '')
+        # With -d, create the new directory with the user-specified mode.
+        # Otherwise, rely on $mkdir_umask.
+        if test -n "$dir_arg"; then
+          mkdir_mode=-m$mode
+        else
+          mkdir_mode=
+        fi
+
+        posix_mkdir=false
+	# The $RANDOM variable is not portable (e.g., dash).  Use it
+	# here however when possible just to lower collision chance.
+	tmpdir=${TMPDIR-/tmp}/ins$RANDOM-$$
+
+	trap '
+	  ret=$?
+	  rmdir "$tmpdir/a/b" "$tmpdir/a" "$tmpdir" 2>/dev/null
+	  exit $ret
+	' 0
+
+	# Because "mkdir -p" follows existing symlinks and we likely work
+	# directly in world-writeable /tmp, make sure that the '$tmpdir'
+	# directory is successfully created first before we actually test
+	# 'mkdir -p'.
+	if (umask $mkdir_umask &&
+	    $mkdirprog $mkdir_mode "$tmpdir" &&
+	    exec $mkdirprog $mkdir_mode -p -- "$tmpdir/a/b") >/dev/null 2>&1
+	then
+	  if test -z "$dir_arg" || {
+	       # Check for POSIX incompatibilities with -m.
+	       # HP-UX 11.23 and IRIX 6.5 mkdir -m -p sets group- or
+	       # other-writable bit of parent directory when it shouldn't.
+	       # FreeBSD 6.1 mkdir -m -p sets mode of existing directory.
+	       test_tmpdir="$tmpdir/a"
+	       ls_ld_tmpdir=`ls -ld "$test_tmpdir"`
+	       case $ls_ld_tmpdir in
+		 d????-?r-*) different_mode=700;;
+		 d????-?--*) different_mode=755;;
+		 *) false;;
+	       esac &&
+	       $mkdirprog -m$different_mode -p -- "$test_tmpdir" && {
+		 ls_ld_tmpdir_1=`ls -ld "$test_tmpdir"`
+		 test "$ls_ld_tmpdir" = "$ls_ld_tmpdir_1"
+	       }
+	     }
+	  then posix_mkdir=:
+	  fi
+	  rmdir "$tmpdir/a/b" "$tmpdir/a" "$tmpdir"
+	else
+	  # Remove any dirs left behind by ancient mkdir implementations.
+	  rmdir ./$mkdir_mode ./-p ./-- "$tmpdir" 2>/dev/null
+	fi
+	trap '' 0;;
+    esac
+
+    if
+      $posix_mkdir && (
+        umask $mkdir_umask &&
+        $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir"
+      )
+    then :
+    else
+
+      # mkdir does not conform to POSIX,
+      # or it failed possibly due to a race condition.  Create the
+      # directory the slow way, step by step, checking for races as we go.
+
+      case $dstdir in
+        /*) prefix='/';;
+        [-=\(\)!]*) prefix='./';;
+        *)  prefix='';;
+      esac
+
+      oIFS=$IFS
+      IFS=/
+      set -f
+      set fnord $dstdir
+      shift
+      set +f
+      IFS=$oIFS
+
+      prefixes=
+
+      for d
+      do
+        test X"$d" = X && continue
+
+        prefix=$prefix$d
+        if test -d "$prefix"; then
+          prefixes=
+        else
+          if $posix_mkdir; then
+            (umask $mkdir_umask &&
+             $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir") && break
+            # Don't fail if two instances are running concurrently.
+            test -d "$prefix" || exit 1
+          else
+            case $prefix in
+              *\'*) qprefix=`echo "$prefix" | sed "s/'/'\\\\\\\\''/g"`;;
+              *) qprefix=$prefix;;
+            esac
+            prefixes="$prefixes '$qprefix'"
+          fi
+        fi
+        prefix=$prefix/
+      done
+
+      if test -n "$prefixes"; then
+        # Don't fail if two instances are running concurrently.
+        (umask $mkdir_umask &&
+         eval "\$doit_exec \$mkdirprog $prefixes") ||
+          test -d "$dstdir" || exit 1
+        obsolete_mkdir_used=true
+      fi
+    fi
+  fi
+
+  if test -n "$dir_arg"; then
+    { test -z "$chowncmd" || $doit $chowncmd "$dst"; } &&
+    { test -z "$chgrpcmd" || $doit $chgrpcmd "$dst"; } &&
+    { test "$obsolete_mkdir_used$chowncmd$chgrpcmd" = false ||
+      test -z "$chmodcmd" || $doit $chmodcmd $mode "$dst"; } || exit 1
+  else
+
+    # Make a couple of temp file names in the proper directory.
+    dsttmp=${dstdirslash}_inst.$$_
+    rmtmp=${dstdirslash}_rm.$$_
+
+    # Trap to clean up those temp files at exit.
+    trap 'ret=$?; rm -f "$dsttmp" "$rmtmp" && exit $ret' 0
+
+    # Copy the file name to the temp name.
+    (umask $cp_umask &&
+     { test -z "$stripcmd" || {
+	 # Create $dsttmp read-write so that cp doesn't create it read-only,
+	 # which would cause strip to fail.
+	 if test -z "$doit"; then
+	   : >"$dsttmp" # No need to fork-exec 'touch'.
+	 else
+	   $doit touch "$dsttmp"
+	 fi
+       }
+     } &&
+     $doit_exec $cpprog "$src" "$dsttmp") &&
+
+    # and set any options; do chmod last to preserve setuid bits.
+    #
+    # If any of these fail, we abort the whole thing.  If we want to
+    # ignore errors from any of these, just make sure not to ignore
+    # errors from the above "$doit $cpprog $src $dsttmp" command.
+    #
+    { test -z "$chowncmd" || $doit $chowncmd "$dsttmp"; } &&
+    { test -z "$chgrpcmd" || $doit $chgrpcmd "$dsttmp"; } &&
+    { test -z "$stripcmd" || $doit $stripcmd "$dsttmp"; } &&
+    { test -z "$chmodcmd" || $doit $chmodcmd $mode "$dsttmp"; } &&
+
+    # If -C, don't bother to copy if it wouldn't change the file.
+    if $copy_on_change &&
+       old=`LC_ALL=C ls -dlL "$dst"     2>/dev/null` &&
+       new=`LC_ALL=C ls -dlL "$dsttmp"  2>/dev/null` &&
+       set -f &&
+       set X $old && old=:$2:$4:$5:$6 &&
+       set X $new && new=:$2:$4:$5:$6 &&
+       set +f &&
+       test "$old" = "$new" &&
+       $cmpprog "$dst" "$dsttmp" >/dev/null 2>&1
+    then
+      rm -f "$dsttmp"
+    else
+      # If $backupsuffix is set, and the file being installed
+      # already exists, attempt a backup.  Don't worry if it fails,
+      # e.g., if mv doesn't support -f.
+      if test -n "$backupsuffix" && test -f "$dst"; then
+        $doit $mvcmd -f "$dst" "$dst$backupsuffix" 2>/dev/null
+      fi
+
+      # Rename the file to the real destination.
+      $doit $mvcmd -f "$dsttmp" "$dst" 2>/dev/null ||
+
+      # The rename failed, perhaps because mv can't rename something else
+      # to itself, or perhaps because mv is so ancient that it does not
+      # support -f.
+      {
+        # Now remove or move aside any old file at destination location.
+        # We try this two ways since rm can't unlink itself on some
+        # systems and the destination file might be busy for other
+        # reasons.  In this case, the final cleanup might fail but the new
+        # file should still install successfully.
+        {
+          test ! -f "$dst" ||
+          $doit $rmcmd "$dst" 2>/dev/null ||
+          { $doit $mvcmd -f "$dst" "$rmtmp" 2>/dev/null &&
+            { $doit $rmcmd "$rmtmp" 2>/dev/null; :; }
+          } ||
+          { echo "$0: cannot unlink or rename $dst" >&2
+            (exit 1); exit 1
+          }
+        } &&
+
+        # Now rename the file to the real destination.
+        $doit $mvcmd "$dsttmp" "$dst"
+      }
+    fi || exit 1
+
+    trap '' 0
+  fi
+done
+
+# Local variables:
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC0"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/missing b/missing
new file mode 100755
index 0000000..1fe1611
--- /dev/null
+++ b/missing
@@ -0,0 +1,215 @@
+#! /bin/sh
+# Common wrapper for a few potentially missing GNU programs.
+
+scriptversion=2018-03-07.03; # UTC
+
+# Copyright (C) 1996-2021 Free Software Foundation, Inc.
+# Originally written by Fran,cois Pinard <pinard@iro.umontreal.ca>, 1996.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+if test $# -eq 0; then
+  echo 1>&2 "Try '$0 --help' for more information"
+  exit 1
+fi
+
+case $1 in
+
+  --is-lightweight)
+    # Used by our autoconf macros to check whether the available missing
+    # script is modern enough.
+    exit 0
+    ;;
+
+  --run)
+    # Back-compat with the calling convention used by older automake.
+    shift
+    ;;
+
+  -h|--h|--he|--hel|--help)
+    echo "\
+$0 [OPTION]... PROGRAM [ARGUMENT]...
+
+Run 'PROGRAM [ARGUMENT]...', returning a proper advice when this fails due
+to PROGRAM being missing or too old.
+
+Options:
+  -h, --help      display this help and exit
+  -v, --version   output version information and exit
+
+Supported PROGRAM values:
+  aclocal   autoconf  autoheader   autom4te  automake  makeinfo
+  bison     yacc      flex         lex       help2man
+
+Version suffixes to PROGRAM as well as the prefixes 'gnu-', 'gnu', and
+'g' are ignored when checking the name.
+
+Send bug reports to <bug-automake@gnu.org>."
+    exit $?
+    ;;
+
+  -v|--v|--ve|--ver|--vers|--versi|--versio|--version)
+    echo "missing $scriptversion (GNU Automake)"
+    exit $?
+    ;;
+
+  -*)
+    echo 1>&2 "$0: unknown '$1' option"
+    echo 1>&2 "Try '$0 --help' for more information"
+    exit 1
+    ;;
+
+esac
+
+# Run the given program, remember its exit status.
+"$@"; st=$?
+
+# If it succeeded, we are done.
+test $st -eq 0 && exit 0
+
+# Also exit now if we it failed (or wasn't found), and '--version' was
+# passed; such an option is passed most likely to detect whether the
+# program is present and works.
+case $2 in --version|--help) exit $st;; esac
+
+# Exit code 63 means version mismatch.  This often happens when the user
+# tries to use an ancient version of a tool on a file that requires a
+# minimum version.
+if test $st -eq 63; then
+  msg="probably too old"
+elif test $st -eq 127; then
+  # Program was missing.
+  msg="missing on your system"
+else
+  # Program was found and executed, but failed.  Give up.
+  exit $st
+fi
+
+perl_URL=https://www.perl.org/
+flex_URL=https://github.com/westes/flex
+gnu_software_URL=https://www.gnu.org/software
+
+program_details ()
+{
+  case $1 in
+    aclocal|automake)
+      echo "The '$1' program is part of the GNU Automake package:"
+      echo "<$gnu_software_URL/automake>"
+      echo "It also requires GNU Autoconf, GNU m4 and Perl in order to run:"
+      echo "<$gnu_software_URL/autoconf>"
+      echo "<$gnu_software_URL/m4/>"
+      echo "<$perl_URL>"
+      ;;
+    autoconf|autom4te|autoheader)
+      echo "The '$1' program is part of the GNU Autoconf package:"
+      echo "<$gnu_software_URL/autoconf/>"
+      echo "It also requires GNU m4 and Perl in order to run:"
+      echo "<$gnu_software_URL/m4/>"
+      echo "<$perl_URL>"
+      ;;
+  esac
+}
+
+give_advice ()
+{
+  # Normalize program name to check for.
+  normalized_program=`echo "$1" | sed '
+    s/^gnu-//; t
+    s/^gnu//; t
+    s/^g//; t'`
+
+  printf '%s\n' "'$1' is $msg."
+
+  configure_deps="'configure.ac' or m4 files included by 'configure.ac'"
+  case $normalized_program in
+    autoconf*)
+      echo "You should only need it if you modified 'configure.ac',"
+      echo "or m4 files included by it."
+      program_details 'autoconf'
+      ;;
+    autoheader*)
+      echo "You should only need it if you modified 'acconfig.h' or"
+      echo "$configure_deps."
+      program_details 'autoheader'
+      ;;
+    automake*)
+      echo "You should only need it if you modified 'Makefile.am' or"
+      echo "$configure_deps."
+      program_details 'automake'
+      ;;
+    aclocal*)
+      echo "You should only need it if you modified 'acinclude.m4' or"
+      echo "$configure_deps."
+      program_details 'aclocal'
+      ;;
+   autom4te*)
+      echo "You might have modified some maintainer files that require"
+      echo "the 'autom4te' program to be rebuilt."
+      program_details 'autom4te'
+      ;;
+    bison*|yacc*)
+      echo "You should only need it if you modified a '.y' file."
+      echo "You may want to install the GNU Bison package:"
+      echo "<$gnu_software_URL/bison/>"
+      ;;
+    lex*|flex*)
+      echo "You should only need it if you modified a '.l' file."
+      echo "You may want to install the Fast Lexical Analyzer package:"
+      echo "<$flex_URL>"
+      ;;
+    help2man*)
+      echo "You should only need it if you modified a dependency" \
+           "of a man page."
+      echo "You may want to install the GNU Help2man package:"
+      echo "<$gnu_software_URL/help2man/>"
+    ;;
+    makeinfo*)
+      echo "You should only need it if you modified a '.texi' file, or"
+      echo "any other file indirectly affecting the aspect of the manual."
+      echo "You might want to install the Texinfo package:"
+      echo "<$gnu_software_URL/texinfo/>"
+      echo "The spurious makeinfo call might also be the consequence of"
+      echo "using a buggy 'make' (AIX, DU, IRIX), in which case you might"
+      echo "want to install GNU make:"
+      echo "<$gnu_software_URL/make/>"
+      ;;
+    *)
+      echo "You might have modified some files without having the proper"
+      echo "tools for further handling them.  Check the 'README' file, it"
+      echo "often tells you about the needed prerequisites for installing"
+      echo "this package.  You may also peek at any GNU archive site, in"
+      echo "case some other package contains this missing '$1' program."
+      ;;
+  esac
+}
+
+give_advice "$1" | sed -e '1s/^/WARNING: /' \
+                       -e '2,$s/^/         /' >&2
+
+# Propagate the correct exit status (expected to be 127 for a program
+# not found, 63 for a program that failed due to version mismatch).
+exit $st
+
+# Local variables:
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC0"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/ntHash-logo.jpg b/ntHash-logo.jpg
deleted file mode 100644
index df64f76..0000000
Binary files a/ntHash-logo.jpg and /dev/null differ
diff --git a/nthash-logo.png b/nthash-logo.png
deleted file mode 100644
index 7614cf0..0000000
Binary files a/nthash-logo.png and /dev/null differ
diff --git a/ssHashIterator.hpp b/ssHashIterator.hpp
deleted file mode 100644
index 61c8830..0000000
--- a/ssHashIterator.hpp
+++ /dev/null
@@ -1,124 +0,0 @@
-#ifndef SSHASH__ITERATOR_H
-#define SSHASH__ITERATOR_H 1
-
-#include <string>
-#include <limits>
-#include "nthash.hpp"
-
-
-/**
- * Iterate over hash values for k-mers in a
- * given DNA sequence.
- *
- * This implementation uses ntHash
- * function to efficiently calculate
- * hash values for successive k-mers.
- */
-
-class ssHashIterator
-{
-
-public:
-
-    /**
-     * Default constructor. Creates an iterator pointing to
-     * the end of the iterator range.
-    */
-    ssHashIterator():
-        m_pos(std::numeric_limits<std::size_t>::max())
-    {}
-
-    /**
-     * Constructor.
-     * @param seq address of DNA sequence to be hashed
-     * @param k k-mer size
-     * @param h number of hashes
-    */
-    ssHashIterator(const std::string& seq, const std::vector<bool>& seed, unsigned k, size_t pos = 0):
-        m_seq(seq), m_seed(seed), m_k(k), m_hVal(0), m_sVal(0), m_pos(pos)
-    {
-        init();
-    }
-
-    /** Initialize internal state of iterator */
-    void init()
-    {
-        if (m_k > m_seq.length()) {
-            m_pos = std::numeric_limits<std::size_t>::max();
-            return;
-        }
-        m_sVal = NTS64(m_seq.data()+m_pos, m_seed, m_k, m_hVal);
-    }
-
-    /** Advance iterator right to the next valid k-mer */
-    void next()
-    {
-        ++m_pos;
-        if (m_pos >= m_seq.length()-m_k+1) {
-            m_pos = std::numeric_limits<std::size_t>::max();
-            return;
-        }
-        m_sVal = NTS64(m_seq.data()+m_pos, m_seed, m_seq.at(m_pos-1), m_seq.at(m_pos-1+m_k), m_k, m_hVal);
-    }
-
-    size_t pos() const {
-        return m_pos;
-    }
-
-    /** get pointer to hash values for current k-mer */
-    uint64_t operator*() const
-    {
-        return m_sVal;
-    }
-
-    /** test equality with another iterator */
-    bool operator==(const ssHashIterator& it) const
-    {
-        return m_pos == it.m_pos;
-    }
-
-    /** test inequality with another iterator */
-    bool operator!=(const ssHashIterator& it) const
-    {
-        return !(*this == it);
-    }
-
-    /** pre-increment operator */
-    ssHashIterator& operator++()
-    {
-        next();
-        return *this;
-    }
-
-    /** iterator pointing to one past last element */
-    static const ssHashIterator end()
-    {
-        return ssHashIterator();
-    }
-
-    /** destructor */
-    ~ssHashIterator() {
-    }
-
-private:
-
-    /** DNA sequence */
-    std::string m_seq;
-
-    /** spaced seed */
-    std::vector<bool> m_seed;
-
-    /** k-mer size */
-    unsigned m_k;
-
-    /** hash value */
-    uint64_t m_hVal;
-
-    /** hash value */
-    uint64_t m_sVal;
-
-    /** position of current k-mer */
-    size_t m_pos;
-};
-
-#endif
diff --git a/sstest.cpp b/sstest.cpp
deleted file mode 100644
index 0d53b2f..0000000
--- a/sstest.cpp
+++ /dev/null
@@ -1,28 +0,0 @@
-#include <iostream>
-#include <string>
-#include <vector>
-#include "ssHashIterator.hpp"
-
-using namespace std;
-
-int main()
-{
-    /* test sequence */
-    std::string seq = "GAGTGTCAAACATTCAGACAACAGCAGGGGTGCTCTGGAATCCTATGTGAGGAACAAACATTCAGGCCACAGTAG";
-
-    /* seed is the spaced seed */
-    std::string seedStr("110001100111000001110100110110100010011101");
-
-    std::vector<bool> seed;
-    for(auto p : seedStr)
-        seed.push_back(p=='1');
-
-    ssHashIterator ssitr(seq, seed, seed.size());
-
-    while (ssitr != ssitr.end()) {
-        std::cout << *ssitr << std::endl;
-        ++ssitr;
-    }
-
-    return 0;
-}
\ No newline at end of file
diff --git a/sttest.cpp b/sttest.cpp
deleted file mode 100644
index 9c92813..0000000
--- a/sttest.cpp
+++ /dev/null
@@ -1,53 +0,0 @@
-#include <iostream>
-#include <fstream>
-#include <string>
-#include <vector>
-#include "stHashIterator.hpp"
-using namespace std;
-
-int main(int argc, const char *argv[])
-{
-    size_t countOnes=0;
-    
-    std::vector<std::string> seedString;
-    seedString.push_back("110001100111000001110100110110100010011101");
-    seedString.push_back("000001111100101110111000001011010100011110");
-    seedString.push_back("011110001010110100000111011101001111100000");
-    seedString.push_back("101110010001011011001011100000111001100011");
-    
-    
-    /* test sequence */
-    //std::string seq = "GAGTGTCAAACATTCAGACAACAGCAGGGGTGCTCTGGAATCCTATGTGAGGAACAAACATTCAGGCCACAGTAG";
-    
-    /* h is the number of spaced seeds and k is the length of spaced seeds */
-    unsigned h, k;
-    h = seedString.size();
-    k = seedString[0].size();
-    
-    std::vector<std::vector<unsigned> > seedSet = parseSeed(seedString);
-    
-    clock_t sTime = clock();
-    std::ifstream in(argv[argc-1]);
-    bool good = true;
-    for(string seq, hseq; good;) {
-        good = static_cast<bool>(getline(in, hseq));
-        good = static_cast<bool>(getline(in, seq));
-        good = static_cast<bool>(getline(in, hseq));
-        good = static_cast<bool>(getline(in, hseq));
-        if(good){
-            stHashIterator ssitr(seq, seedSet, h, k);
-            while (ssitr != ssitr.end()) {
-                if((ssitr.strandArray())[0])
-                    ++countOnes;
-                ++ssitr;
-            }
-        }
-        
-    }
-
-    std::cerr<< countOnes << std::endl;
-    std::cerr << (double)(clock() - sTime)/CLOCKS_PER_SEC << "\n";
-    
-    
-    return 0;
-}
diff --git a/test-driver b/test-driver
new file mode 100755
index 0000000..be73b80
--- /dev/null
+++ b/test-driver
@@ -0,0 +1,153 @@
+#! /bin/sh
+# test-driver - basic testsuite driver script.
+
+scriptversion=2018-03-07.03; # UTC
+
+# Copyright (C) 2011-2021 Free Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+#
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# This file is maintained in Automake, please report
+# bugs to <bug-automake@gnu.org> or send patches to
+# <automake-patches@gnu.org>.
+
+# Make unconditional expansion of undefined variables an error.  This
+# helps a lot in preventing typo-related bugs.
+set -u
+
+usage_error ()
+{
+  echo "$0: $*" >&2
+  print_usage >&2
+  exit 2
+}
+
+print_usage ()
+{
+  cat <<END
+Usage:
+  test-driver --test-name NAME --log-file PATH --trs-file PATH
+              [--expect-failure {yes|no}] [--color-tests {yes|no}]
+              [--enable-hard-errors {yes|no}] [--]
+              TEST-SCRIPT [TEST-SCRIPT-ARGUMENTS]
+
+The '--test-name', '--log-file' and '--trs-file' options are mandatory.
+See the GNU Automake documentation for information.
+END
+}
+
+test_name= # Used for reporting.
+log_file=  # Where to save the output of the test script.
+trs_file=  # Where to save the metadata of the test run.
+expect_failure=no
+color_tests=no
+enable_hard_errors=yes
+while test $# -gt 0; do
+  case $1 in
+  --help) print_usage; exit $?;;
+  --version) echo "test-driver $scriptversion"; exit $?;;
+  --test-name) test_name=$2; shift;;
+  --log-file) log_file=$2; shift;;
+  --trs-file) trs_file=$2; shift;;
+  --color-tests) color_tests=$2; shift;;
+  --expect-failure) expect_failure=$2; shift;;
+  --enable-hard-errors) enable_hard_errors=$2; shift;;
+  --) shift; break;;
+  -*) usage_error "invalid option: '$1'";;
+   *) break;;
+  esac
+  shift
+done
+
+missing_opts=
+test x"$test_name" = x && missing_opts="$missing_opts --test-name"
+test x"$log_file"  = x && missing_opts="$missing_opts --log-file"
+test x"$trs_file"  = x && missing_opts="$missing_opts --trs-file"
+if test x"$missing_opts" != x; then
+  usage_error "the following mandatory options are missing:$missing_opts"
+fi
+
+if test $# -eq 0; then
+  usage_error "missing argument"
+fi
+
+if test $color_tests = yes; then
+  # Keep this in sync with 'lib/am/check.am:$(am__tty_colors)'.
+  red='' # Red.
+  grn='' # Green.
+  lgn='' # Light green.
+  blu='' # Blue.
+  mgn='' # Magenta.
+  std=''     # No color.
+else
+  red= grn= lgn= blu= mgn= std=
+fi
+
+do_exit='rm -f $log_file $trs_file; (exit $st); exit $st'
+trap "st=129; $do_exit" 1
+trap "st=130; $do_exit" 2
+trap "st=141; $do_exit" 13
+trap "st=143; $do_exit" 15
+
+# Test script is run here. We create the file first, then append to it,
+# to ameliorate tests themselves also writing to the log file. Our tests
+# don't, but others can (automake bug#35762).
+: >"$log_file"
+"$@" >>"$log_file" 2>&1
+estatus=$?
+
+if test $enable_hard_errors = no && test $estatus -eq 99; then
+  tweaked_estatus=1
+else
+  tweaked_estatus=$estatus
+fi
+
+case $tweaked_estatus:$expect_failure in
+  0:yes) col=$red res=XPASS recheck=yes gcopy=yes;;
+  0:*)   col=$grn res=PASS  recheck=no  gcopy=no;;
+  77:*)  col=$blu res=SKIP  recheck=no  gcopy=yes;;
+  99:*)  col=$mgn res=ERROR recheck=yes gcopy=yes;;
+  *:yes) col=$lgn res=XFAIL recheck=no  gcopy=yes;;
+  *:*)   col=$red res=FAIL  recheck=yes gcopy=yes;;
+esac
+
+# Report the test outcome and exit status in the logs, so that one can
+# know whether the test passed or failed simply by looking at the '.log'
+# file, without the need of also peaking into the corresponding '.trs'
+# file (automake bug#11814).
+echo "$res $test_name (exit status: $estatus)" >>"$log_file"
+
+# Report outcome to console.
+echo "${col}${res}${std}: $test_name"
+
+# Register the test result, and other relevant metadata.
+echo ":test-result: $res" > $trs_file
+echo ":global-test-result: $res" >> $trs_file
+echo ":recheck: $recheck" >> $trs_file
+echo ":copy-in-global-log: $gcopy" >> $trs_file
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# eval: (add-hook 'before-save-hook 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC0"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/unittest/Makefile.in b/unittest/Makefile.in
new file mode 100644
index 0000000..1b5ffd0
--- /dev/null
+++ b/unittest/Makefile.in
@@ -0,0 +1,944 @@
+# Makefile.in generated by automake 1.16.5 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2021 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+@SET_MAKE@
+VPATH = @srcdir@
+am__is_gnu_make = { \
+  if test -z '$(MAKELEVEL)'; then \
+    false; \
+  elif test -n '$(MAKE_HOST)'; then \
+    true; \
+  elif test -n '$(MAKE_VERSION)' && test -n '$(CURDIR)'; then \
+    true; \
+  else \
+    false; \
+  fi; \
+}
+am__make_running_with_option = \
+  case $${target_option-} in \
+      ?) ;; \
+      *) echo "am__make_running_with_option: internal error: invalid" \
+              "target option '$${target_option-}' specified" >&2; \
+         exit 1;; \
+  esac; \
+  has_opt=no; \
+  sane_makeflags=$$MAKEFLAGS; \
+  if $(am__is_gnu_make); then \
+    sane_makeflags=$$MFLAGS; \
+  else \
+    case $$MAKEFLAGS in \
+      *\\[\ \	]*) \
+        bs=\\; \
+        sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+          | sed "s/$$bs$$bs[$$bs $$bs	]*//g"`;; \
+    esac; \
+  fi; \
+  skip_next=no; \
+  strip_trailopt () \
+  { \
+    flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+  }; \
+  for flg in $$sane_makeflags; do \
+    test $$skip_next = yes && { skip_next=no; continue; }; \
+    case $$flg in \
+      *=*|--*) continue;; \
+        -*I) strip_trailopt 'I'; skip_next=yes;; \
+      -*I?*) strip_trailopt 'I';; \
+        -*O) strip_trailopt 'O'; skip_next=yes;; \
+      -*O?*) strip_trailopt 'O';; \
+        -*l) strip_trailopt 'l'; skip_next=yes;; \
+      -*l?*) strip_trailopt 'l';; \
+      -[dEDm]) skip_next=yes;; \
+      -[JT]) skip_next=yes;; \
+    esac; \
+    case $$flg in \
+      *$$target_option*) has_opt=yes; break;; \
+    esac; \
+  done; \
+  test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+build_triplet = @build@
+host_triplet = @host@
+check_PROGRAMS = UNITTESTS$(EXEEXT)
+subdir = unittest
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+	$(ACLOCAL_M4)
+DIST_COMMON = $(srcdir)/Makefile.am $(am__DIST_COMMON)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+am_UNITTESTS_OBJECTS = UNITTESTS-UnitTests.$(OBJEXT)
+UNITTESTS_OBJECTS = $(am_UNITTESTS_OBJECTS)
+UNITTESTS_LDADD = $(LDADD)
+UNITTESTS_LINK = $(CXXLD) $(UNITTESTS_CXXFLAGS) $(CXXFLAGS) \
+	$(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_P = $(am__v_P_@AM_V@)
+am__v_P_ = $(am__v_P_@AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_@AM_V@)
+am__v_GEN_ = $(am__v_GEN_@AM_DEFAULT_V@)
+am__v_GEN_0 = @echo "  GEN     " $@;
+am__v_GEN_1 = 
+AM_V_at = $(am__v_at_@AM_V@)
+am__v_at_ = $(am__v_at_@AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 = 
+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__maybe_remake_depfiles = depfiles
+am__depfiles_remade = ./$(DEPDIR)/UNITTESTS-UnitTests.Po
+am__mv = mv -f
+AM_V_lt = $(am__v_lt_@AM_V@)
+am__v_lt_ = $(am__v_lt_@AM_DEFAULT_V@)
+am__v_lt_0 = --silent
+am__v_lt_1 = 
+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
+	$(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
+AM_V_CXX = $(am__v_CXX_@AM_V@)
+am__v_CXX_ = $(am__v_CXX_@AM_DEFAULT_V@)
+am__v_CXX_0 = @echo "  CXX     " $@;
+am__v_CXX_1 = 
+CXXLD = $(CXX)
+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
+	-o $@
+AM_V_CXXLD = $(am__v_CXXLD_@AM_V@)
+am__v_CXXLD_ = $(am__v_CXXLD_@AM_DEFAULT_V@)
+am__v_CXXLD_0 = @echo "  CXXLD   " $@;
+am__v_CXXLD_1 = 
+SOURCES = $(UNITTESTS_SOURCES)
+DIST_SOURCES = $(UNITTESTS_SOURCES)
+am__can_run_installinfo = \
+  case $$AM_UPDATE_INFO_DIR in \
+    n|no|NO) false;; \
+    *) (install-info --version) >/dev/null 2>&1;; \
+  esac
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates.  Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+  BEGIN { nonempty = 0; } \
+  { items[$$0] = 1; nonempty = 1; } \
+  END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique.  This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+  list='$(am__tagged_files)'; \
+  unique=`for i in $$list; do \
+    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+  done | $(am__uniquify_input)`
+am__tty_colors_dummy = \
+  mgn= red= grn= lgn= blu= brg= std=; \
+  am__color_tests=no
+am__tty_colors = { \
+  $(am__tty_colors_dummy); \
+  if test "X$(AM_COLOR_TESTS)" = Xno; then \
+    am__color_tests=no; \
+  elif test "X$(AM_COLOR_TESTS)" = Xalways; then \
+    am__color_tests=yes; \
+  elif test "X$$TERM" != Xdumb && { test -t 1; } 2>/dev/null; then \
+    am__color_tests=yes; \
+  fi; \
+  if test $$am__color_tests = yes; then \
+    red=''; \
+    grn=''; \
+    lgn=''; \
+    blu=''; \
+    mgn=''; \
+    brg=''; \
+    std=''; \
+  fi; \
+}
+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
+am__vpath_adj = case $$p in \
+    $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
+    *) f=$$p;; \
+  esac;
+am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
+am__install_max = 40
+am__nobase_strip_setup = \
+  srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
+am__nobase_strip = \
+  for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
+am__nobase_list = $(am__nobase_strip_setup); \
+  for p in $$list; do echo "$$p $$p"; done | \
+  sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
+  $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
+    if (++n[$$2] == $(am__install_max)) \
+      { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
+    END { for (dir in files) print dir, files[dir] }'
+am__base_list = \
+  sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
+  sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
+am__uninstall_files_from_dir = { \
+  test -z "$$files" \
+    || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
+    || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
+         $(am__cd) "$$dir" && rm -f $$files; }; \
+  }
+am__recheck_rx = ^[ 	]*:recheck:[ 	]*
+am__global_test_result_rx = ^[ 	]*:global-test-result:[ 	]*
+am__copy_in_global_log_rx = ^[ 	]*:copy-in-global-log:[ 	]*
+# A command that, given a newline-separated list of test names on the
+# standard input, print the name of the tests that are to be re-run
+# upon "make recheck".
+am__list_recheck_tests = $(AWK) '{ \
+  recheck = 1; \
+  while ((rc = (getline line < ($$0 ".trs"))) != 0) \
+    { \
+      if (rc < 0) \
+        { \
+          if ((getline line2 < ($$0 ".log")) < 0) \
+	    recheck = 0; \
+          break; \
+        } \
+      else if (line ~ /$(am__recheck_rx)[nN][Oo]/) \
+        { \
+          recheck = 0; \
+          break; \
+        } \
+      else if (line ~ /$(am__recheck_rx)[yY][eE][sS]/) \
+        { \
+          break; \
+        } \
+    }; \
+  if (recheck) \
+    print $$0; \
+  close ($$0 ".trs"); \
+  close ($$0 ".log"); \
+}'
+# A command that, given a newline-separated list of test names on the
+# standard input, create the global log from their .trs and .log files.
+am__create_global_log = $(AWK) ' \
+function fatal(msg) \
+{ \
+  print "fatal: making $@: " msg | "cat >&2"; \
+  exit 1; \
+} \
+function rst_section(header) \
+{ \
+  print header; \
+  len = length(header); \
+  for (i = 1; i <= len; i = i + 1) \
+    printf "="; \
+  printf "\n\n"; \
+} \
+{ \
+  copy_in_global_log = 1; \
+  global_test_result = "RUN"; \
+  while ((rc = (getline line < ($$0 ".trs"))) != 0) \
+    { \
+      if (rc < 0) \
+         fatal("failed to read from " $$0 ".trs"); \
+      if (line ~ /$(am__global_test_result_rx)/) \
+        { \
+          sub("$(am__global_test_result_rx)", "", line); \
+          sub("[ 	]*$$", "", line); \
+          global_test_result = line; \
+        } \
+      else if (line ~ /$(am__copy_in_global_log_rx)[nN][oO]/) \
+        copy_in_global_log = 0; \
+    }; \
+  if (copy_in_global_log) \
+    { \
+      rst_section(global_test_result ": " $$0); \
+      while ((rc = (getline line < ($$0 ".log"))) != 0) \
+      { \
+        if (rc < 0) \
+          fatal("failed to read from " $$0 ".log"); \
+        print line; \
+      }; \
+      printf "\n"; \
+    }; \
+  close ($$0 ".trs"); \
+  close ($$0 ".log"); \
+}'
+# Restructured Text title.
+am__rst_title = { sed 's/.*/   &   /;h;s/./=/g;p;x;s/ *$$//;p;g' && echo; }
+# Solaris 10 'make', and several other traditional 'make' implementations,
+# pass "-e" to $(SHELL), and POSIX 2008 even requires this.  Work around it
+# by disabling -e (using the XSI extension "set +e") if it's set.
+am__sh_e_setup = case $$- in *e*) set +e;; esac
+# Default flags passed to test drivers.
+am__common_driver_flags = \
+  --color-tests "$$am__color_tests" \
+  --enable-hard-errors "$$am__enable_hard_errors" \
+  --expect-failure "$$am__expect_failure"
+# To be inserted before the command running the test.  Creates the
+# directory for the log if needed.  Stores in $dir the directory
+# containing $f, in $tst the test, in $log the log.  Executes the
+# developer- defined test setup AM_TESTS_ENVIRONMENT (if any), and
+# passes TESTS_ENVIRONMENT.  Set up options for the wrapper that
+# will run the test scripts (or their associated LOG_COMPILER, if
+# thy have one).
+am__check_pre = \
+$(am__sh_e_setup);					\
+$(am__vpath_adj_setup) $(am__vpath_adj)			\
+$(am__tty_colors);					\
+srcdir=$(srcdir); export srcdir;			\
+case "$@" in						\
+  */*) am__odir=`echo "./$@" | sed 's|/[^/]*$$||'`;;	\
+    *) am__odir=.;; 					\
+esac;							\
+test "x$$am__odir" = x"." || test -d "$$am__odir" 	\
+  || $(MKDIR_P) "$$am__odir" || exit $$?;		\
+if test -f "./$$f"; then dir=./;			\
+elif test -f "$$f"; then dir=;				\
+else dir="$(srcdir)/"; fi;				\
+tst=$$dir$$f; log='$@'; 				\
+if test -n '$(DISABLE_HARD_ERRORS)'; then		\
+  am__enable_hard_errors=no; 				\
+else							\
+  am__enable_hard_errors=yes; 				\
+fi; 							\
+case " $(XFAIL_TESTS) " in				\
+  *[\ \	]$$f[\ \	]* | *[\ \	]$$dir$$f[\ \	]*) \
+    am__expect_failure=yes;;				\
+  *)							\
+    am__expect_failure=no;;				\
+esac; 							\
+$(AM_TESTS_ENVIRONMENT) $(TESTS_ENVIRONMENT)
+# A shell command to get the names of the tests scripts with any registered
+# extension removed (i.e., equivalently, the names of the test logs, with
+# the '.log' extension removed).  The result is saved in the shell variable
+# '$bases'.  This honors runtime overriding of TESTS and TEST_LOGS.  Sadly,
+# we cannot use something simpler, involving e.g., "$(TEST_LOGS:.log=)",
+# since that might cause problem with VPATH rewrites for suffix-less tests.
+# See also 'test-harness-vpath-rewrite.sh' and 'test-trs-basic.sh'.
+am__set_TESTS_bases = \
+  bases='$(TEST_LOGS)'; \
+  bases=`for i in $$bases; do echo $$i; done | sed 's/\.log$$//'`; \
+  bases=`echo $$bases`
+AM_TESTSUITE_SUMMARY_HEADER = ' for $(PACKAGE_STRING)'
+RECHECK_LOGS = $(TEST_LOGS)
+AM_RECURSIVE_TARGETS = check recheck
+TEST_SUITE_LOG = test-suite.log
+TEST_EXTENSIONS = @EXEEXT@ .test
+LOG_DRIVER = $(SHELL) $(top_srcdir)/test-driver
+LOG_COMPILE = $(LOG_COMPILER) $(AM_LOG_FLAGS) $(LOG_FLAGS)
+am__set_b = \
+  case '$@' in \
+    */*) \
+      case '$*' in \
+        */*) b='$*';; \
+          *) b=`echo '$@' | sed 's/\.log$$//'`; \
+       esac;; \
+    *) \
+      b='$*';; \
+  esac
+am__test_logs1 = $(TESTS:=.log)
+am__test_logs2 = $(am__test_logs1:@EXEEXT@.log=.log)
+TEST_LOGS = $(am__test_logs2:.test.log=.log)
+TEST_LOG_DRIVER = $(SHELL) $(top_srcdir)/test-driver
+TEST_LOG_COMPILE = $(TEST_LOG_COMPILER) $(AM_TEST_LOG_FLAGS) \
+	$(TEST_LOG_FLAGS)
+am__DIST_COMMON = $(srcdir)/Makefile.in $(top_srcdir)/depcomp \
+	$(top_srcdir)/test-driver
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_CXXFLAGS = @AM_CXXFLAGS@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CSCOPE = @CSCOPE@
+CTAGS = @CTAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+ETAGS = @ETAGS@
+EXEEXT = @EXEEXT@
+GREP = @GREP@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build = @build@
+build_alias = @build_alias@
+build_cpu = @build_cpu@
+build_os = @build_os@
+build_vendor = @build_vendor@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host = @host@
+host_alias = @host_alias@
+host_cpu = @host_cpu@
+host_os = @host_os@
+host_vendor = @host_vendor@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+runstatedir = @runstatedir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+UNITTESTS_SOURCES = UnitTests.cpp
+UNITTESTS_CPPFLAGS = -I$(top_srcdir)
+UNITTESTS_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS) -std=c++11
+
+# programs that will be run by 'make check' (after compiling)
+TESTS = $(check_PROGRAMS)
+all: all-am
+
+.SUFFIXES:
+.SUFFIXES: .cpp .log .o .obj .test .test$(EXEEXT) .trs
+$(srcdir)/Makefile.in:  $(srcdir)/Makefile.am  $(am__configure_deps)
+	@for dep in $?; do \
+	  case '$(am__configure_deps)' in \
+	    *$$dep*) \
+	      ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+	        && { if test -f $@; then exit 0; else break; fi; }; \
+	      exit 1;; \
+	  esac; \
+	done; \
+	echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign unittest/Makefile'; \
+	$(am__cd) $(top_srcdir) && \
+	  $(AUTOMAKE) --foreign unittest/Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+	@case '$?' in \
+	  *config.status*) \
+	    cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+	  *) \
+	    echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__maybe_remake_depfiles)'; \
+	    cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__maybe_remake_depfiles);; \
+	esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure:  $(am__configure_deps)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4):  $(am__aclocal_m4_deps)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+clean-checkPROGRAMS:
+	-test -z "$(check_PROGRAMS)" || rm -f $(check_PROGRAMS)
+
+UNITTESTS$(EXEEXT): $(UNITTESTS_OBJECTS) $(UNITTESTS_DEPENDENCIES) $(EXTRA_UNITTESTS_DEPENDENCIES) 
+	@rm -f UNITTESTS$(EXEEXT)
+	$(AM_V_CXXLD)$(UNITTESTS_LINK) $(UNITTESTS_OBJECTS) $(UNITTESTS_LDADD) $(LIBS)
+
+mostlyclean-compile:
+	-rm -f *.$(OBJEXT)
+
+distclean-compile:
+	-rm -f *.tab.c
+
+@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/UNITTESTS-UnitTests.Po@am__quote@ # am--include-marker
+
+$(am__depfiles_remade):
+	@$(MKDIR_P) $(@D)
+	@echo '# dummy' >$@-t && $(am__mv) $@-t $@
+
+am--depfiles: $(am__depfiles_remade)
+
+.cpp.o:
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.o$$||'`;\
+@am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
+@am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXXCOMPILE) -c -o $@ $<
+
+.cpp.obj:
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.obj$$||'`;\
+@am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ `$(CYGPATH_W) '$<'` &&\
+@am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+UNITTESTS-UnitTests.o: UnitTests.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(UNITTESTS_CPPFLAGS) $(CPPFLAGS) $(UNITTESTS_CXXFLAGS) $(CXXFLAGS) -MT UNITTESTS-UnitTests.o -MD -MP -MF $(DEPDIR)/UNITTESTS-UnitTests.Tpo -c -o UNITTESTS-UnitTests.o `test -f 'UnitTests.cpp' || echo '$(srcdir)/'`UnitTests.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) $(DEPDIR)/UNITTESTS-UnitTests.Tpo $(DEPDIR)/UNITTESTS-UnitTests.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='UnitTests.cpp' object='UNITTESTS-UnitTests.o' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(UNITTESTS_CPPFLAGS) $(CPPFLAGS) $(UNITTESTS_CXXFLAGS) $(CXXFLAGS) -c -o UNITTESTS-UnitTests.o `test -f 'UnitTests.cpp' || echo '$(srcdir)/'`UnitTests.cpp
+
+UNITTESTS-UnitTests.obj: UnitTests.cpp
+@am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(UNITTESTS_CPPFLAGS) $(CPPFLAGS) $(UNITTESTS_CXXFLAGS) $(CXXFLAGS) -MT UNITTESTS-UnitTests.obj -MD -MP -MF $(DEPDIR)/UNITTESTS-UnitTests.Tpo -c -o UNITTESTS-UnitTests.obj `if test -f 'UnitTests.cpp'; then $(CYGPATH_W) 'UnitTests.cpp'; else $(CYGPATH_W) '$(srcdir)/UnitTests.cpp'; fi`
+@am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) $(DEPDIR)/UNITTESTS-UnitTests.Tpo $(DEPDIR)/UNITTESTS-UnitTests.Po
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='UnitTests.cpp' object='UNITTESTS-UnitTests.obj' libtool=no @AMDEPBACKSLASH@
+@AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+@am__fastdepCXX_FALSE@	$(AM_V_CXX@am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(UNITTESTS_CPPFLAGS) $(CPPFLAGS) $(UNITTESTS_CXXFLAGS) $(CXXFLAGS) -c -o UNITTESTS-UnitTests.obj `if test -f 'UnitTests.cpp'; then $(CYGPATH_W) 'UnitTests.cpp'; else $(CYGPATH_W) '$(srcdir)/UnitTests.cpp'; fi`
+
+ID: $(am__tagged_files)
+	$(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+	set x; \
+	here=`pwd`; \
+	$(am__define_uniq_tagged_files); \
+	shift; \
+	if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+	  test -n "$$unique" || unique=$$empty_fix; \
+	  if test $$# -gt 0; then \
+	    $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	      "$$@" $$unique; \
+	  else \
+	    $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	      $$unique; \
+	  fi; \
+	fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+	$(am__define_uniq_tagged_files); \
+	test -z "$(CTAGS_ARGS)$$unique" \
+	  || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+	     $$unique
+
+GTAGS:
+	here=`$(am__cd) $(top_builddir) && pwd` \
+	  && $(am__cd) $(top_srcdir) \
+	  && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+	list='$(am__tagged_files)'; \
+	case "$(srcdir)" in \
+	  [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+	  *) sdir=$(subdir)/$(srcdir) ;; \
+	esac; \
+	for i in $$list; do \
+	  if test -f "$$i"; then \
+	    echo "$(subdir)/$$i"; \
+	  else \
+	    echo "$$sdir/$$i"; \
+	  fi; \
+	done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+	-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+
+# Recover from deleted '.trs' file; this should ensure that
+# "rm -f foo.log; make foo.trs" re-run 'foo.test', and re-create
+# both 'foo.log' and 'foo.trs'.  Break the recipe in two subshells
+# to avoid problems with "make -n".
+.log.trs:
+	rm -f $< $@
+	$(MAKE) $(AM_MAKEFLAGS) $<
+
+# Leading 'am--fnord' is there to ensure the list of targets does not
+# expand to empty, as could happen e.g. with make check TESTS=''.
+am--fnord $(TEST_LOGS) $(TEST_LOGS:.log=.trs): $(am__force_recheck)
+am--force-recheck:
+	@:
+
+$(TEST_SUITE_LOG): $(TEST_LOGS)
+	@$(am__set_TESTS_bases); \
+	am__f_ok () { test -f "$$1" && test -r "$$1"; }; \
+	redo_bases=`for i in $$bases; do \
+	              am__f_ok $$i.trs && am__f_ok $$i.log || echo $$i; \
+	            done`; \
+	if test -n "$$redo_bases"; then \
+	  redo_logs=`for i in $$redo_bases; do echo $$i.log; done`; \
+	  redo_results=`for i in $$redo_bases; do echo $$i.trs; done`; \
+	  if $(am__make_dryrun); then :; else \
+	    rm -f $$redo_logs && rm -f $$redo_results || exit 1; \
+	  fi; \
+	fi; \
+	if test -n "$$am__remaking_logs"; then \
+	  echo "fatal: making $(TEST_SUITE_LOG): possible infinite" \
+	       "recursion detected" >&2; \
+	elif test -n "$$redo_logs"; then \
+	  am__remaking_logs=yes $(MAKE) $(AM_MAKEFLAGS) $$redo_logs; \
+	fi; \
+	if $(am__make_dryrun); then :; else \
+	  st=0;  \
+	  errmsg="fatal: making $(TEST_SUITE_LOG): failed to create"; \
+	  for i in $$redo_bases; do \
+	    test -f $$i.trs && test -r $$i.trs \
+	      || { echo "$$errmsg $$i.trs" >&2; st=1; }; \
+	    test -f $$i.log && test -r $$i.log \
+	      || { echo "$$errmsg $$i.log" >&2; st=1; }; \
+	  done; \
+	  test $$st -eq 0 || exit 1; \
+	fi
+	@$(am__sh_e_setup); $(am__tty_colors); $(am__set_TESTS_bases); \
+	ws='[ 	]'; \
+	results=`for b in $$bases; do echo $$b.trs; done`; \
+	test -n "$$results" || results=/dev/null; \
+	all=`  grep "^$$ws*:test-result:"           $$results | wc -l`; \
+	pass=` grep "^$$ws*:test-result:$$ws*PASS"  $$results | wc -l`; \
+	fail=` grep "^$$ws*:test-result:$$ws*FAIL"  $$results | wc -l`; \
+	skip=` grep "^$$ws*:test-result:$$ws*SKIP"  $$results | wc -l`; \
+	xfail=`grep "^$$ws*:test-result:$$ws*XFAIL" $$results | wc -l`; \
+	xpass=`grep "^$$ws*:test-result:$$ws*XPASS" $$results | wc -l`; \
+	error=`grep "^$$ws*:test-result:$$ws*ERROR" $$results | wc -l`; \
+	if test `expr $$fail + $$xpass + $$error` -eq 0; then \
+	  success=true; \
+	else \
+	  success=false; \
+	fi; \
+	br='==================='; br=$$br$$br$$br$$br; \
+	result_count () \
+	{ \
+	    if test x"$$1" = x"--maybe-color"; then \
+	      maybe_colorize=yes; \
+	    elif test x"$$1" = x"--no-color"; then \
+	      maybe_colorize=no; \
+	    else \
+	      echo "$@: invalid 'result_count' usage" >&2; exit 4; \
+	    fi; \
+	    shift; \
+	    desc=$$1 count=$$2; \
+	    if test $$maybe_colorize = yes && test $$count -gt 0; then \
+	      color_start=$$3 color_end=$$std; \
+	    else \
+	      color_start= color_end=; \
+	    fi; \
+	    echo "$${color_start}# $$desc $$count$${color_end}"; \
+	}; \
+	create_testsuite_report () \
+	{ \
+	  result_count $$1 "TOTAL:" $$all   "$$brg"; \
+	  result_count $$1 "PASS: " $$pass  "$$grn"; \
+	  result_count $$1 "SKIP: " $$skip  "$$blu"; \
+	  result_count $$1 "XFAIL:" $$xfail "$$lgn"; \
+	  result_count $$1 "FAIL: " $$fail  "$$red"; \
+	  result_count $$1 "XPASS:" $$xpass "$$red"; \
+	  result_count $$1 "ERROR:" $$error "$$mgn"; \
+	}; \
+	{								\
+	  echo "$(PACKAGE_STRING): $(subdir)/$(TEST_SUITE_LOG)" |	\
+	    $(am__rst_title);						\
+	  create_testsuite_report --no-color;				\
+	  echo;								\
+	  echo ".. contents:: :depth: 2";				\
+	  echo;								\
+	  for b in $$bases; do echo $$b; done				\
+	    | $(am__create_global_log);					\
+	} >$(TEST_SUITE_LOG).tmp || exit 1;				\
+	mv $(TEST_SUITE_LOG).tmp $(TEST_SUITE_LOG);			\
+	if $$success; then						\
+	  col="$$grn";							\
+	 else								\
+	  col="$$red";							\
+	  test x"$$VERBOSE" = x || cat $(TEST_SUITE_LOG);		\
+	fi;								\
+	echo "$${col}$$br$${std}"; 					\
+	echo "$${col}Testsuite summary"$(AM_TESTSUITE_SUMMARY_HEADER)"$${std}";	\
+	echo "$${col}$$br$${std}"; 					\
+	create_testsuite_report --maybe-color;				\
+	echo "$$col$$br$$std";						\
+	if $$success; then :; else					\
+	  echo "$${col}See $(subdir)/$(TEST_SUITE_LOG)$${std}";		\
+	  if test -n "$(PACKAGE_BUGREPORT)"; then			\
+	    echo "$${col}Please report to $(PACKAGE_BUGREPORT)$${std}";	\
+	  fi;								\
+	  echo "$$col$$br$$std";					\
+	fi;								\
+	$$success || exit 1
+
+check-TESTS: $(check_PROGRAMS)
+	@list='$(RECHECK_LOGS)';           test -z "$$list" || rm -f $$list
+	@list='$(RECHECK_LOGS:.log=.trs)'; test -z "$$list" || rm -f $$list
+	@test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
+	@set +e; $(am__set_TESTS_bases); \
+	log_list=`for i in $$bases; do echo $$i.log; done`; \
+	trs_list=`for i in $$bases; do echo $$i.trs; done`; \
+	log_list=`echo $$log_list`; trs_list=`echo $$trs_list`; \
+	$(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_LOG) TEST_LOGS="$$log_list"; \
+	exit $$?;
+recheck: all $(check_PROGRAMS)
+	@test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
+	@set +e; $(am__set_TESTS_bases); \
+	bases=`for i in $$bases; do echo $$i; done \
+	         | $(am__list_recheck_tests)` || exit 1; \
+	log_list=`for i in $$bases; do echo $$i.log; done`; \
+	log_list=`echo $$log_list`; \
+	$(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_LOG) \
+	        am__force_recheck=am--force-recheck \
+	        TEST_LOGS="$$log_list"; \
+	exit $$?
+UNITTESTS.log: UNITTESTS$(EXEEXT)
+	@p='UNITTESTS$(EXEEXT)'; \
+	b='UNITTESTS'; \
+	$(am__check_pre) $(LOG_DRIVER) --test-name "$$f" \
+	--log-file $$b.log --trs-file $$b.trs \
+	$(am__common_driver_flags) $(AM_LOG_DRIVER_FLAGS) $(LOG_DRIVER_FLAGS) -- $(LOG_COMPILE) \
+	"$$tst" $(AM_TESTS_FD_REDIRECT)
+.test.log:
+	@p='$<'; \
+	$(am__set_b); \
+	$(am__check_pre) $(TEST_LOG_DRIVER) --test-name "$$f" \
+	--log-file $$b.log --trs-file $$b.trs \
+	$(am__common_driver_flags) $(AM_TEST_LOG_DRIVER_FLAGS) $(TEST_LOG_DRIVER_FLAGS) -- $(TEST_LOG_COMPILE) \
+	"$$tst" $(AM_TESTS_FD_REDIRECT)
+@am__EXEEXT_TRUE@.test$(EXEEXT).log:
+@am__EXEEXT_TRUE@	@p='$<'; \
+@am__EXEEXT_TRUE@	$(am__set_b); \
+@am__EXEEXT_TRUE@	$(am__check_pre) $(TEST_LOG_DRIVER) --test-name "$$f" \
+@am__EXEEXT_TRUE@	--log-file $$b.log --trs-file $$b.trs \
+@am__EXEEXT_TRUE@	$(am__common_driver_flags) $(AM_TEST_LOG_DRIVER_FLAGS) $(TEST_LOG_DRIVER_FLAGS) -- $(TEST_LOG_COMPILE) \
+@am__EXEEXT_TRUE@	"$$tst" $(AM_TESTS_FD_REDIRECT)
+distdir: $(BUILT_SOURCES)
+	$(MAKE) $(AM_MAKEFLAGS) distdir-am
+
+distdir-am: $(DISTFILES)
+	@srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	list='$(DISTFILES)'; \
+	  dist_files=`for file in $$list; do echo $$file; done | \
+	  sed -e "s|^$$srcdirstrip/||;t" \
+	      -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+	case $$dist_files in \
+	  */*) $(MKDIR_P) `echo "$$dist_files" | \
+			   sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+			   sort -u` ;; \
+	esac; \
+	for file in $$dist_files; do \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  if test -d $$d/$$file; then \
+	    dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+	    if test -d "$(distdir)/$$file"; then \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+	  else \
+	    test -f "$(distdir)/$$file" \
+	    || cp -p $$d/$$file "$(distdir)/$$file" \
+	    || exit 1; \
+	  fi; \
+	done
+check-am: all-am
+	$(MAKE) $(AM_MAKEFLAGS) $(check_PROGRAMS)
+	$(MAKE) $(AM_MAKEFLAGS) check-TESTS
+check: check-am
+all-am: Makefile
+installdirs:
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+	if test -z '$(STRIP)'; then \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	      install; \
+	else \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	    "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+	fi
+mostlyclean-generic:
+	-test -z "$(TEST_LOGS)" || rm -f $(TEST_LOGS)
+	-test -z "$(TEST_LOGS:.log=.trs)" || rm -f $(TEST_LOGS:.log=.trs)
+	-test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
+
+clean-generic:
+
+distclean-generic:
+	-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+	-test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-checkPROGRAMS clean-generic mostlyclean-am
+
+distclean: distclean-am
+		-rm -f ./$(DEPDIR)/UNITTESTS-UnitTests.Po
+	-rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+	distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+		-rm -f ./$(DEPDIR)/UNITTESTS-UnitTests.Po
+	-rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am:
+
+.MAKE: check-am install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am am--depfiles check check-TESTS \
+	check-am clean clean-checkPROGRAMS clean-generic cscopelist-am \
+	ctags ctags-am distclean distclean-compile distclean-generic \
+	distclean-tags distdir dvi dvi-am html html-am info info-am \
+	install install-am install-data install-data-am install-dvi \
+	install-dvi-am install-exec install-exec-am install-html \
+	install-html-am install-info install-info-am install-man \
+	install-pdf install-pdf-am install-ps install-ps-am \
+	install-strip installcheck installcheck-am installdirs \
+	maintainer-clean maintainer-clean-generic mostlyclean \
+	mostlyclean-compile mostlyclean-generic pdf pdf-am ps ps-am \
+	recheck tags tags-am uninstall uninstall-am
+
+.PRECIOUS: Makefile
+
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/vendor/Makefile.in b/vendor/Makefile.in
new file mode 100644
index 0000000..98dcfaa
--- /dev/null
+++ b/vendor/Makefile.in
@@ -0,0 +1,484 @@
+# Makefile.in generated by automake 1.16.5 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2021 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+@SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = { \
+  if test -z '$(MAKELEVEL)'; then \
+    false; \
+  elif test -n '$(MAKE_HOST)'; then \
+    true; \
+  elif test -n '$(MAKE_VERSION)' && test -n '$(CURDIR)'; then \
+    true; \
+  else \
+    false; \
+  fi; \
+}
+am__make_running_with_option = \
+  case $${target_option-} in \
+      ?) ;; \
+      *) echo "am__make_running_with_option: internal error: invalid" \
+              "target option '$${target_option-}' specified" >&2; \
+         exit 1;; \
+  esac; \
+  has_opt=no; \
+  sane_makeflags=$$MAKEFLAGS; \
+  if $(am__is_gnu_make); then \
+    sane_makeflags=$$MFLAGS; \
+  else \
+    case $$MAKEFLAGS in \
+      *\\[\ \	]*) \
+        bs=\\; \
+        sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+          | sed "s/$$bs$$bs[$$bs $$bs	]*//g"`;; \
+    esac; \
+  fi; \
+  skip_next=no; \
+  strip_trailopt () \
+  { \
+    flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+  }; \
+  for flg in $$sane_makeflags; do \
+    test $$skip_next = yes && { skip_next=no; continue; }; \
+    case $$flg in \
+      *=*|--*) continue;; \
+        -*I) strip_trailopt 'I'; skip_next=yes;; \
+      -*I?*) strip_trailopt 'I';; \
+        -*O) strip_trailopt 'O'; skip_next=yes;; \
+      -*O?*) strip_trailopt 'O';; \
+        -*l) strip_trailopt 'l'; skip_next=yes;; \
+      -*l?*) strip_trailopt 'l';; \
+      -[dEDm]) skip_next=yes;; \
+      -[JT]) skip_next=yes;; \
+    esac; \
+    case $$flg in \
+      *$$target_option*) has_opt=yes; break;; \
+    esac; \
+  done; \
+  test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+build_triplet = @build@
+host_triplet = @host@
+subdir = vendor
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+	$(ACLOCAL_M4)
+DIST_COMMON = $(srcdir)/Makefile.am $(noinst_HEADERS) \
+	$(am__DIST_COMMON)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+AM_V_P = $(am__v_P_@AM_V@)
+am__v_P_ = $(am__v_P_@AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_@AM_V@)
+am__v_GEN_ = $(am__v_GEN_@AM_DEFAULT_V@)
+am__v_GEN_0 = @echo "  GEN     " $@;
+am__v_GEN_1 = 
+AM_V_at = $(am__v_at_@AM_V@)
+am__v_at_ = $(am__v_at_@AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 = 
+SOURCES =
+DIST_SOURCES =
+am__can_run_installinfo = \
+  case $$AM_UPDATE_INFO_DIR in \
+    n|no|NO) false;; \
+    *) (install-info --version) >/dev/null 2>&1;; \
+  esac
+HEADERS = $(noinst_HEADERS)
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates.  Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+  BEGIN { nonempty = 0; } \
+  { items[$$0] = 1; nonempty = 1; } \
+  END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique.  This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+  list='$(am__tagged_files)'; \
+  unique=`for i in $$list; do \
+    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+  done | $(am__uniquify_input)`
+am__DIST_COMMON = $(srcdir)/Makefile.in
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_CXXFLAGS = @AM_CXXFLAGS@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CSCOPE = @CSCOPE@
+CTAGS = @CTAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+ETAGS = @ETAGS@
+EXEEXT = @EXEEXT@
+GREP = @GREP@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build = @build@
+build_alias = @build_alias@
+build_cpu = @build_cpu@
+build_os = @build_os@
+build_vendor = @build_vendor@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host = @host@
+host_alias = @host_alias@
+host_cpu = @host_cpu@
+host_os = @host_os@
+host_vendor = @host_vendor@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+runstatedir = @runstatedir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+noinst_HEADERS = catch.hpp
+all: all-am
+
+.SUFFIXES:
+$(srcdir)/Makefile.in:  $(srcdir)/Makefile.am  $(am__configure_deps)
+	@for dep in $?; do \
+	  case '$(am__configure_deps)' in \
+	    *$$dep*) \
+	      ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+	        && { if test -f $@; then exit 0; else break; fi; }; \
+	      exit 1;; \
+	  esac; \
+	done; \
+	echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign vendor/Makefile'; \
+	$(am__cd) $(top_srcdir) && \
+	  $(AUTOMAKE) --foreign vendor/Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+	@case '$?' in \
+	  *config.status*) \
+	    cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+	  *) \
+	    echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__maybe_remake_depfiles)'; \
+	    cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__maybe_remake_depfiles);; \
+	esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure:  $(am__configure_deps)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4):  $(am__aclocal_m4_deps)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+ID: $(am__tagged_files)
+	$(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+	set x; \
+	here=`pwd`; \
+	$(am__define_uniq_tagged_files); \
+	shift; \
+	if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+	  test -n "$$unique" || unique=$$empty_fix; \
+	  if test $$# -gt 0; then \
+	    $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	      "$$@" $$unique; \
+	  else \
+	    $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	      $$unique; \
+	  fi; \
+	fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+	$(am__define_uniq_tagged_files); \
+	test -z "$(CTAGS_ARGS)$$unique" \
+	  || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+	     $$unique
+
+GTAGS:
+	here=`$(am__cd) $(top_builddir) && pwd` \
+	  && $(am__cd) $(top_srcdir) \
+	  && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+	list='$(am__tagged_files)'; \
+	case "$(srcdir)" in \
+	  [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+	  *) sdir=$(subdir)/$(srcdir) ;; \
+	esac; \
+	for i in $$list; do \
+	  if test -f "$$i"; then \
+	    echo "$(subdir)/$$i"; \
+	  else \
+	    echo "$$sdir/$$i"; \
+	  fi; \
+	done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+	-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+distdir: $(BUILT_SOURCES)
+	$(MAKE) $(AM_MAKEFLAGS) distdir-am
+
+distdir-am: $(DISTFILES)
+	@srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	list='$(DISTFILES)'; \
+	  dist_files=`for file in $$list; do echo $$file; done | \
+	  sed -e "s|^$$srcdirstrip/||;t" \
+	      -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+	case $$dist_files in \
+	  */*) $(MKDIR_P) `echo "$$dist_files" | \
+			   sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+			   sort -u` ;; \
+	esac; \
+	for file in $$dist_files; do \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  if test -d $$d/$$file; then \
+	    dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+	    if test -d "$(distdir)/$$file"; then \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+	  else \
+	    test -f "$(distdir)/$$file" \
+	    || cp -p $$d/$$file "$(distdir)/$$file" \
+	    || exit 1; \
+	  fi; \
+	done
+check-am: all-am
+check: check-am
+all-am: Makefile $(HEADERS)
+installdirs:
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+	if test -z '$(STRIP)'; then \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	      install; \
+	else \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	    "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+	fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+	-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+	-test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic mostlyclean-am
+
+distclean: distclean-am
+	-rm -f Makefile
+distclean-am: clean-am distclean-generic distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+	-rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am:
+
+.MAKE: install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
+	cscopelist-am ctags ctags-am distclean distclean-generic \
+	distclean-tags distdir dvi dvi-am html html-am info info-am \
+	install install-am install-data install-data-am install-dvi \
+	install-dvi-am install-exec install-exec-am install-html \
+	install-html-am install-info install-info-am install-man \
+	install-pdf install-pdf-am install-ps install-ps-am \
+	install-strip installcheck installcheck-am installdirs \
+	maintainer-clean maintainer-clean-generic mostlyclean \
+	mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
+	uninstall-am
+
+.PRECIOUS: Makefile
+
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT: