Package list barrnap / 6df15a3
New upstream version 0.9+dfsg Sascha Steinbiss 3 years ago
4 changed file(s) with 5816 addition(s) and 89 deletion(s). Raw diff Collapse all Expand all
0 language: perl
1
2 sudo: false
3
4 addons:
5 apt:
6 packages:
7 - hmmer
8 - bedtools
9
10 perl:
11 - "5.26"
12
13 install:
14 - "export PATH=$PWD/bin:$PATH"
15 - "sed -i~ -e 's/-name+/-name/' bin/barrnap"
16
17 script:
18 - "barrnap --version"
19 - "barrnap --help"
20 - "barrnap --citation"
21 - "! barrnap --doesnotexist"
22 - "barrnap 2>&1 | grep 'ERROR: No input file'"
23 - "barrnap -q --kingdom bac examples/bacteria.fna"
24 - "barrnap -q --kingdom arc examples/bacteria.fna"
25 - "barrnap -q --kingdom mito examples/mitochondria.fna"
26 - "barrnap -q --kingdom euk examples/fungus.fna"
27 - "! barrnap examples/empty.fna"
28 - "! barrnap examples/null.fna"
29 - "barrnap -q examples/small.fna | grep 16S_rRNA"
30 - "barrnap -q < examples/small.fna | grep 16S_rRNA"
31 - "barrnap -q - < examples/small.fna | grep 16S_rRNA"
32 - "barrnap examples/nohits.fna 2>&1 | grep 'Found 0 '"
33 - "barrnap --threads 2 examples/small.fna"
34 - "barrnap -q --incseq examples/small.fna | grep '^>'"
35 - "barrnap -q --outseq hits.fa < examples/small.fna && head -n3 hits.fa"
0 [![Build Status](https://travis-ci.org/tseemann/barrnap.svg?branch=master)](https://travis-ci.org/tseemann/barrnap) [![License: GPL v3](https://img.shields.io/badge/License-GPL%20v3-blue.svg)](https://www.gnu.org/licenses/gpl-3.0) [](#lang-au)
1
02 # Barrnap
13
24 BAsic Rapid Ribosomal RNA Predictor
3
4 ## Author
5
6 Torsten Seemann - torsten.seemann@gmail.com - @torstenseemann
75
86 ## Description
97
108 Barrnap predicts the location of ribosomal RNA genes in genomes.
119 It supports bacteria (5S,23S,16S), archaea (5S,5.8S,23S,16S),
12 mitochondria (12S,16S) and eukaryotes (5S,5.8S,28S,18S).
10 metazoan mitochondria (12S,16S) and eukaryotes (5S,5.8S,28S,18S).
1311
1412 It takes FASTA DNA sequence as input, and write GFF3 as output.
15 It uses the new NHMMER tool that comes with HMMER 3.1 for HMM searching in RNA:DNA style.
16 NHMMER binaries for 64-bit Linux and Mac OS X are included and will be auto-detected.
13 It uses the new `nhmmer` tool that comes with HMMER 3.1 for HMM searching in RNA:DNA style.
1714 Multithreading is supported and one can expect roughly linear speed-ups with more CPUs.
1815
19 ## Download
16 ## Installation
2017
21 * Tarballs: https://github.com/tseemann/barrnap/releases/
22 * Source: https://github.com/tseemann/barrnap
18 ### Requirements
19 * [Perl 5.xx](https://dev.perl.org/perl5/) (core modules only)
20 * [nhmmer](https://hmmer.org/) (part of HMMER 3.x)
21 * [bedtools](http://bedtools.readthedocs.io/en/latest/)
2322
24 ## Install
23 ### Conda
24 Install [Conda](https://conda.io/docs/) or [Miniconda](https://conda.io/miniconda.html):
25 ```
26 conda -c bioconda -c conda-forge install barrnap
27 barrnap --version
28 ```
2529
26 % cd $HOME
27 % tar zxvf barrnap-0.X.tar.gz
28 % echo "PATH=$PATH:$HOME/barrnap-0.x/bin" >> .bashrc
29 (logout and log back in)
30 ### Homebrew
31 Install [HomeBrew](http://brew.sh/) (Mac OS X) or [LinuxBrew](http://brew.sh/linuxbrew/) (Linux).
32 ```
33 brew install brewsci/bio/barrnap
34 barrnap --help
35 ```
36
37 ### Source
38 This will install the latest version direct from Github.
39 You'll need to add the `bin` directory to your PATH.
40 ```
41 cd $HOME
42 tar zxvf barrnap-0.X.tar.gz
43 barrnap-0.X/barrnap -h
44 ```
3045
3146 ## Usage
3247
33 % barrnap --quiet examples/small.fna
34 ##gff-version 3
35 P.marinus barrnap:0.7 rRNA 353314 354793 0 + . Name=16S_rRNA;product=16S ribosomal RNA
36 P.marinus barrnap:0.7 rRNA 355464 358334 0 + . Name=23S_rRNA;product=23S ribosomal RNA
37 P.marinus barrnap:0.7 rRNA 358433 358536 7.5e-07 + . Name=5S_rRNA;product=5S ribosomal RNA
48 ```
49 % barrnap --quiet examples/small.fna
50 ##gff-version 3
51 P.marinus barrnap:0.8 rRNA 353314 354793 0 + . Name=16S_rRNA;product=16S ribosomal RNA
52 P.marinus barrnap:0.8 rRNA 355464 358334 0 + . Name=23S_rRNA;product=23S ribosomal RNA
53 P.marinus barrnap:0.8 rRNA 358433 358536 7.5e-07 + . Name=5S_rRNA;product=5S ribosomal RNA
3854
39 % barrnap -q -k mito examples/mitochondria.fna
40 ##gff-version 3
41 AF346967.1 barrnap:0.7 rRNA 643 1610 . + . Name=12S_rRNA;product=12S ribosomal RNA
42 AF346967.1 barrnap:0.7 rRNA 1672 3228 . + . Name=16S_rRNA;product=16S ribosomal RNA
55 % barrnap -q -k mito examples/mitochondria.fna
56 ##gff-version 3
57 AF346967.1 barrnap:0.8 rRNA 643 1610 . + . Name=12S_rRNA;product=12S ribosomal RNA
58 AF346967.1 barrnap:0.8 rRNA 1672 3228 . + . Name=16S_rRNA;product=16S ribosomal RNA
59
60 % barrnap -o rrna.fa < contigs.fa > rrna.gff
61 % head -n 3 rrna.fa
62 >16S_rRNA::gi|329138943|tpg|BK006945.2|:455935-456864(-)
63 ACGGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATT
64 TATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGACGTTTTCATTA
65 ```
66
67 ## Options
68
69 ### General
70 * `--help` show help and exit
71 * `--version` print version in form `barrnap X.Y` and exit
72 * `--citation` print a citation and exit
73 ### Search
74 * `--kingdom` is the database to use: Bacteria:`bac`, Archaea:`arc`, Eukaryota:`euk`, Metazoan Mitochondria:`mito`
75 * `--threads` is how many CPUs to assign to `nhmmer` search
76 * `--evalue` is the cut-off for `nhmmer` reporting, before further scrutiny
77 * `--lencutoff` is the proportion of the full length that qualifies as `partial` match
78 * `--reject` will not include hits below this proportion of the expected length
79 ### Output
80 * `--quiet` will not print any messages to `stderr`
81 * `--incseq` will include the full input sequences in the output GFF
82 * `--outseq` creates a FASTA file with the hit sequences
4383
4484 ## Caveats
4585
4686 Barrnap does not do anything fancy. It has HMM models for each different rRNA gene.
4787 They are built from full length seed alignments.
4888
49 ## Requirements
50
51 * Perl >= 5.6
52 * HMMER >= 3.1b
53
54 ## License
55
56 Barrnap is free software, released under the GPL (version 3).
57
5889 ## Comparison with RNAmmer
5990
60 Barrnap is designed to be a substitute for RNAmmer. It was motivated by
61 my desire to remove <A HREF="https://github.com/tseemann/prokka">Prokka's</A> dependency on RNAmmer
62 which is encumbered by a free-for-academic sign-up license, and by RNAmmer's
63 dependence on legacy HMMER 2.x which conflicts with HMMER 3.x that most people are using now.
91 Barrnap is designed to be a substitute for [RNAmmer](http://www.cbs.dtu.dk/services/RNAmmer/).
92 It was motivated by my desire to remove [Prokka's](https://github.com/tseemann/prokka)
93 dependency on RNAmmer which is encumbered by a free-for-academic sign-up
94 license, and by RNAmmer's dependence on legacy HMMER 2.x which conflicts
95 with HMMER 3.x that most people are using now.
6496
65 RNAmmer is more sophisticated than Barrnap, and more accurate because it uses HMMER 2.x in glocal alignment mode whereas NHMMER 3.x currently only supports local alignment (Sean Eddy expects glocal to be supported in 2014). In practice, Barrnap will find all the typical rRNA genes in a few seconds (in bacteria), but may get the end points out by a few bases and will probably miss wierd rRNAs. The HMM models it uses are derived from Rfam, Silva and RefSeq.
97 RNAmmer is more sophisticated than Barrnap, and more accurate because it
98 uses HMMER 2.x in glocal alignment mode whereas NHMMER 3.x currently only
99 supports local alignment (Sean Eddy expected glocal to be supported in 2014,
100 but it still isn't available in 2018).
101
102 In practice, Barrnap will find all the typical rRNA genes in a few seconds
103 (in bacteria), but may get the end points out by a few bases and will
104 probably miss wierd rRNAs. The HMM models it uses are derived from Rfam,
105 Silva and RefSeq.
66106
67107 ## Data sources for HMM models
68108
69 <pre>
109 ```
70110 Bacteria (70S)
71111 LSU 50S
72112 5S RF00001
89129 28S SILVA-LSU-Euk
90130 SSU 40S
91131 18S RF01960
92 Mito
132
133 Metazoan Mito
93134 12S RefSeq (MT-RNR1, s-rRNA, rns)
94135 16S RefSeq (MT-RNR2, l-rRNA, rnl)
136 ```
95137
96 TODO: [Sajeet Haridas]
97 Fungi
138 ## Models I would like to add
139
140 ```
141 Fungi [Sajeet Haridas]
98142 LSU 35S ?
99143 5S
100144 5.8S
105149 15S
106150 21S (multiple exons)
107151
108
109 TODO:
110152 Apicoplast [http://www.ncbi.nlm.nih.gov/nuccore/U87145.2]
111153 LSU ~2500bp 28S ?
112154 SSU ~1500bp 16S ?
113155
114 Plastid [Shaun Jackman]
115 ?
116
117 </pre>
156 Plant [Shaun Jackman]
157 Mito [https://www.ncbi.nlm.nih.gov/nucleotide?cmd=Retrieve&dopt=GenBank&list_uids=26556996]
158 5S ~118 bp ? rrn5 (use RF00001 ?)
159 18S ~1935 bp ? rrn18 (use RF01960 ?)
160 26S ~2568 bp ? rrn26
161 ```
118162
119163 ## Where does the name come from?
120164
124168 The project was originally spawned at CodeFest 2013 in Berlin, Germany
125169 by Torsten Seemann and Tim Booth.
126170
171 ## License
172
173 * Barrnap: [GPLv3](https://raw.githubusercontent.com/tseemann/barrnap/master/LICENSE)
174 * Rfam: [CC0](https://raw.githubusercontent.com/tseemann/barrnap/master/LICENSE.Rfam)
175 * SILVA: [Free for academic use](https://raw.githubusercontent.com/tseemann/barrnap/master/LICENSE.SILVA)
176
177 ## Author
178
179 Torsten Seemann
180
00 #!/usr/bin/env perl
11 use strict;
22 use warnings;
3 use Time::Piece;
43 use List::Util qw(max);
54 use FindBin;
5 use File::Temp;
66
77 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
88 # global variables
99
10 my $VERSION = "0.9";
1011 my $EXE = $FindBin::RealScript;
11 my $VERSION = "0.8";
1212 my $DESC = "rapid ribosomal RNA prediction";
13 my $AUTHOR = 'Torsten Seemann <torsten.seemann@gmail.com>';
13 my $AUTHOR = 'Torsten Seemann';
1414 my $URL = 'https://github.com/tseemann/barrnap';
1515 my $DBDIR = "$FindBin::RealBin/../db";
1616 my $OPSYS = $^O;
2626 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2727 # command line options
2828
29 my(@Options, $quiet, $kingdom, $threads, $evalue, $lencutoff, $reject, $incseq);
29 my(@Options, $quiet, $kingdom, $threads, $evalue, $lencutoff, $reject, $incseq, $outseq);
3030 setOptions();
3131
3232 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3939 msg("Adding $BINDIR to end of PATH");
4040 $ENV{PATH} .= ":$BINDIR";
4141
42 my($NHMMER) = qx(which -a nhmmer 2> /dev/null);
43 $NHMMER or err("Could not find 'nhmmer' executable in PATH");
44 chomp $NHMMER;
45 msg("Using HMMER binary: $NHMMER");
42 msg("Checking for dependencies:");
43 require_exe('nhmmer', 'bedtools');
4644
4745 $threads > 0 or err("Invalid --threads $threads");
4846 msg("Will use $threads threads");
5755 msg("Will reject genes < $reject of expected length.");
5856
5957 my $kdom = $KINGDOM{ lc substr($kingdom,0,1) } or
60 err("I don't recognise --kingdom '$kingdom'. Try: bac arc euk mito");
58 err("I don't recognise --kingdom '$kingdom'. Try:", values(%KINGDOM) );
6159
6260 my $hmmdb = "$DBDIR/$kdom.hmm";
6361 err("Can't find database: $hmmdb") unless -r $hmmdb;
6462 msg("Using database: $hmmdb");
6563
6664 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
65 # check if user is piping to STDIN
66 # nhmmer needs to fseek() so we make a temp fasta file
67
68 my $fasta = shift @ARGV;
69 my $tmpfh;
70 if (defined($fasta) && $fasta eq '-' or !defined($fasta) && !-t \*STDIN) {
71 $tmpfh = File::Temp->new(UNLINK=>1);
72 msg("Copying STDIN to a temporary file:", $tmpfh->filename);
73 while (<STDIN>) {
74 print $tmpfh $_;
75 }
76 $fasta = $tmpfh->filename;
77 }
78 $fasta && -r $fasta or err("No input file on command line or stdin");
79
80 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
6781 # run the external command
6882
69 my $fasta = shift @ARGV;
70 $fasta && -r $fasta or err("Usage: $EXE <file.fasta>");
71
7283 msg("Scanning $fasta for $kdom rRNA genes... please wait");
73 my $cmd = "$NHMMER --cpu $threads -E $evalue --w_length $MAXLEN -o /dev/null --tblout /dev/stdout \Q$hmmdb\E \Q$fasta\E";
84 my $opts = "--cpu $threads -E $evalue --w_length $MAXLEN -o /dev/null --tblout /dev/stdout";
85 my $cmd = "nhmmer $opts '$hmmdb' '$fasta'";
7486 msg("Command: $cmd");
7587 my @hits = qx($cmd 2>&1);
7688
7789 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
7890 # process the output
7991
92 my %hitname;
8093 my @feat;
94 my @bed;
8195 HIT:
8296 foreach (@hits) {
8397 chomp;
87101 my @x = split ' ', $_;
88102 err("bad line in nhmmer output - @x") unless defined $x[6] and $x[6] =~ m/^\d+$/;
89103
104 # massage to GFF
90105 my($begin,$end,$strand) = $x[6] < $x[7] ? ($x[6],$x[7],'+') : ($x[7],$x[6],'-');
91106 my($seqid, $gene, $prod) = ($x[0], $x[2], $x[2]);
92107 my $score = defined $x[12] ? $x[12] : '.';
108
109 # record hits for --outseq retrieval later
110 $hitname{"$seqid/$begin:$end($strand)"} = $prod;
93111
94112 # check if hit makes sense to us
95113 exists $LENG{$gene} or err("Detected unknown gene '$gene' in scan, aborting.");
111129 $prod .= " (partial)";
112130 }
113131
132 # keep track of good hits for retrievel later
133 push @bed, [ $seqid, $begin-1, $end, $gene, 100, $strand ];
134
114135 msg("Found:", $gene, $seqid, "L=$len/$LENG{$gene}", "$begin..$end", $strand, $prod);
115136 my $tags = "Name=$gene;product=$prod";
116137 $tags .= ";note=$note" if $note;
139160 print while (<FASTA>); # `cat $fasta`
140161 }
141162
142 #----------------------------------------------------------------------
143
163 if ($outseq) {
164 msg("Writing hit sequences to: $outseq");
165 my $bed = File::Temp->new();
166 for my $b (@bed) {
167 print $bed join("\t", @$b),"\n";
168 }
169 $bed->seek(0, SEEK_END); # rewind
170 my $cmd = "bedtools getfasta -s -name+ -fo '$outseq' -fi '$fasta' -bed '".$bed->filename."'";
171 msg("Running: $cmd");
172 system($cmd);
173 }
174
175 # . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
176 # final cleanup
177
178 msg("Done.");
179
180 #----------------------------------------------------------------------
181 sub require_exe {
182 for my $exe (@_) {
183 my($which) = qx(which $exe 2> /dev/null);
184 $which or err("Can not find required '$exe' in PATH");
185 chomp $which;
186 msg("Found $exe - $which");
187 }
188 }
189
190 #----------------------------------------------------------------------
191 sub revcom {
192 my($s) = @_;
193 $s = reverse($s);
194 $s =~ tr/ATCGatcg/TAGCtagc/;
195 return $s;
196 }
197
198 #----------------------------------------------------------------------
144199 sub msg {
145200 return if $quiet;
146 my $t = localtime;
147 my $line = "[".$t->hms."] @_\n";
201 my $line = "[$EXE] @_\n";
148202 print STDERR $line;
149203 }
150204
151205 #----------------------------------------------------------------------
152
153206 sub err {
154207 $quiet=0;
155 msg(@_);
208 msg("ERROR:", @_);
156209 exit(2);
157210 }
158211
159212 #----------------------------------------------------------------------
160
161213 sub version {
162214 print STDERR "$EXE $VERSION\n";
163215 exit;
164216 }
165217
166218 #----------------------------------------------------------------------
167
168219 sub show_citation {
169220 print STDERR << "EOCITE";
170221
171222 If you use Barrnap in your work, please cite:
172223
173 Seemann T (2013)
224 Seemann T
174225 $EXE $VERSION : $DESC
175226 $URL
176227
192243 {OPT=>"help", VAR=>\&usage, DESC=>"This help"},
193244 {OPT=>"version", VAR=>\&version, DESC=>"Print version and exit"},
194245 {OPT=>"citation",VAR=>\&show_citation, DESC=>"Print citation for referencing $EXE"},
195 {OPT=>"kingdom=s", VAR=>\$kingdom, DEFAULT=>'bac',
196 DESC=>"Kingdom: ".join(' ', values %KINGDOM) },
246 {OPT=>"kingdom=s", VAR=>\$kingdom, DEFAULT=>'bac', DESC=>"Kingdom: ".join(' ', values %KINGDOM) },
197247 {OPT=>"quiet!", VAR=>\$quiet, DEFAULT=>0, DESC=>"No screen output"},
198 {OPT=>"threads=i", VAR=>\$threads, DEFAULT=>8, DESC=>"Number of threads/cores/CPUs to use"},
248 {OPT=>"threads=i", VAR=>\$threads, DEFAULT=>1, DESC=>"Number of threads/cores/CPUs to use"},
199249 {OPT=>"lencutoff=f",VAR=>\$lencutoff, DEFAULT=>0.8, DESC=>"Proportional length threshold to label as partial"},
200 {OPT=>"reject=f",VAR=>\$reject, DEFAULT=>0.5, DESC=>"Proportional length threshold to reject prediction"},
250 {OPT=>"reject=f",VAR=>\$reject, DEFAULT=>0.25, DESC=>"Proportional length threshold to reject prediction"},
201251 {OPT=>"evalue=f",VAR=>\$evalue, DEFAULT=>1E-6, DESC=>"Similarity e-value cut-off"},
202 {OPT=>"incseq!", VAR=>\$incseq, DEFAULT=>0, DESC=>"Include FASTA input sequences in GFF3 output"},
252 {OPT=>"incseq!", VAR=>\$incseq, DEFAULT=>0, DESC=>"Include FASTA _input_ sequences in GFF3 output"},
253 {OPT=>"outseq=s", VAR=>\$outseq, DEFAULT=>'', DESC=>"Save rRNA hit seqs to this FASTA file"},
203254 );
204255
205 (!@ARGV) && (usage());
206
207 &GetOptions(map {$_->{OPT}, $_->{VAR}} grep { ref } @Options) || usage();
256 # (!@ARGV) && (usage(1));
257
258 &GetOptions(map {$_->{OPT}, $_->{VAR}} grep { ref } @Options) || usage(1);
208259
209260 # Now setup default values.
210261 foreach (@Options) {
217268 #----------------------------------------------------------------------
218269
219270 sub usage {
220 print STDERR "Synopsis:\n $EXE $VERSION - $DESC\n";
221 print STDERR "Author:\n $AUTHOR\n";
222 print STDERR "Usage:\n $EXE [options] <chromosomes.fasta>\n";
271 my($exitcode) = @_;
272 $exitcode = 0 if $exitcode eq 'help'; # what gets passed by getopt func ref
273 $exitcode ||= 0;
274 select STDERR if $exitcode; # write to STDERR if exitcode is error
275
276 print "Synopsis:\n $EXE $VERSION - $DESC\n";
277 print "Author:\n $AUTHOR\n";
278 print "Usage:\n";
279 print " $EXE [options] chr.fa\n";
280 print " $EXE [options] < chr.fa\n";
281 print " $EXE [options] - < chr.fa\n";
223282 foreach (@Options) {
224283 if (ref) {
225284 my $def = defined($_->{DEFAULT}) ? " (default '$_->{DEFAULT}')" : "";
229288 $opt =~ s/=s$/ [X]/;
230289 $opt =~ s/=i$/ [N]/;
231290 $opt =~ s/=f$/ [n.n]/;
232 printf STDERR " --%-15s %s%s\n", $opt, $_->{DESC}, $def;
291 printf " --%-15s %s%s\n", $opt, $_->{DESC}, $def;
233292 }
234293 else {
235 print STDERR "$_\n";
294 print "$_\n";
236295 }
237296 }
238 exit(1);
239 }
240
241 #----------------------------------------------------------------------
297 exit($exitcode);
298 }
299
300 #----------------------------------------------------------------------
0 HMMER3/f [3.1b2 | February 2015]
1 NAME 18S_rRNA
2 ACC RF01960
3 DESC Eukaryotic small subunit ribosomal RNA
4 LENG 1851
5 MAXL 2860
6 ALPH RNA
7 RF yes
8 MM no
9 CONS yes
10 CS yes
11 MAP yes
12 DATE Thu Apr 20 11:07:37 2017
13 NSEQ 91
14 EFFN 4.429474
15 CKSUM 3445497107
16 STATS LOCAL MSV -13.4315 0.69488
17 STATS LOCAL VITERBI -14.7858 0.69488
18 STATS LOCAL FORWARD -7.0200 0.69488
19 HMM A C G U
20 m->m m->i m->d i->m i->i d->m d->d
21 COMPO 1.33849 1.53541 1.34060 1.34437
22 1.38629 1.38629 1.38629 1.38629
23 0.09303 4.19411 2.60708 1.46634 0.26236 0.00000 *
24 1 1.15271 1.89687 2.03589 0.90729 1 u u - :
25 1.38629 1.38629 1.38629 1.38629
26 0.03257 4.13365 4.13365 1.46634 0.26236 1.04592 0.43289
27 2 0.57824 1.95456 2.05834 1.77301 2 a A - :
28 1.38629 1.38629 1.38629 1.38629
29 0.03184 4.15616 4.15616 1.46634 0.26236 0.45528 1.00587
30 3 2.04131 0.67716 2.31771 1.33338 3 c C - :
31 1.38629 1.38629 1.38629 1.38629
32 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
33 4 3.00883 0.23904 2.96558 2.19164 4 c C - <
34 1.38629 1.38629 1.38629 1.38629
35 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
36 5 2.70790 2.22080 2.95522 0.25782 5 u U - <
37 1.38629 1.38629 1.38629 1.38629
38 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
39 6 2.45358 3.07488 0.20468 2.93911 6 g G - <
40 1.38629 1.38629 1.38629 1.38629
41 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
42 7 2.20330 3.13796 0.22805 2.99359 7 g G - <
43 1.38629 1.38629 1.38629 1.38629
44 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
45 8 3.05295 2.54038 3.20227 0.18239 8 u U - <
46 1.38629 1.38629 1.38629 1.38629
47 0.03709 4.19411 3.84769 1.46634 0.26236 1.09861 0.40547
48 9 2.52990 2.13027 2.52319 0.32667 9 u U - _
49 1.38629 1.38629 1.38629 1.38629
50 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
51 10 2.52519 3.50347 0.15915 3.29704 10 g G - _
52 1.38629 1.38629 1.38629 1.38629
53 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
54 11 0.14048 3.20321 3.04324 3.15244 11 a A - _
55 1.38629 1.38629 1.38629 1.38629
56 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
57 12 2.65946 2.41462 2.98321 0.23574 12 u U - _
58 1.38629 1.38629 1.38629 1.38629
59 0.03473 4.18785 3.96556 1.46634 0.26236 0.88146 0.53474
60 13 3.03671 0.25827 3.21320 1.97045 13 c C - _
61 1.38629 1.38629 1.38629 1.38629
62 0.03075 4.19035 4.19035 1.46634 0.26236 1.17833 0.36787
63 14 3.21817 0.17668 3.40515 2.42220 14 c C - _
64 1.38629 1.38629 1.38629 1.38629
65 0.03075 4.19035 4.19035 1.46634 0.26236 1.17833 0.36787
66 15 3.00919 2.46274 3.16013 0.19474 15 u U - _
67 1.38629 1.38629 1.38629 1.38629
68 0.03075 4.19035 4.19035 1.46634 0.26236 0.95604 0.48518
69 16 2.45701 3.47595 0.16813 3.26658 16 g G - >
70 1.38629 1.38629 1.38629 1.38629
71 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
72 17 3.07961 0.22255 3.15187 2.20026 17 c C - >
73 1.41687 1.37631 1.41687 1.33732
74 0.03709 3.84769 4.19411 1.33209 0.30642 1.09861 0.40547
75 18 3.01214 0.20055 3.10157 2.43545 21 c C - >
76 1.38629 1.38629 1.38629 1.38629
77 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
78 19 0.24050 2.87491 2.54516 2.53977 22 a A - >
79 1.38629 1.38629 1.38629 1.38629
80 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
81 20 2.54497 3.09219 0.18567 3.08837 23 g G - >
82 1.38629 1.38629 1.38629 1.38629
83 0.03872 4.19411 3.77694 1.46634 0.26236 1.09861 0.40547
84 21 2.10076 2.02400 2.39866 0.42362 24 u U - ,
85 1.38629 1.38629 1.38629 1.38629
86 0.03088 4.18627 4.18627 1.46634 0.26236 0.84063 0.56465
87 22 0.63149 1.98133 1.78400 1.81799 25 a a - {
88 1.38629 1.38629 1.38629 1.38629
89 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
90 23 1.78422 2.11899 0.60546 1.79519 26 g g - {
91 1.38629 1.38629 1.38629 1.38629
92 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
93 24 2.14750 1.75794 2.22365 0.50648 27 u u - {
94 1.38629 1.38629 1.38629 1.38629
95 0.24012 4.19411 1.61754 1.46634 0.26236 1.09861 0.40547
96 25 1.98283 0.73347 1.75042 1.56839 28 c c - -
97 1.39689 1.39689 1.39689 1.35516
98 0.04584 3.63667 3.99162 1.08150 0.41413 0.14156 2.02498
99 26 0.49626 2.17929 1.89417 2.05861 30 a a - {
100 1.38629 1.38629 1.38629 1.38629
101 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
102 27 2.63112 2.17678 2.69893 0.29126 31 u U - {
103 1.38629 1.38629 1.38629 1.38629
104 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
105 28 0.20526 3.04106 2.59307 2.76484 32 a A - {
106 1.38629 1.38629 1.38629 1.38629
107 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
108 29 2.07477 1.71120 2.38754 0.50765 33 u c - {
109 1.38629 1.38629 1.38629 1.38629
110 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
111 30 2.03263 2.73755 0.30267 2.72662 34 g g - {
112 1.38629 1.38629 1.38629 1.38629
113 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
114 31 3.19908 0.18543 3.38620 2.35791 35 c C - {
115 1.38629 1.38629 1.38629 1.38629
116 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
117 32 3.22346 2.87889 3.35684 0.14025 36 u U - {
118 1.38629 1.38629 1.38629 1.38629
119 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
120 33 1.97792 1.59474 2.05113 0.63470 37 u U - ,
121 1.38629 1.38629 1.38629 1.38629
122 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
123 34 1.62631 2.33980 0.52605 2.15363 38 g c - {
124 1.38629 1.38629 1.38629 1.38629
125 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
126 35 2.11968 1.88016 2.03437 0.51651 39 u u - {
127 1.38629 1.38629 1.38629 1.38629
128 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
129 36 1.97865 0.74371 1.88618 1.44924 40 c c - {
130 1.38629 1.38629 1.38629 1.38629
131 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
132 37 2.87977 2.17400 3.03234 0.24599 41 u U - {
133 1.38629 1.38629 1.38629 1.38629
134 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
135 38 2.25741 0.54378 2.63048 1.41557 42 c c - {
136 1.38629 1.38629 1.38629 1.38629
137 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
138 39 0.61489 1.98439 1.78095 1.87501 43 a c - {
139 1.38629 1.38629 1.38629 1.38629
140 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
141 40 0.40646 2.17504 2.35757 2.07352 44 a a - {
142 1.38629 1.38629 1.38629 1.38629
143 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
144 41 0.53203 2.47262 1.53730 2.17802 45 a A - {
145 1.38629 1.38629 1.38629 1.38629
146 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
147 42 3.09270 3.81113 0.09897 3.62220 46 G G - {
148 1.38629 1.38629 1.38629 1.38629
149 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
150 43 0.65828 1.83152 1.77813 1.87645 47 a A - -
151 1.38629 1.38629 1.38629 1.38629
152 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
153 44 2.62612 1.48391 2.76624 0.44943 48 u U - -
154 1.38629 1.38629 1.38629 1.38629
155 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
156 45 3.07065 2.78301 3.00005 0.17201 49 u U - -
157 1.38629 1.38629 1.38629 1.38629
158 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
159 46 0.29188 2.50273 2.74337 2.23562 50 a A - -
160 1.38629 1.38629 1.38629 1.38629
161 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
162 47 0.10905 3.58544 3.14370 3.42760 51 a A - -
163 1.38629 1.38629 1.38629 1.38629
164 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
165 48 2.54893 3.34014 0.17809 3.00503 52 g G - {
166 1.38629 1.38629 1.38629 1.38629
167 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
168 49 3.28450 0.15569 3.46983 2.58233 53 c C - {
169 1.39811 1.39811 1.35165 1.39811
170 0.03806 3.80508 4.19411 1.05065 0.43034 1.09861 0.40547
171 50 2.90149 0.21429 3.26332 2.30574 55 c C - {
172 1.38629 1.38629 1.38629 1.38629
173 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
174 51 0.14270 3.02210 3.23561 3.10218 56 a A - -
175 1.38629 1.38629 1.38629 1.38629
176 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
177 52 3.22346 2.87889 3.35684 0.14025 57 u U - {
178 1.38629 1.38629 1.38629 1.38629
179 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
180 53 2.53108 3.51465 0.15772 3.30831 58 g G - {
181 1.38629 1.38629 1.38629 1.38629
182 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
183 54 3.19602 0.18662 3.38306 2.34993 59 c C - {
184 1.38629 1.38629 1.38629 1.38629
185 0.03806 4.19411 3.80508 1.46634 0.26236 1.09861 0.40547
186 55 0.08387 3.74529 3.52027 3.60355 60 A A - ,
187 1.38629 1.38629 1.38629 1.38629
188 0.03086 4.18691 4.18691 1.46634 0.26236 0.85672 0.55261
189 56 1.44241 1.88581 2.15777 0.70047 61 u U - ,
190 1.38629 1.38629 1.38629 1.38629
191 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
192 57 2.12219 3.10159 0.25861 2.76255 62 g G - <
193 1.38629 1.38629 1.38629 1.38629
194 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
195 58 2.75055 1.85885 2.89778 0.32143 63 u U - <
196 1.38629 1.38629 1.38629 1.38629
197 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
198 59 1.87891 0.82973 1.44354 1.74305 64 c c - -
199 1.38629 1.38629 1.38629 1.38629
200 0.04579 4.19411 3.51747 1.46634 0.26236 1.09861 0.40547
201 60 2.03864 1.97498 2.33530 0.45531 65 u U - -
202 1.38629 1.38629 1.38629 1.38629
203 0.03109 4.17941 4.17941 1.46634 0.26236 0.99761 0.46007
204 61 0.74927 1.60959 1.86719 1.75585 66 a A - -
205 1.38629 1.38629 1.38629 1.38629
206 0.05075 4.18647 3.37317 1.46634 0.26236 0.84567 0.56084
207 62 0.43422 2.09555 2.33397 2.02254 67 a a - <
208 1.38629 1.38629 1.38629 1.38629
209 0.03123 4.17499 4.17499 1.46634 0.26236 0.63487 0.75503
210 63 2.72200 3.61502 0.13411 3.41594 68 g G - <
211 1.38629 1.38629 1.38629 1.38629
212 0.03689 4.19411 3.85678 1.46634 0.26236 1.09861 0.40547
213 64 1.51529 1.94747 2.25362 0.62998 69 u u - <
214 1.52795 1.55585 1.22158 1.28285
215 0.07947 2.79335 4.18804 2.51056 0.08471 1.22413 0.34816
216 65 0.90492 1.88954 1.64248 1.38316 100 a a - -
217 1.38629 1.38629 1.38629 1.38629
218 0.03082 4.18804 4.18804 1.46634 0.26236 1.22413 0.34816
219 66 2.17618 0.80892 2.21489 1.10255 101 c c - -
220 1.38629 1.38629 1.38629 1.38629
221 0.03082 4.18804 4.18804 1.46634 0.26236 0.88680 0.53098
222 67 0.70648 1.94748 1.61256 1.80416 102 a A - -
223 1.38629 1.38629 1.38629 1.38629
224 0.04778 4.19411 3.45554 1.46634 0.26236 1.09861 0.40547
225 68 1.00384 1.66764 1.55552 1.45346 103 a a - -
226 1.38629 1.38629 1.38629 1.38629
227 0.03115 4.17749 4.17749 1.46634 0.26236 0.67069 0.71612
228 69 1.06269 1.74671 1.23541 1.66382 104 a a - <
229 1.38629 1.38629 1.38629 1.38629
230 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
231 70 1.65057 0.98130 1.80581 1.31343 105 c c - <
232 1.38629 1.38629 1.38629 1.38629
233 0.03851 4.19411 3.78580 1.46634 0.26236 1.09861 0.40547
234 71 1.41567 1.43530 1.45292 1.25419 106 u u - _
235 1.38629 1.38629 1.38629 1.38629
236 0.03902 4.18647 3.76931 1.46634 0.26236 1.25399 0.33598
237 72 1.43334 1.61154 1.27266 1.26647 107 u u - _
238 1.36961 1.46936 1.41614 1.29801
239 0.34781 2.24583 1.67172 0.47751 0.96844 1.39176 0.28587
240 73 1.25015 1.43953 1.63849 1.26505 110 a a - _
241 1.38629 1.38629 1.38629 1.38629
242 0.03774 3.98910 3.98910 1.46634 0.26236 0.60224 0.79316
243 74 1.52193 1.77796 2.16371 0.69750 111 u U - _
244 1.38629 1.38629 1.38629 1.38629
245 0.03313 4.11705 4.11705 1.46634 0.26236 0.87576 0.53879
246 75 1.48898 1.70386 1.83385 0.83789 112 u u - _
247 1.61255 1.48426 1.19120 1.30897
248 0.35825 2.21600 1.64996 2.22022 0.11495 1.32344 0.30954
249 76 1.28057 1.65321 1.26143 1.39660 128 g a - _
250 1.38629 1.38629 1.38629 1.38629
251 0.03851 3.96920 3.96920 1.46634 0.26236 0.47315 0.97561
252 77 1.36365 1.46553 1.82078 1.04578 129 u u - _
253 1.38629 1.38629 1.38629 1.38629
254 0.03272 4.12924 4.12924 1.46634 0.26236 0.68948 0.69683
255 78 0.68596 1.87978 1.88744 1.64865 130 a A - _
256 1.38629 1.38629 1.38629 1.38629
257 0.03139 4.17016 4.17016 1.46634 0.26236 1.51929 0.24701
258 79 1.37490 1.21437 1.64468 1.35804 131 c c - _
259 1.38629 1.38629 1.38629 1.38629
260 0.03139 4.17016 4.17016 1.46634 0.26236 1.51929 0.24701
261 80 1.35520 1.88098 1.09299 1.36865 132 g g - _
262 1.38629 1.38629 1.38629 1.38629
263 0.03139 4.17016 4.17016 1.46634 0.26236 0.57578 0.82614
264 81 1.61583 1.95475 0.79558 1.56851 133 g g - >
265 1.38629 1.38629 1.38629 1.38629
266 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
267 82 1.75819 1.50561 1.76896 0.83183 134 u u - >
268 1.41868 1.35241 1.41868 1.35744
269 0.05132 3.35397 4.19411 0.71465 0.67210 1.09861 0.40547
270 83 2.01073 2.15655 0.57845 1.66275 136 g G - -
271 1.38629 1.38629 1.38629 1.38629
272 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
273 84 0.27338 3.00442 2.05429 2.78958 137 a A - -
274 1.38629 1.38629 1.38629 1.38629
275 0.03918 4.19411 3.75777 1.46634 0.26236 1.09861 0.40547
276 85 0.43365 2.42722 1.81756 2.29110 138 a A - -
277 1.41055 1.41055 1.36264 1.36259
278 0.04642 3.50163 4.18582 0.81717 0.58283 0.82977 0.57296
279 86 0.71397 2.16353 1.94004 1.37957 140 a a - >
280 1.38629 1.38629 1.38629 1.38629
281 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
282 87 2.93902 0.19227 3.32426 2.45346 141 c C - >
283 1.38629 1.38629 1.38629 1.38629
284 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
285 88 2.28460 1.16892 2.22147 0.73598 142 u u - >
286 1.38629 1.38629 1.38629 1.38629
287 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
288 89 2.87958 3.53533 0.12792 3.35908 143 g G - >
289 1.38629 1.38629 1.38629 1.38629
290 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
291 90 2.57818 0.42081 2.86312 1.55835 144 c C - >
292 1.38629 1.38629 1.38629 1.38629
293 0.03948 4.19411 3.74537 1.46634 0.26236 1.09861 0.40547
294 91 1.89072 2.98452 0.30339 2.81075 145 g G - ,
295 1.38629 1.38629 1.38629 1.38629
296 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
297 92 0.88585 1.98594 1.26432 1.78407 146 a a - ,
298 1.38629 1.38629 1.38629 1.38629
299 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
300 93 0.16211 2.87556 3.15101 2.98651 147 a A - ,
301 1.38629 1.38629 1.38629 1.38629
302 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
303 94 1.51793 1.24205 2.05151 1.01197 148 u u - ,
304 1.38629 1.38629 1.38629 1.38629
305 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
306 95 1.86470 2.63260 0.37946 2.41987 149 g G - ,
307 1.38629 1.38629 1.38629 1.38629
308 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
309 96 2.37921 3.42415 0.18091 3.21171 150 g G - ,
310 1.38629 1.38629 1.38629 1.38629
311 0.03949 4.18553 3.75030 1.46634 0.26236 1.27154 0.32906
312 97 3.36071 0.13078 3.52987 2.83760 151 c C - [
313 1.38629 1.38629 1.38629 1.38629
314 0.03116 4.17720 4.17720 1.46634 0.26236 0.66635 0.72068
315 98 3.22346 2.87889 3.35684 0.14025 152 u U - [
316 1.38629 1.38629 1.38629 1.38629
317 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
318 99 3.25819 0.16413 3.44500 2.51323 153 c C - [
319 1.38629 1.38629 1.38629 1.38629
320 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
321 100 0.41702 1.85966 2.49497 2.27526 154 a A - ,
322 1.38629 1.38629 1.38629 1.38629
323 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
324 101 1.96520 2.21206 1.73464 0.55524 155 u U - ,
325 1.38629 1.38629 1.38629 1.38629
326 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
327 102 2.81700 2.32297 2.81178 0.24573 156 u U - ,
328 1.38629 1.38629 1.38629 1.38629
329 0.04487 4.19411 3.54766 1.46634 0.26236 1.09861 0.40547
330 103 0.22213 2.93345 2.62121 2.61376 157 a A - ,
331 1.31996 1.40942 1.40942 1.40942
332 0.04594 3.51975 4.18031 0.83386 0.56981 0.96388 0.48031
333 104 1.06701 1.49283 1.82717 1.30801 159 a a - ,
334 1.38629 1.38629 1.38629 1.38629
335 0.06348 4.18779 3.07206 1.46634 0.26236 1.22903 0.34612
336 105 0.37634 2.33268 2.39557 2.07563 160 a A - ,
337 1.38629 1.38629 1.38629 1.38629
338 0.04721 4.15615 3.49185 1.46634 0.26236 0.45516 1.00608
339 106 1.24899 1.54083 2.05084 0.99324 161 u u - (
340 1.38629 1.38629 1.38629 1.38629
341 0.03108 4.17978 4.17978 1.46634 0.26236 0.70768 0.67883
342 107 1.97015 0.51894 2.05847 1.98221 162 c c - (
343 1.38629 1.38629 1.38629 1.38629
344 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
345 108 0.46657 2.41327 1.87578 2.03948 163 a A - (
346 1.38629 1.38629 1.38629 1.38629
347 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
348 109 2.20868 2.64958 0.30362 2.50926 164 g G - (
349 1.38629 1.38629 1.38629 1.38629
350 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
351 110 2.09890 1.80413 2.50058 0.46084 165 u U - -
352 1.38629 1.38629 1.38629 1.38629
353 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
354 111 1.87261 1.36641 2.01538 0.78091 166 u u - -
355 1.38629 1.38629 1.38629 1.38629
356 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
357 112 0.92446 1.93873 1.39415 1.55436 167 a a - (
358 1.38629 1.38629 1.38629 1.38629
359 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
360 113 1.94172 1.76491 1.98479 0.60161 168 u u - (
361 1.38629 1.38629 1.38629 1.38629
362 0.03830 4.19411 3.79477 1.46634 0.26236 1.09861 0.40547
363 114 0.88344 1.99391 1.37861 1.61671 169 a a - -
364 1.38629 1.38629 1.38629 1.38629
365 0.03086 4.18668 4.18668 1.46634 0.26236 0.85080 0.55699
366 115 1.07713 2.09763 0.92117 1.97598 170 g a - -
367 1.39455 1.36193 1.39455 1.39455
368 0.03580 3.90774 4.19411 1.14641 0.38240 1.09861 0.40547
369 116 1.53651 1.95443 2.14034 0.64319 172 u u - (
370 1.38629 1.38629 1.38629 1.38629
371 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
372 117 1.77953 1.15866 1.96049 0.97660 173 u c - (
373 1.39844 1.39844 1.35073 1.39844
374 0.04597 3.79627 3.79550 1.04282 0.43457 1.09861 0.40547
375 118 1.82265 1.29585 1.96338 0.85718 175 u u - -
376 1.38629 1.38629 1.38629 1.38629
377 0.03086 4.18670 4.18670 1.46634 0.26236 1.24983 0.33765
378 119 0.97158 1.49230 1.62993 1.60586 176 a a - -
379 1.38629 1.38629 1.38629 1.38629
380 0.03086 4.18670 4.18670 1.46634 0.26236 0.85122 0.55668
381 120 1.52282 1.38068 1.85886 0.98177 177 u u - -
382 1.38629 1.38629 1.38629 1.38629
383 0.07306 4.19411 2.89364 1.46634 0.26236 1.09861 0.40547
384 121 1.55351 1.67103 1.61215 0.91384 178 u u - -
385 1.38629 1.38629 1.38629 1.38629
386 0.03194 4.15299 4.15299 1.46634 0.26236 0.43490 1.04222
387 122 1.45513 1.62235 1.52424 1.04580 179 u u - (
388 1.38629 1.38629 1.38629 1.38629
389 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
390 123 1.83588 1.94396 0.60247 1.89755 180 g g - (
391 1.38629 1.38629 1.38629 1.38629
392 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
393 124 1.00786 1.88166 1.26547 1.60667 181 a a - (
394 1.38629 1.38629 1.38629 1.38629
395 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
396 125 1.59037 1.36841 1.72308 1.01302 182 u u - (
397 1.38629 1.38629 1.38629 1.38629
398 0.03561 4.19411 3.91697 1.46634 0.26236 1.09861 0.40547
399 126 1.26673 1.50529 1.49413 1.30250 183 a a - ,
400 1.38629 1.38629 1.38629 1.38629
401 0.03078 4.18928 4.18928 1.46634 0.26236 1.19977 0.35848
402 127 1.40234 1.80295 1.22541 1.21899 184 u u - ,
403 1.42583 1.71149 1.27383 1.20619
404 0.96928 1.25599 1.09108 2.59778 0.07735 1.19977 0.35848
405 128 1.37360 1.41241 1.50689 1.26708 255 u u - ,
406 1.38629 1.38629 1.38629 1.38629
407 0.04565 3.80260 3.80260 1.46634 0.26236 1.42978 0.27360
408 129 1.38286 1.53077 1.44604 1.21311 256 u u - ,
409 1.38629 1.38629 1.38629 1.38629
410 0.04109 3.90553 3.90553 1.46634 0.26236 0.64655 0.74202
411 130 1.43808 1.42179 1.56542 1.16368 257 u u - ,
412 1.38629 1.38629 1.38629 1.38629
413 0.03451 4.07675 4.07675 1.46634 0.26236 0.71462 0.67212
414 131 1.22451 1.42678 1.57210 1.35322 258 a a - ,
415 1.38629 1.38629 1.38629 1.38629
416 0.03225 4.14336 4.14336 1.46634 0.26236 1.43812 0.27099
417 132 1.26987 1.53584 1.46107 1.30244 259 a a - ,
418 1.38629 1.38629 1.38629 1.38629
419 0.03200 4.15112 4.15112 1.46634 0.26236 0.73868 0.64960
420 133 1.23643 1.45815 1.66594 1.24514 260 a a - ,
421 1.38629 1.38629 1.38629 1.38629
422 0.03112 4.17855 4.17855 1.46634 0.26236 0.84676 0.56002
423 134 1.40661 1.74730 1.44702 1.06273 261 u u - ,
424 1.38629 1.38629 1.38629 1.38629
425 0.03077 4.18960 4.18960 1.46634 0.26236 0.93234 0.50027
426 135 1.36101 1.54026 1.43148 1.23678 262 u u - ,
427 1.38629 1.38629 1.38629 1.38629
428 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
429 136 1.56208 1.27730 1.78303 1.06891 263 u u - ,
430 1.38629 1.38629 1.38629 1.38629
431 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
432 137 1.82531 1.39347 1.85571 0.83407 264 u u - ,
433 1.38629 1.38629 1.38629 1.38629
434 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
435 138 0.81974 1.68218 1.80712 1.56371 265 a A - ,
436 1.38629 1.38629 1.38629 1.38629
437 0.04643 4.19411 3.49727 1.46634 0.26236 1.09861 0.40547
438 139 1.34558 1.22186 1.70981 1.33169 266 c c - <
439 1.38629 1.38629 1.38629 1.38629
440 0.03111 4.17880 4.17880 1.46634 0.26236 1.38814 0.28707
441 140 1.14729 1.86053 1.72344 1.05422 267 u a - <
442 1.38629 1.38629 1.38629 1.38629
443 0.03111 4.17880 4.17880 1.46634 0.26236 1.38814 0.28707
444 141 1.62232 1.59468 1.72580 0.86381 268 u u - <
445 1.38629 1.38629 1.38629 1.38629
446 0.03111 4.17880 4.17880 1.46634 0.26236 0.69130 0.69500
447 142 2.34744 3.41898 0.18503 3.20504 269 g G - <
448 1.38629 1.38629 1.38629 1.38629
449 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
450 143 2.19021 2.84847 0.25927 2.83775 270 g G - -
451 1.38629 1.38629 1.38629 1.38629
452 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
453 144 0.18586 2.81948 3.05807 2.76472 271 a A - -
454 1.36193 1.39455 1.39455 1.39455
455 0.03580 3.90774 4.19411 1.14641 0.38240 1.09861 0.40547
456 145 2.61339 2.15254 2.88679 0.28134 273 u U - -
457 1.38629 1.38629 1.38629 1.38629
458 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
459 146 0.08229 3.76409 3.53702 3.62298 274 A A - -
460 1.38629 1.38629 1.38629 1.38629
461 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
462 147 0.80833 1.68407 1.84945 1.55374 275 a c - <
463 1.38629 1.38629 1.38629 1.38629
464 0.04449 4.19411 3.56028 1.46634 0.26236 1.09861 0.40547
465 148 2.59954 0.31456 2.98741 1.92986 276 c C - <
466 1.38629 1.38629 1.38629 1.38629
467 0.03105 4.18067 4.18067 1.46634 0.26236 1.35707 0.29761
468 149 1.69439 1.29257 1.92622 0.92628 277 u u - <
469 1.38629 1.38629 1.38629 1.38629
470 0.03105 4.18067 4.18067 1.46634 0.26236 0.72325 0.66393
471 150 1.71273 1.64354 0.80363 1.72243 278 g c - <
472 1.38629 1.38629 1.38629 1.38629
473 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
474 151 1.73752 1.66391 1.95963 0.70575 279 u u - <
475 1.41009 1.41009 1.41009 1.31813
476 0.04573 3.51955 4.19411 0.82394 0.57750 1.09861 0.40547
477 152 1.51260 2.65225 0.46622 2.50342 281 g g - <
478 1.38629 1.38629 1.38629 1.38629
479 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
480 153 1.92694 1.96292 0.61462 1.75381 282 g g - <
481 1.38629 1.38629 1.38629 1.38629
482 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
483 154 1.74998 1.31391 1.77661 0.94612 283 u u - _
484 1.38629 1.38629 1.38629 1.38629
485 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
486 155 0.08229 3.76409 3.53702 3.62298 284 A A - _
487 1.38629 1.38629 1.38629 1.38629
488 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
489 156 0.08901 3.71422 3.42348 3.56882 285 A A - _
490 1.38629 1.38629 1.38629 1.38629
491 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
492 157 1.34108 1.60865 1.98671 0.91346 286 u u - _
493 1.38629 1.38629 1.38629 1.38629
494 0.05407 4.19411 3.28198 1.46634 0.26236 1.09861 0.40547
495 158 2.14172 1.81300 2.17655 0.50096 287 u U - _
496 1.38629 1.38629 1.38629 1.38629
497 0.03135 4.17138 4.17138 1.46634 0.26236 0.58964 0.80862
498 159 1.91556 0.70063 1.61656 1.84588 288 c c - >
499 1.38629 1.38629 1.38629 1.38629
500 0.04478 4.19411 3.55064 1.46634 0.26236 1.09861 0.40547
501 160 2.43350 1.47430 2.45089 0.51565 289 u c - >
502 1.38629 1.38629 1.38629 1.38629
503 0.03106 4.18039 4.18039 1.46634 0.26236 0.71829 0.66862
504 161 0.79392 1.92545 1.52123 1.69456 290 a a - >
505 1.38629 1.38629 1.38629 1.38629
506 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
507 162 1.77717 2.28135 0.58498 1.76248 291 g g - >
508 1.38629 1.38629 1.38629 1.38629
509 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
510 163 0.82132 1.77957 1.60285 1.66014 292 a a - >
511 1.38629 1.38629 1.38629 1.38629
512 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
513 164 2.13434 3.05838 0.26666 2.67679 293 g G - >
514 1.38629 1.38629 1.38629 1.38629
515 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
516 165 1.76104 0.56624 2.35262 1.79965 294 c g - >
517 1.38629 1.38629 1.38629 1.38629
518 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
519 166 2.92030 2.26479 3.07346 0.22819 295 u U - -
520 1.38629 1.38629 1.38629 1.38629
521 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
522 167 0.24799 2.51610 2.86260 2.50425 296 a A - -
523 1.38629 1.38629 1.38629 1.38629
524 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
525 168 0.08229 3.76409 3.53702 3.62298 297 A A - -
526 1.38629 1.38629 1.38629 1.38629
527 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
528 169 2.74528 2.45712 2.53870 0.25991 298 u U - -
529 1.38629 1.38629 1.38629 1.38629
530 0.03786 4.19411 3.81364 1.46634 0.26236 1.09861 0.40547
531 170 0.13433 3.44544 2.88306 3.27432 299 a A - -
532 1.38629 1.38629 1.38629 1.38629
533 0.03085 4.18710 4.18710 1.46634 0.26236 0.86166 0.54898
534 171 3.17670 0.19435 3.36307 2.29981 300 c C - >
535 1.38629 1.38629 1.38629 1.38629
536 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
537 172 0.90002 1.81127 1.54821 1.52618 301 a a - >
538 1.38629 1.38629 1.38629 1.38629
539 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
540 173 1.91865 1.96834 2.15006 0.51579 302 u u - >
541 1.38629 1.38629 1.38629 1.38629
542 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
543 174 1.88880 2.36979 0.45533 2.11191 303 g g - >
544 1.38629 1.38629 1.38629 1.38629
545 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
546 175 1.42012 1.05895 1.73161 1.45032 304 c c - ,
547 1.38629 1.38629 1.38629 1.38629
548 0.03929 4.19411 3.75311 1.46634 0.26236 1.09861 0.40547
549 176 1.10678 1.77601 1.45511 1.32166 305 a a - ,
550 1.38629 1.38629 1.38629 1.38629
551 0.03090 4.18571 4.18571 1.46634 0.26236 1.26815 0.33038
552 177 1.06347 1.42578 1.69255 1.46805 306 a a - ,
553 1.38629 1.38629 1.38629 1.38629
554 0.05342 4.18571 3.30219 1.46634 0.26236 1.26815 0.33038
555 178 1.17552 1.48454 1.59011 1.34388 307 a a - ,
556 1.38629 1.38629 1.38629 1.38629
557 0.05607 4.16389 3.24482 1.46634 0.26236 1.60416 0.22447
558 179 1.11264 1.55765 1.65287 1.31238 308 a a - ,
559 1.38629 1.38629 1.38629 1.38629
560 0.10560 4.14018 2.47338 1.46634 0.26236 1.86882 0.16760
561 180 1.06160 1.62235 1.45138 1.50321 309 a a - ,
562 0.97727 1.70885 1.47599 1.54160
563 0.49996 1.10914 2.75510 0.69346 0.69283 0.72906 0.65848
564 181 1.24000 1.70820 1.22799 1.44163 314 g c - <
565 1.38629 1.38629 1.38629 1.38629
566 0.03390 4.09426 4.09426 1.46634 0.26236 2.23000 0.11376
567 182 1.58313 1.18402 1.61933 1.23584 315 c c - <
568 1.38629 1.38629 1.38629 1.38629
569 0.03390 4.09426 4.09426 1.46634 0.26236 2.23000 0.11376
570 183 1.54673 1.28223 1.50992 1.24233 316 u c - <
571 1.38629 1.38629 1.38629 1.38629
572 0.03390 4.09426 4.09426 1.46634 0.26236 2.23000 0.11376
573 184 1.72152 1.23393 1.51108 1.17316 317 u c - <
574 1.38629 1.38629 1.38629 1.38629
575 0.03390 4.09426 4.09426 1.46634 0.26236 2.23000 0.11376
576 185 1.59465 1.40691 1.34896 1.22891 318 u c - <
577 1.38629 1.38629 1.38629 1.38629
578 0.04736 4.09426 3.52037 1.46634 0.26236 2.23000 0.11376
579 186 1.37945 1.75735 1.16949 1.32706 319 g a - -
580 1.38629 1.38629 1.38629 1.38629
581 0.03436 4.08125 4.08125 1.46634 0.26236 2.31006 0.10453
582 187 1.09816 1.70809 1.42497 1.40736 320 a a - -
583 1.38629 1.38629 1.38629 1.38629
584 0.07261 4.08125 2.93462 1.46634 0.26236 0.93178 0.50063
585 188 1.62932 1.10786 1.57057 1.32522 321 c c - <
586 1.38629 1.38629 1.38629 1.38629
587 0.03388 4.09501 4.09501 1.46634 0.26236 2.22512 0.11435
588 189 1.45361 1.37228 1.61427 1.15929 322 u c - <
589 1.42814 1.41318 1.45318 1.26213
590 0.84148 1.02474 1.56047 2.86967 0.05839 2.22512 0.11435
591 190 1.30622 1.59302 1.42414 1.25480 386 u a - _
592 1.38629 1.38629 1.38629 1.38629
593 0.04217 3.88011 3.88011 1.46634 0.26236 1.05057 0.43038
594 191 1.55618 1.58656 1.32541 1.14339 387 u u - _
595 1.38629 1.38629 1.38629 1.38629
596 0.03723 4.00235 4.00235 1.46634 0.26236 1.81641 0.17746
597 192 1.25868 1.72624 1.44321 1.19782 388 u u - _
598 1.38629 1.38629 1.38629 1.38629
599 0.03630 4.02706 4.02706 1.46634 0.26236 0.97268 0.47492
600 193 1.31339 1.51939 1.40880 1.31747 389 a a - _
601 1.38629 1.38629 1.38629 1.38629
602 0.03385 4.09577 4.09577 1.46634 0.26236 2.22017 0.11495
603 194 1.43009 1.64733 1.10286 1.44296 390 g g - _
604 1.38629 1.38629 1.38629 1.38629
605 0.34600 4.09577 1.28791 1.46634 0.26236 2.22017 0.11495
606 195 1.51723 1.40952 1.25332 1.38283 391 g u - _
607 1.38629 1.38629 1.38629 1.38629
608 0.04597 3.79574 3.79574 1.46634 0.26236 0.43862 1.03543
609 196 1.38679 1.70741 1.08112 1.47154 392 g g - >
610 1.38629 1.38629 1.38629 1.38629
611 0.03419 4.08589 4.08589 1.46634 0.26236 2.28237 0.10763
612 197 1.56395 1.86235 0.83841 1.59463 393 g g - >
613 1.38629 1.38629 1.38629 1.38629
614 0.03940 4.08589 3.82470 1.46634 0.26236 1.84714 0.17160
615 198 1.36004 1.63275 1.11545 1.51326 394 g g - -
616 1.38629 1.38629 1.38629 1.38629
617 0.04627 4.09003 3.55850 1.46634 0.26236 2.25686 0.11057
618 199 0.96928 1.59715 1.65522 1.48227 395 a a - -
619 1.37310 1.39967 1.39967 1.37310
620 0.07499 3.83982 2.98091 1.28389 0.32429 0.95381 0.48657
621 200 1.37706 1.54245 1.18650 1.47606 398 g g - >
622 1.39425 1.39425 1.36281 1.39425
623 0.03943 3.81711 4.09426 1.15544 0.37822 2.23000 0.11376
624 201 1.46262 1.74538 0.90606 1.66242 400 g g - >
625 1.38629 1.38629 1.38629 1.38629
626 0.03390 4.09426 4.09426 1.46634 0.26236 2.23000 0.11376
627 202 1.35901 1.75313 1.11704 1.41633 401 g g - >
628 1.38629 1.38629 1.38629 1.38629
629 0.07191 4.09426 2.94285 1.46634 0.26236 2.23000 0.11376
630 203 1.46029 1.63790 1.02189 1.54397 402 g g - >
631 1.38629 1.38629 1.38629 1.38629
632 0.05260 4.05755 3.38299 1.46634 0.26236 2.43908 0.09128
633 204 1.54901 1.35595 1.66600 1.07635 403 u g - >
634 1.38629 1.38629 1.38629 1.38629
635 0.03580 4.04075 4.04075 1.46634 0.26236 0.17549 1.82662
636 205 1.82226 2.26571 0.50872 2.01500 404 g G - ,
637 1.38629 1.38629 1.38629 1.38629
638 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
639 206 1.80274 0.84977 1.75007 1.45295 405 c c - ,
640 1.38629 1.38629 1.38629 1.38629
641 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
642 207 0.98197 1.81188 1.69440 1.27879 406 a a - ,
643 1.38629 1.38629 1.38629 1.38629
644 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
645 208 1.33766 1.73030 1.81111 0.92423 407 u u - ,
646 1.38629 1.38629 1.38629 1.38629
647 0.06790 4.19411 2.98453 1.46634 0.26236 1.09861 0.40547
648 209 1.62682 1.77273 1.83774 0.74570 408 u u - <
649 1.38629 1.38629 1.38629 1.38629
650 0.03178 4.15799 4.15799 1.46634 0.26236 1.67749 0.20683
651 210 1.78249 1.57623 1.96580 0.72364 409 u u - <
652 1.38629 1.38629 1.38629 1.38629
653 0.03178 4.15799 4.15799 1.46634 0.26236 1.10564 0.40197
654 211 0.85752 1.90382 1.54961 1.53963 410 a a - <
655 1.38629 1.38629 1.38629 1.38629
656 0.03139 4.16998 4.16998 1.46634 0.26236 1.12214 0.39391
657 212 1.74886 1.71518 1.80689 0.72995 411 u u - <
658 1.38629 1.38629 1.38629 1.38629
659 0.04537 4.17754 3.53989 1.46634 0.26236 1.40835 0.28044
660 213 1.72955 1.72797 1.73937 0.75638 412 u u - <
661 1.38629 1.38629 1.38629 1.38629
662 0.03159 4.16377 4.16377 1.46634 0.26236 1.60568 0.22409
663 214 0.96340 1.76179 1.60714 1.40157 413 a a - <
664 1.38629 1.38629 1.38629 1.38629
665 0.03159 4.16377 4.16377 1.46634 0.26236 1.60568 0.22409
666 215 1.83020 1.87828 0.65723 1.78092 414 g g - -
667 1.38629 1.38629 1.38629 1.38629
668 0.03159 4.16377 4.16377 1.46634 0.26236 1.60568 0.22409
669 216 0.99227 1.71844 1.64592 1.35835 415 a a - -
670 1.38629 1.38629 1.38629 1.38629
671 0.03159 4.16377 4.16377 1.46634 0.26236 1.60568 0.22409
672 217 1.42381 1.59900 1.72415 0.97079 416 u u - -
673 1.38629 1.38629 1.38629 1.38629
674 0.03159 4.16377 4.16377 1.46634 0.26236 1.60568 0.22409
675 218 1.30552 1.37877 1.61231 1.28139 417 u a - -
676 1.38629 1.38629 1.38629 1.38629
677 0.03159 4.16377 4.16377 1.46634 0.26236 1.14514 0.38299
678 219 1.00866 1.76290 1.55679 1.37463 418 a a - -
679 1.38629 1.38629 1.38629 1.38629
680 0.03130 4.17282 4.17282 1.46634 0.26236 1.48077 0.25808
681 220 0.84771 1.72151 1.95317 1.38236 419 a a - -
682 1.38629 1.38629 1.38629 1.38629
683 0.04629 4.17282 3.51227 1.46634 0.26236 1.48077 0.25808
684 221 0.91825 1.75173 1.54844 1.53837 420 a a - -
685 1.38629 1.38629 1.38629 1.38629
686 0.26338 4.15830 1.53285 1.46634 0.26236 1.67376 0.20769
687 222 1.12279 1.76637 1.22737 1.55772 421 a a - -
688 1.31662 1.34499 1.43601 1.45438
689 0.22361 2.16541 2.45722 0.35425 1.20966 0.14768 1.98566
690 223 0.84888 1.68154 1.56000 1.73795 424 a a - <
691 1.38629 1.38629 1.38629 1.38629
692 0.03256 4.13391 4.13391 1.46634 0.26236 1.92763 0.15723
693 224 1.38508 1.07486 1.70943 1.48112 425 c c - <
694 1.38629 1.38629 1.38629 1.38629
695 0.03669 4.13391 3.91162 1.46634 0.26236 1.92763 0.15723
696 225 1.53457 0.95677 1.71618 1.51154 426 c c - <
697 1.38629 1.38629 1.38629 1.38629
698 0.07231 4.12991 2.92483 1.46634 0.26236 1.50316 0.25158
699 226 1.11107 1.75385 1.45199 1.33339 427 a a - <
700 1.38629 1.38629 1.38629 1.38629
701 0.03366 4.10132 4.10132 1.46634 0.26236 2.18324 0.11955
702 227 1.04607 1.72192 1.49252 1.40586 428 a a - -
703 1.38629 1.38629 1.38629 1.38629
704 0.03366 4.10132 4.10132 1.46634 0.26236 2.18324 0.11955
705 228 1.54897 1.31641 1.57509 1.16331 429 u u - -
706 1.58290 1.37019 1.22598 1.39799
707 0.49274 1.19924 2.43465 3.20934 0.04122 2.18324 0.11955
708 229 1.50293 1.34979 1.36447 1.33671 507 u u - -
709 1.38629 1.38629 1.38629 1.38629
710 0.03628 4.02759 4.02759 1.46634 0.26236 1.21729 0.35102
711 230 1.31993 1.52371 1.38978 1.32497 508 a a - -
712 1.38629 1.38629 1.38629 1.38629
713 0.09321 4.07794 2.63029 1.46634 0.26236 0.70629 0.68017
714 231 1.42937 1.63294 1.07937 1.48998 509 g g - <
715 1.38629 1.38629 1.38629 1.38629
716 0.04245 4.09166 3.69503 1.46634 0.26236 2.24661 0.11178
717 232 1.55954 1.35658 1.36768 1.28183 510 u c - <
718 1.38629 1.38629 1.38629 1.38629
719 0.03428 4.08349 4.08349 1.46634 0.26236 2.29681 0.10600
720 233 1.60527 1.08121 1.59161 1.36109 511 c c - <
721 1.38629 1.38629 1.38629 1.38629
722 0.03428 4.08349 4.08349 1.46634 0.26236 2.04467 0.13860
723 234 1.44187 1.54896 1.47898 1.12956 512 u u - _
724 1.38629 1.38629 1.38629 1.38629
725 0.03411 4.08831 4.08831 1.46634 0.26236 2.05690 0.13679
726 235 1.46247 1.55858 1.67975 0.99026 513 u u - _
727 1.38629 1.38629 1.38629 1.38629
728 0.03397 4.09223 4.09223 1.46634 0.26236 1.45810 0.26485
729 236 1.37743 1.28513 1.64260 1.28127 514 u u - _
730 1.38629 1.38629 1.38629 1.38629
731 0.10644 4.11195 2.46991 1.46634 0.26236 1.38623 0.28770
732 237 1.16600 1.54237 1.41450 1.46331 515 a a - _
733 1.35772 1.38629 1.38629 1.41571
734 0.09153 3.79851 2.73243 1.44045 0.27026 0.69601 0.69029
735 238 1.49624 1.79127 0.96798 1.47215 520 g g - >
736 1.38629 1.38629 1.38629 1.38629
737 0.04467 4.09166 3.61277 1.46634 0.26236 2.24661 0.11178
738 239 1.43653 1.38887 1.28632 1.44136 521 g g - >
739 1.38629 1.38629 1.38629 1.38629
740 0.03435 4.08134 4.08134 1.46634 0.26236 2.30955 0.10459
741 240 1.54823 1.29214 1.54542 1.20574 522 u c - >
742 1.38629 1.38629 1.38629 1.38629
743 0.07043 4.08134 2.97360 1.46634 0.26236 2.30955 0.10459
744 241 1.43328 1.38463 1.50492 1.24124 523 u u - -
745 1.38629 1.38629 1.38629 1.38629
746 0.05563 4.04651 3.30707 1.46634 0.26236 2.49299 0.08628
747 242 1.35976 1.61060 1.37298 1.23733 524 u u - -
748 1.38629 1.38629 1.38629 1.38629
749 0.04701 4.02718 3.57217 1.46634 0.26236 2.57962 0.07883
750 243 1.42763 1.76222 1.28748 1.16317 525 u u - -
751 1.34503 1.45631 1.40913 1.33934
752 0.60264 0.87590 3.32003 1.48943 0.25554 2.62237 0.07540
753 244 1.49413 1.48269 1.57709 1.07307 538 u u - -
754 1.38629 1.38629 1.38629 1.38629
755 0.03737 3.99855 3.99855 1.46634 0.26236 0.79031 0.60459
756 245 1.43456 1.60099 1.51743 1.07644 539 u u - -
757 1.38629 1.38629 1.38629 1.38629
758 0.07919 4.09805 2.82126 1.46634 0.26236 0.65228 0.73576
759 246 1.41894 1.74947 1.44827 1.05215 540 u u - >
760 1.38629 1.38629 1.38629 1.38629
761 0.03314 4.11680 4.11680 1.46634 0.26236 0.86580 0.54596
762 247 1.71170 2.19787 0.63397 1.72641 541 g g - >
763 1.38629 1.38629 1.38629 1.38629
764 0.03190 4.15418 4.15418 1.46634 0.26236 1.49956 0.25261
765 248 1.42675 1.94319 1.12395 1.23212 542 g g - >
766 1.38629 1.38629 1.38629 1.38629
767 0.03177 4.15808 4.15808 1.46634 0.26236 1.67633 0.20710
768 249 1.79896 1.82953 1.65911 0.72623 543 u u - >
769 1.38629 1.38629 1.38629 1.38629
770 0.03177 4.15808 4.15808 1.46634 0.26236 1.01515 0.44996
771 250 1.91255 2.62753 0.36919 2.42195 544 g G - -
772 1.38629 1.38629 1.38629 1.38629
773 0.03131 4.17263 4.17263 1.46634 0.26236 1.08427 0.41271
774 251 0.55241 2.06858 1.98986 1.82411 545 a A - -
775 1.38629 1.38629 1.38629 1.38629
776 0.03107 4.18017 4.18017 1.46634 0.26236 1.36558 0.29468
777 252 1.13025 1.47775 1.55713 1.43482 546 a a - -
778 1.38629 1.38629 1.38629 1.38629
779 0.03107 4.18017 4.18017 1.46634 0.26236 0.71430 0.67243
780 253 1.68470 1.72164 1.85499 0.73549 547 u U - -
781 1.38629 1.38629 1.38629 1.38629
782 0.04399 4.19411 3.57724 1.46634 0.26236 1.09861 0.40547
783 254 1.85775 0.71103 2.11828 1.45844 548 c c - -
784 1.38629 1.38629 1.38629 1.38629
785 0.03615 4.18116 3.90109 1.46634 0.26236 1.34888 0.30047
786 255 1.05671 1.69980 1.82105 1.17822 549 a a - -
787 1.42823 1.30394 1.42834 1.38990
788 0.08446 3.11913 3.30227 0.94195 0.49408 0.65179 0.73629
789 256 1.43888 1.89291 1.13019 1.24062 552 g u - >
790 1.38629 1.38629 1.38629 1.38629
791 0.03130 4.17282 4.17282 1.46634 0.26236 1.48077 0.25808
792 257 1.08909 1.97799 1.14967 1.56836 553 a a - >
793 1.38629 1.38629 1.38629 1.38629
794 0.03130 4.17282 4.17282 1.46634 0.26236 0.84311 0.56277
795 258 0.92622 1.82071 1.46229 1.55905 554 a a - >
796 1.38629 1.38629 1.38629 1.38629
797 0.05183 4.18647 3.34365 1.46634 0.26236 1.25399 0.33598
798 259 1.62790 1.64369 1.72925 0.83707 555 u u - >
799 1.38629 1.38629 1.38629 1.38629
800 0.03151 4.16616 4.16616 1.46634 0.26236 1.57427 0.23213
801 260 0.86773 1.96721 1.55214 1.47642 556 a a - >
802 1.38629 1.38629 1.38629 1.38629
803 0.04394 4.16616 3.59431 1.46634 0.26236 1.57427 0.23213
804 261 0.89449 1.79701 1.74552 1.38295 557 a a - >
805 1.38629 1.38629 1.38629 1.38629
806 0.03190 4.15412 4.15412 1.46634 0.26236 0.44196 1.02940
807 262 1.43291 1.14162 1.82598 1.26932 558 c c - ,
808 1.38629 1.38629 1.38629 1.38629
809 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
810 263 1.53481 1.25396 1.67536 1.16510 559 u u - ,
811 1.38629 1.38629 1.38629 1.38629
812 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
813 264 1.26607 1.75623 1.54743 1.10090 560 u u - ,
814 1.38629 1.38629 1.38629 1.38629
815 0.11532 4.19411 2.36617 1.46634 0.26236 1.09861 0.40547
816 265 1.37994 1.65064 1.58742 1.04404 561 u u - ,
817 1.38629 1.38629 1.38629 1.38629
818 0.04187 4.11208 3.70377 1.46634 0.26236 0.62016 0.77188
819 266 1.44448 1.78759 1.10012 1.33204 562 g g - ,
820 1.38629 1.38629 1.38629 1.38629
821 0.03175 4.15875 4.15875 1.46634 0.26236 1.66838 0.20894
822 267 1.52224 1.19927 1.45828 1.39542 563 c c - ,
823 1.44097 1.34532 1.30799 1.45894
824 0.27236 1.50151 4.15874 0.74357 0.64514 1.66838 0.20894
825 268 1.38190 1.45502 1.49103 1.23662 573 u u - ,
826 1.38629 1.38629 1.38629 1.38629
827 0.03175 4.15875 4.15875 1.46634 0.26236 1.41387 0.27866
828 269 1.27660 2.20680 0.80187 1.81724 574 g g - ,
829 1.38629 1.38629 1.38629 1.38629
830 0.03161 4.16326 4.16326 1.46634 0.26236 1.16344 0.37456
831 270 0.63777 1.91066 1.82624 1.81689 575 a A - ,
832 1.38629 1.38629 1.38629 1.38629
833 0.03133 4.17204 4.17204 1.46634 0.26236 1.49232 0.25470
834 271 1.75968 1.49749 1.55097 0.93607 576 u u - <
835 1.38629 1.38629 1.38629 1.38629
836 0.03133 4.17204 4.17204 1.46634 0.26236 1.49232 0.25470
837 272 2.06276 0.65477 2.12557 1.45255 577 c c - <
838 1.38629 1.38629 1.38629 1.38629
839 0.04465 4.17204 3.56686 1.46634 0.26236 1.49232 0.25470
840 273 1.76108 2.56524 0.48672 1.99070 578 g g - <
841 1.38629 1.38629 1.38629 1.38629
842 0.03174 4.15913 4.15913 1.46634 0.26236 1.66373 0.21002
843 274 1.49205 1.24727 1.91194 1.07879 579 u c - <
844 1.39257 1.57696 1.38885 1.21876
845 0.48295 1.83610 1.49790 0.53392 0.88262 1.66373 0.21002
846 275 0.89667 1.76441 1.66900 1.45950 583 a a - -
847 1.38629 1.38629 1.38629 1.38629
848 0.04025 3.92596 3.92596 1.46634 0.26236 1.58527 0.22928
849 276 1.49164 1.33330 1.66303 1.13374 584 u c - <
850 1.38629 1.38629 1.38629 1.38629
851 0.03809 3.97989 3.97989 1.46634 0.26236 1.54445 0.24007
852 277 1.60094 1.85150 0.81895 1.60744 585 g g - <
853 1.38629 1.38629 1.38629 1.38629
854 0.03645 4.02321 4.02321 1.46634 0.26236 1.63542 0.21675
855 278 1.52535 1.67008 1.04505 1.41655 586 g g - <
856 1.38629 1.38629 1.38629 1.38629
857 0.03541 4.05168 4.05168 1.46634 0.26236 1.01390 0.45067
858 279 1.53897 1.16176 1.74014 1.21413 587 c c - <
859 1.38629 1.38629 1.38629 1.38629
860 0.09668 4.10719 2.58093 1.46634 0.26236 1.93001 0.15683
861 280 1.69775 1.02683 1.67682 1.30270 588 c c - _
862 1.38629 1.38629 1.38629 1.38629
863 0.03546 4.05024 4.05024 1.46634 0.26236 0.98478 0.46764
864 281 1.53988 1.62940 1.85136 0.83812 589 u u - _
865 1.38629 1.38629 1.38629 1.38629
866 0.04686 4.10841 3.52858 1.46634 0.26236 0.98677 0.46646
867 282 1.45351 1.42556 1.75209 1.04280 590 u u - _
868 1.38629 1.38629 1.38629 1.38629
869 0.03268 4.13055 4.13055 1.46634 0.26236 1.95763 0.15221
870 283 1.41236 1.51627 1.46371 1.18571 591 u u - _
871 1.38629 1.38629 1.38629 1.38629
872 0.03268 4.13055 4.13055 1.46634 0.26236 1.69655 0.20250
873 284 1.41374 1.50560 1.51394 1.15568 592 u u - _
874 1.39898 1.59026 1.31939 1.26591
875 0.53148 1.12771 2.42481 1.26129 0.33308 0.84133 0.56412
876 285 1.30359 1.88486 1.04786 1.48763 616 g g - >
877 1.38629 1.38629 1.38629 1.38629
878 0.07646 4.09274 2.86619 1.46634 0.26236 2.23977 0.11259
879 286 1.51388 1.00832 1.66190 1.49016 617 c c - >
880 1.38629 1.38629 1.38629 1.38629
881 0.05614 4.05168 3.29154 1.46634 0.26236 2.46815 0.08855
882 287 1.63866 1.07701 1.62678 1.31459 618 c c - >
883 1.38629 1.38629 1.38629 1.38629
884 0.08069 4.03168 2.81717 1.46634 0.26236 2.56026 0.08043
885 288 1.37597 2.16458 0.77655 1.75668 619 g g - >
886 1.33741 1.44727 1.30920 1.46003
887 0.10971 2.46058 3.98874 0.87936 0.53623 0.17864 1.81036
888 289 1.19748 1.83291 1.07792 1.62051 623 g g - >
889 1.38629 1.38629 1.38629 1.38629
890 0.03087 4.18647 4.18647 1.46634 0.26236 1.25399 0.33598
891 290 1.75525 0.82996 2.08703 1.32045 624 c c - >
892 1.38629 1.38629 1.38629 1.38629
893 0.04577 4.18647 3.52218 1.46634 0.26236 1.25399 0.33598
894 291 2.02512 2.53267 0.37818 2.26848 625 g g - >
895 1.38629 1.38629 1.38629 1.38629
896 0.03133 4.17204 4.17204 1.46634 0.26236 1.49232 0.25470
897 292 1.04574 1.56050 1.33397 1.74235 626 a a - >
898 1.39499 1.39499 1.36067 1.39499
899 0.03690 3.87255 4.17204 1.13370 0.38837 0.59729 0.79917
900 293 1.89830 1.07702 1.81808 1.05777 628 u u - ,
901 1.38629 1.38629 1.38629 1.38629
902 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
903 294 1.39480 1.74228 1.11500 1.38998 629 g g - ,
904 1.38629 1.38629 1.38629 1.38629
905 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
906 295 1.36198 1.58595 1.49815 1.15344 630 u u - ,
907 1.38629 1.38629 1.38629 1.38629
908 0.03561 4.19411 3.91697 1.46634 0.26236 1.09861 0.40547
909 296 1.18814 1.66875 1.42522 1.32323 631 a a - )
910 1.38629 1.38629 1.38629 1.38629
911 0.03078 4.18928 4.18928 1.46634 0.26236 0.92263 0.50662
912 297 1.64076 1.40469 1.73030 0.95843 632 u u - )
913 1.38629 1.38629 1.38629 1.38629
914 0.04573 4.19411 3.51955 1.46634 0.26236 1.09861 0.40547
915 298 1.75182 0.78855 1.95829 1.46560 633 c c - )
916 1.38629 1.38629 1.38629 1.38629
917 0.03109 4.17948 4.17948 1.46634 0.26236 0.70248 0.68390
918 299 1.10864 1.66903 1.61297 1.26490 634 a a - )
919 1.40621 1.32884 1.40621 1.40621
920 0.05819 3.60388 3.52982 0.88546 0.53192 1.09861 0.40547
921 300 1.39927 1.84835 1.52549 0.97230 636 u u - -
922 1.38629 1.38629 1.38629 1.38629
923 0.03108 4.17978 4.17978 1.46634 0.26236 1.37197 0.29250
924 301 1.32346 1.87789 1.83670 0.86386 637 u u - -
925 1.38629 1.38629 1.38629 1.38629
926 0.04036 4.17978 3.71925 1.46634 0.26236 1.37197 0.29250
927 302 1.66240 1.04462 1.66575 1.31140 638 c c - -
928 1.38629 1.38629 1.38629 1.38629
929 0.03137 4.17079 4.17079 1.46634 0.26236 0.58284 0.81714
930 303 1.11601 1.87912 1.07317 1.72729 639 g g - )
931 1.40540 1.40540 1.33108 1.40540
932 0.04271 3.62226 4.19411 0.89944 0.52222 1.09861 0.40547
933 304 0.73817 1.95337 1.76109 1.56850 641 a a - )
934 1.38629 1.38629 1.38629 1.38629
935 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
936 305 1.23380 2.05542 0.82617 1.94454 642 g a - )
937 1.38629 1.38629 1.38629 1.38629
938 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
939 306 1.79782 1.35736 2.12705 0.78129 643 u u - )
940 1.38629 1.38629 1.38629 1.38629
941 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
942 307 1.48932 1.92717 1.23623 1.08342 644 u u - -
943 1.38629 1.38629 1.38629 1.38629
944 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
945 308 1.43055 2.00233 2.07997 0.69141 645 u U - -
946 1.38629 1.38629 1.38629 1.38629
947 0.03806 4.19411 3.80508 1.46634 0.26236 1.09861 0.40547
948 309 2.13533 0.41601 2.37755 2.04527 646 c C - )
949 1.38629 1.38629 1.38629 1.38629
950 0.03086 4.18691 4.18691 1.46634 0.26236 0.85672 0.55261
951 310 2.31366 1.95179 2.66373 0.37194 647 u U - )
952 1.38629 1.38629 1.38629 1.38629
953 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
954 311 1.97079 2.40667 0.46948 1.92955 648 g g - )
955 1.38629 1.38629 1.38629 1.38629
956 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
957 312 1.11416 1.00190 2.00028 1.77589 649 c a - )
958 1.38629 1.38629 1.38629 1.38629
959 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
960 313 2.01971 0.59432 2.36397 1.50814 650 c c - <
961 1.38629 1.38629 1.38629 1.38629
962 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
963 314 2.41924 0.55344 2.23000 1.47617 651 c C - <
964 1.38629 1.38629 1.38629 1.38629
965 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
966 315 2.36334 1.73473 2.24266 0.47277 652 u u - <
967 1.38629 1.38629 1.38629 1.38629
968 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
969 316 0.08229 3.76409 3.53702 3.62298 653 A A - -
970 1.38629 1.38629 1.38629 1.38629
971 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
972 317 3.22346 2.87889 3.35684 0.14025 654 u U - -
973 1.38629 1.38629 1.38629 1.38629
974 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
975 318 3.09300 0.23180 3.27403 2.09010 655 c C - <
976 1.38629 1.38629 1.38629 1.38629
977 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
978 319 0.17252 3.09199 3.12467 2.67223 656 a A - -
979 1.41968 1.38536 1.32356 1.41968
980 0.05198 3.33623 4.19411 0.70377 0.68263 1.09861 0.40547
981 320 1.19772 2.16780 0.88078 1.77650 658 g g - <
982 1.38629 1.38629 1.38629 1.38629
983 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
984 321 2.16753 0.51237 2.41253 1.62519 659 c c - <
985 1.38629 1.38629 1.38629 1.38629
986 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
987 322 2.57459 1.93655 2.81259 0.32911 660 u u - <
988 1.40687 1.32699 1.40687 1.40687
989 0.04365 3.58893 4.19411 0.87424 0.53987 1.09861 0.40547
990 323 1.56085 1.88433 1.49566 0.88186 662 u u - -
991 1.41328 1.36002 1.36002 1.41328
992 0.43123 3.75777 1.11794 1.16955 0.37180 1.09861 0.40547
993 324 1.64444 1.86851 1.73234 0.74306 665 u U - -
994 1.38629 1.38629 1.38629 1.38629
995 0.04483 3.82034 3.82034 1.46634 0.26236 1.38239 0.28899
996 325 1.70510 0.98686 1.88216 1.22676 666 c c - -
997 1.38629 1.38629 1.38629 1.38629
998 0.04036 3.92319 3.92319 1.46634 0.26236 0.11290 2.23715
999 326 2.10189 2.87578 0.29942 2.52376 667 g G - -
1000 1.38629 1.38629 1.38629 1.38629
1001 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1002 327 0.72769 2.06612 2.11570 1.31025 668 a a - <
1003 1.38629 1.38629 1.38629 1.38629
1004 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1005 328 1.83809 1.39569 2.10383 0.75242 669 u u - <
1006 1.38629 1.38629 1.38629 1.38629
1007 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1008 329 1.99752 2.30818 0.51567 1.78508 670 g g - <
1009 1.38629 1.38629 1.38629 1.38629
1010 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1011 330 2.10296 2.35578 0.44288 1.95970 671 g g - <
1012 1.39811 1.39811 1.39811 1.35165
1013 0.05202 3.80508 3.56028 1.05065 0.43034 1.09861 0.40547
1014 331 1.97223 1.73507 2.24770 0.54676 673 u u - <
1015 1.38629 1.38629 1.38629 1.38629
1016 0.03930 4.18067 3.76162 1.46634 0.26236 1.35707 0.29761
1017 332 0.86197 1.87758 1.75864 1.37661 674 a a - <
1018 1.35516 1.39689 1.39689 1.39689
1019 0.03811 3.81773 4.17268 1.08150 0.41413 1.06376 0.42336
1020 333 1.50587 1.96044 0.66672 2.08757 676 g g - <
1021 1.38629 1.38629 1.38629 1.38629
1022 0.03105 4.18067 4.18067 1.46634 0.26236 1.35707 0.29761
1023 334 1.80566 1.98511 0.83769 1.32591 677 g g - <
1024 1.42703 1.34715 1.42703 1.34715
1025 0.04425 3.57550 4.18067 1.09123 0.40918 1.35707 0.29761
1026 335 1.66366 1.89279 0.83168 1.49349 680 g g - _
1027 1.38629 1.38629 1.38629 1.38629
1028 0.03105 4.18067 4.18067 1.46634 0.26236 0.72325 0.66393
1029 336 2.42068 1.97025 2.24319 0.40707 681 u U - _
1030 1.38629 1.38629 1.38629 1.38629
1031 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1032 337 0.59613 1.60139 2.32671 1.89825 682 a A - _
1033 1.38629 1.38629 1.38629 1.38629
1034 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1035 338 1.45432 1.79270 1.41148 1.03240 683 u u - _
1036 1.38629 1.38629 1.38629 1.38629
1037 0.03948 4.19411 3.74537 1.46634 0.26236 1.09861 0.40547
1038 339 1.28989 1.87583 1.66454 0.96183 684 u u - _
1039 1.35165 1.39811 1.39811 1.39811
1040 0.03839 3.79650 4.18553 1.05065 0.43034 1.27154 0.32906
1041 340 1.99962 1.95161 0.67296 1.54941 686 g g - _
1042 1.38629 1.38629 1.38629 1.38629
1043 0.03090 4.18553 4.18553 1.46634 0.26236 0.82280 0.57839
1044 341 2.01213 2.48551 0.40787 2.13750 687 g G - _
1045 1.50384 1.50384 1.28112 1.28112
1046 0.05769 3.58893 3.56028 1.66798 0.20903 1.09861 0.40547
1047 342 1.37986 0.85391 2.08022 1.62083 694 c c - >
1048 1.38629 1.38629 1.38629 1.38629
1049 0.03105 4.18067 4.18067 1.46634 0.26236 1.35707 0.29761
1050 343 1.94582 0.75527 1.86924 1.45669 695 c c - >
1051 1.32334 1.40819 1.40819 1.40819
1052 0.04512 3.54646 4.18067 0.85285 0.55547 1.35707 0.29761
1053 344 1.48292 1.79821 2.00524 0.74908 697 u u - >
1054 1.38629 1.38629 1.38629 1.38629
1055 0.03105 4.18067 4.18067 1.46634 0.26236 1.35707 0.29761
1056 345 0.67017 1.98763 1.71851 1.76010 698 a a - >
1057 1.38629 1.38629 1.38629 1.38629
1058 0.04604 4.18067 3.51638 1.46634 0.26236 1.35707 0.29761
1059 346 1.77160 0.60915 2.29243 1.68684 699 c c - >
1060 1.38629 1.38629 1.38629 1.38629
1061 0.03152 4.16615 4.16615 1.46634 0.26236 1.57442 0.23209
1062 347 1.60158 0.79213 1.88405 1.64212 700 c c - >
1063 1.38629 1.38629 1.38629 1.38629
1064 0.03152 4.16615 4.16615 1.46634 0.26236 0.53487 0.88127
1065 348 0.83795 1.90777 1.36572 1.80912 701 a a - >
1066 1.38629 1.38629 1.38629 1.38629
1067 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1068 349 1.43575 1.99995 2.07624 0.69051 702 u u - >
1069 1.40687 1.40687 1.40687 1.32699
1070 0.04365 3.58893 4.19411 0.87424 0.53987 1.09861 0.40547
1071 350 2.18060 2.91320 0.30451 2.35138 704 g g - >
1072 1.38629 1.38629 1.38629 1.38629
1073 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1074 351 1.88872 2.73921 0.37240 2.35351 705 g g - >
1075 1.38629 1.38629 1.38629 1.38629
1076 0.04449 4.19411 3.56028 1.46634 0.26236 1.09861 0.40547
1077 352 1.89096 1.00393 2.00182 1.05685 706 c c - >
1078 1.38629 1.38629 1.38629 1.38629
1079 0.03105 4.18067 4.18067 1.46634 0.26236 1.35707 0.29761
1080 353 1.54126 1.85373 1.31851 1.01693 707 u u - -
1081 1.38629 1.38629 1.38629 1.38629
1082 0.04003 4.18067 3.73193 1.46634 0.26236 0.72325 0.66393
1083 354 1.10137 1.95469 1.40152 1.27385 708 a a - -
1084 1.38629 1.38629 1.38629 1.38629
1085 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
1086 355 2.46124 1.22622 2.63443 0.59873 709 u U - -
1087 1.38629 1.38629 1.38629 1.38629
1088 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
1089 356 1.16197 1.73782 1.25123 1.49132 710 a a - -
1090 1.38629 1.38629 1.38629 1.38629
1091 0.03090 4.18553 4.18553 1.46634 0.26236 0.82280 0.57839
1092 357 0.08229 3.76409 3.53702 3.62298 711 A A - -
1093 1.38629 1.38629 1.38629 1.38629
1094 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1095 358 3.09300 0.23180 3.27403 2.09010 712 c C - >
1096 1.38629 1.38629 1.38629 1.38629
1097 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1098 359 2.22609 2.67726 0.27318 2.77512 713 g g - >
1099 1.38629 1.38629 1.38629 1.38629
1100 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1101 360 2.34036 2.60629 0.26296 2.79484 714 g G - >
1102 1.38629 1.38629 1.38629 1.38629
1103 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1104 361 1.81164 2.54000 0.45881 2.07374 715 g g - >
1105 1.38629 1.38629 1.38629 1.38629
1106 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1107 362 2.69722 2.70473 3.11024 0.19708 716 u U - ,
1108 1.38629 1.38629 1.38629 1.38629
1109 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1110 363 0.53616 2.41519 1.51984 2.23574 717 a A - ,
1111 1.38629 1.38629 1.38629 1.38629
1112 0.20885 4.19411 1.75217 1.46634 0.26236 1.09861 0.40547
1113 364 0.28383 2.52880 2.47721 2.48444 718 a A - ,
1114 1.38629 1.38629 1.38629 1.38629
1115 0.03650 4.02176 4.02176 1.46634 0.26236 0.16040 1.90920
1116 365 2.91816 0.20169 3.29667 2.39018 719 c C - <
1117 1.38629 1.38629 1.38629 1.38629
1118 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1119 366 2.27232 3.38008 0.19774 3.16301 720 g G - <
1120 1.38629 1.38629 1.38629 1.38629
1121 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1122 367 2.07296 3.27710 0.23675 3.05211 721 g G - <
1123 1.38629 1.38629 1.38629 1.38629
1124 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1125 368 1.39588 2.90698 0.46511 2.66385 722 g g - <
1126 1.38629 1.38629 1.38629 1.38629
1127 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1128 369 2.06425 2.49846 0.40020 2.11455 723 g g - <
1129 1.38629 1.38629 1.38629 1.38629
1130 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1131 370 0.65635 2.08264 1.50257 2.00916 724 a a - <
1132 1.38629 1.38629 1.38629 1.38629
1133 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1134 371 0.33311 2.60727 2.31468 2.20025 725 a A - <
1135 1.38629 1.38629 1.38629 1.38629
1136 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1137 372 3.03639 2.50734 3.18668 0.18730 726 u U - <
1138 1.31264 1.35639 1.44117 1.44117
1139 0.05220 3.33054 4.19411 0.90145 0.52085 1.09861 0.40547
1140 373 1.99611 0.90325 2.22794 1.04658 729 c c - _
1141 1.38629 1.38629 1.38629 1.38629
1142 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1143 374 0.58857 2.26158 1.71803 1.82463 730 a A - _
1144 1.38629 1.38629 1.38629 1.38629
1145 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1146 375 2.35844 2.81761 0.27743 2.43092 731 g G - _
1147 1.38629 1.38629 1.38629 1.38629
1148 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1149 376 2.03674 2.13174 0.57538 1.66906 732 g G - _
1150 1.27691 1.57672 1.27691 1.44583
1151 0.04449 3.56028 4.19411 2.77589 0.06432 1.09861 0.40547
1152 377 2.76330 3.63683 0.12955 3.43916 757 g G - >
1153 1.38629 1.38629 1.38629 1.38629
1154 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1155 378 2.40069 2.25411 2.80249 0.29609 758 u U - >
1156 1.38629 1.38629 1.38629 1.38629
1157 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1158 379 2.43010 1.91173 2.29009 0.41115 759 u u - >
1159 1.38629 1.38629 1.38629 1.38629
1160 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1161 380 2.07180 0.63740 2.07023 1.51768 760 c c - >
1162 1.38629 1.38629 1.38629 1.38629
1163 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1164 381 2.20530 2.99879 0.27558 2.51569 761 g G - -
1165 1.38629 1.38629 1.38629 1.38629
1166 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1167 382 0.15139 3.37621 2.72705 3.19664 762 a A - -
1168 1.38629 1.38629 1.38629 1.38629
1169 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1170 383 2.04175 1.49985 2.40881 0.58499 763 u U - -
1171 1.40487 1.40487 1.40487 1.33256
1172 0.04236 3.63456 4.19411 0.90891 0.51578 1.09861 0.40547
1173 384 1.92324 1.96181 2.20596 0.50564 765 u u - >
1174 1.39915 1.39915 1.34868 1.39915
1175 0.03872 3.77694 4.19411 1.02585 0.44393 1.09861 0.40547
1176 385 2.41218 0.42110 2.53439 1.74443 767 c C - >
1177 1.38629 1.38629 1.38629 1.38629
1178 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1179 386 2.97056 0.29915 3.14093 1.80766 768 c C - >
1180 1.38629 1.38629 1.38629 1.38629
1181 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1182 387 2.74983 3.37372 0.16389 2.93807 769 g G - >
1183 1.38629 1.38629 1.38629 1.38629
1184 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1185 388 2.84081 3.49274 0.14210 3.13119 770 g G - ]
1186 1.38629 1.38629 1.38629 1.38629
1187 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1188 389 0.13261 3.31648 3.28251 2.98821 771 a A - ]
1189 1.35913 1.41422 1.35913 1.41422
1190 0.03948 3.74537 4.19411 1.16326 0.37465 1.09861 0.40547
1191 390 2.84081 3.49274 0.14210 3.13119 774 g G - ]
1192 1.38629 1.38629 1.38629 1.38629
1193 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1194 391 0.13261 3.31648 3.28251 2.98821 775 a A - ,
1195 1.38629 1.38629 1.38629 1.38629
1196 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1197 392 1.92149 2.91256 0.30483 2.78018 776 g G - <
1198 1.38629 1.38629 1.38629 1.38629
1199 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1200 393 1.98160 2.48861 0.43184 2.04165 777 g G - <
1201 1.38629 1.38629 1.38629 1.38629
1202 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1203 394 2.03072 2.41675 0.36231 2.48315 778 g c - <
1204 1.38629 1.38629 1.38629 1.38629
1205 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1206 395 0.58686 1.88997 1.95444 1.88910 779 a a - <
1207 1.38629 1.38629 1.38629 1.38629
1208 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1209 396 2.38416 2.94237 0.23790 2.70582 780 g G - <
1210 1.38629 1.38629 1.38629 1.38629
1211 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1212 397 3.16498 0.19921 3.35080 2.26965 781 c C - <
1213 1.38629 1.38629 1.38629 1.38629
1214 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1215 398 2.07054 0.43346 2.68996 1.84683 782 c C - _
1216 1.38629 1.38629 1.38629 1.38629
1217 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1218 399 2.54189 2.20142 2.86166 0.28308 783 u U - _
1219 1.38629 1.38629 1.38629 1.38629
1220 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1221 400 2.16902 2.80458 0.34718 2.13286 784 g G - _
1222 1.38629 1.38629 1.38629 1.38629
1223 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1224 401 0.38811 2.11032 2.42701 2.18780 785 a A - _
1225 1.38629 1.38629 1.38629 1.38629
1226 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1227 402 1.86234 2.53261 0.40641 2.31060 786 g G - _
1228 1.38629 1.38629 1.38629 1.38629
1229 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1230 403 0.10905 3.58544 3.14370 3.42760 787 a A - _
1231 1.38629 1.38629 1.38629 1.38629
1232 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1233 404 0.51518 2.69055 1.39204 2.45112 788 a A - _
1234 1.38629 1.38629 1.38629 1.38629
1235 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1236 405 0.08229 3.76409 3.53702 3.62298 789 A A - _
1237 1.38629 1.38629 1.38629 1.38629
1238 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1239 406 2.69140 0.55645 2.83788 1.20256 790 c C - _
1240 1.38629 1.38629 1.38629 1.38629
1241 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1242 407 1.90031 2.54140 0.38310 2.40816 791 g G - _
1243 1.38629 1.38629 1.38629 1.38629
1244 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1245 408 3.09270 3.81113 0.09897 3.62220 792 G G - >
1246 1.38629 1.38629 1.38629 1.38629
1247 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1248 409 3.14483 0.18848 2.79398 2.69516 793 c C - >
1249 1.38629 1.38629 1.38629 1.38629
1250 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1251 410 2.41448 2.12408 2.13196 0.39684 794 u u - >
1252 1.38629 1.38629 1.38629 1.38629
1253 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1254 411 0.54429 1.87998 2.08198 1.94861 795 a g - >
1255 1.38629 1.38629 1.38629 1.38629
1256 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1257 412 2.06514 0.40523 2.57622 2.03778 796 c C - >
1258 1.38629 1.38629 1.38629 1.38629
1259 0.03429 4.19411 3.98347 1.46634 0.26236 1.09861 0.40547
1260 413 2.86682 0.36816 3.02809 1.59600 797 c C - >
1261 1.38629 1.38629 1.38629 1.38629
1262 0.03074 4.19057 4.19057 1.46634 0.26236 0.96322 0.48072
1263 414 0.10070 3.63600 3.25125 3.48322 798 A A - ,
1264 1.38629 1.38629 1.38629 1.38629
1265 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1266 415 2.47792 0.41108 2.34829 1.84758 799 c C - <
1267 1.38629 1.38629 1.38629 1.38629
1268 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1269 416 0.90184 1.97822 1.75418 1.26296 800 a u - <
1270 1.38629 1.38629 1.38629 1.38629
1271 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1272 417 2.22274 2.22082 2.36952 0.37158 801 u u - <
1273 1.38629 1.38629 1.38629 1.38629
1274 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1275 418 3.19714 0.18619 3.38421 2.35285 802 c C - <
1276 1.38629 1.38629 1.38629 1.38629
1277 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1278 419 2.57018 0.86265 2.70762 0.83300 803 u u - _
1279 1.38629 1.38629 1.38629 1.38629
1280 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1281 420 0.08229 3.76409 3.53702 3.62298 804 A A - _
1282 1.38629 1.38629 1.38629 1.38629
1283 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1284 421 0.49170 1.80367 2.42043 2.00369 805 a A - _
1285 1.38629 1.38629 1.38629 1.38629
1286 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1287 422 3.09270 3.81113 0.09897 3.62220 806 G G - _
1288 1.38629 1.38629 1.38629 1.38629
1289 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1290 423 3.09270 3.81113 0.09897 3.62220 807 G G - >
1291 1.38629 1.38629 1.38629 1.38629
1292 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1293 424 0.59173 1.98983 1.89711 1.83315 808 a a - >
1294 1.38629 1.38629 1.38629 1.38629
1295 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1296 425 0.82103 1.68318 1.74558 1.61097 809 a a - >
1297 1.38629 1.38629 1.38629 1.38629
1298 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1299 426 2.12820 2.81113 0.29750 2.54927 810 g G - >
1300 1.38629 1.38629 1.38629 1.38629
1301 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1302 427 2.46768 3.14962 0.19035 3.08607 811 g G - ,
1303 1.38629 1.38629 1.38629 1.38629
1304 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1305 428 3.25819 0.16413 3.44500 2.51323 812 c C - ,
1306 1.38629 1.38629 1.38629 1.38629
1307 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1308 429 0.14270 3.02210 3.23561 3.10218 813 a A - ,
1309 1.38629 1.38629 1.38629 1.38629
1310 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1311 430 2.47036 3.48292 0.16620 3.27410 814 g G - }
1312 1.38629 1.38629 1.38629 1.38629
1313 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1314 431 3.05811 0.22240 3.04434 2.25570 815 c C - }
1315 1.38629 1.38629 1.38629 1.38629
1316 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1317 432 0.08229 3.76409 3.53702 3.62298 816 A A - }
1318 1.38629 1.38629 1.38629 1.38629
1319 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1320 433 3.09270 3.81113 0.09897 3.62220 817 G G - }
1321 1.38629 1.38629 1.38629 1.38629
1322 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1323 434 3.09270 3.81113 0.09897 3.62220 818 G G - }
1324 1.38629 1.38629 1.38629 1.38629
1325 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1326 435 3.21986 0.16791 3.16705 2.62438 819 c C - }
1327 1.38629 1.38629 1.38629 1.38629
1328 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1329 436 1.85597 2.87037 0.35396 2.46375 820 g G - -
1330 1.38629 1.38629 1.38629 1.38629
1331 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1332 437 3.19714 0.18619 3.38421 2.35285 821 c C - }
1333 1.38629 1.38629 1.38629 1.38629
1334 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1335 438 2.63998 3.57181 0.14372 3.36973 822 g G - ,
1336 1.38629 1.38629 1.38629 1.38629
1337 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1338 439 1.60682 0.98030 1.79252 1.35581 823 c c - ,
1339 1.38629 1.38629 1.38629 1.38629
1340 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1341 440 0.19845 2.84049 2.76147 2.84037 824 a A - ,
1342 1.38629 1.38629 1.38629 1.38629
1343 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1344 441 0.10567 3.60543 3.18587 3.44961 825 a A - ,
1345 1.38629 1.38629 1.38629 1.38629
1346 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1347 442 0.55629 1.59636 2.39377 2.01929 826 a A - ,
1348 1.38629 1.38629 1.38629 1.38629
1349 0.03709 4.19411 3.84769 1.46634 0.26236 1.09861 0.40547
1350 443 2.75053 2.45555 2.56139 0.25736 827 u U - <
1351 1.38629 1.38629 1.38629 1.38629
1352 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1353 444 2.87301 2.17925 3.02511 0.24617 828 u U - -
1354 1.38629 1.38629 1.38629 1.38629
1355 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1356 445 0.67571 2.01805 1.69785 1.74176 829 a a - <
1357 1.38629 1.38629 1.38629 1.38629
1358 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1359 446 2.42494 0.31303 2.58427 2.25535 830 c C - <
1360 1.38629 1.38629 1.38629 1.38629
1361 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1362 447 2.92316 0.26536 2.81986 2.12280 831 c C - <
1363 1.34225 1.34225 1.43237 1.43237
1364 0.04570 3.52355 4.18785 1.06721 0.42154 1.22789 0.34660
1365 448 2.93097 0.26190 2.82572 2.13878 834 c C - -
1366 1.42720 1.42720 1.40573 1.29152
1367 0.05732 3.20570 4.18785 0.63180 0.75851 1.22789 0.34660
1368 449 0.24946 2.60818 2.84874 2.41695 836 a A - -
1369 1.38629 1.38629 1.38629 1.38629
1370 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1371 450 0.76840 1.36471 2.11049 1.83500 837 a A - -
1372 1.38629 1.38629 1.38629 1.38629
1373 0.03830 4.18785 3.79881 1.46634 0.26236 1.22789 0.34660
1374 451 3.05857 2.58616 3.20449 0.17774 838 u U - <
1375 1.38629 1.38629 1.38629 1.38629
1376 0.03106 4.18060 4.18060 1.46634 0.26236 0.96926 0.47701
1377 452 1.67728 1.00963 1.46025 1.52976 839 c c - <
1378 1.38629 1.38629 1.38629 1.38629
1379 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1380 453 2.04247 0.76772 1.89968 1.36022 840 c c - <
1381 1.38629 1.38629 1.38629 1.38629
1382 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1383 454 1.67865 1.12616 1.76301 1.14706 841 c c - <
1384 1.38629 1.38629 1.38629 1.38629
1385 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1386 455 1.01383 1.87523 1.17647 1.74018 842 a g - <
1387 1.38629 1.38629 1.38629 1.38629
1388 0.03083 4.18785 4.18785 1.46634 0.26236 0.88146 0.53474
1389 456 0.97020 2.23770 1.05576 1.79360 843 a a - _
1390 1.38629 1.38629 1.38629 1.38629
1391 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1392 457 1.38706 1.07773 1.96188 1.31218 844 c c - _
1393 1.38629 1.38629 1.38629 1.38629
1394 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1395 458 1.02198 1.69244 1.91400 1.17584 845 a a - _
1396 1.09846 1.43921 1.78616 1.33980
1397 0.17138 1.99384 3.84769 1.03112 0.44100 1.09861 0.40547
1398 459 1.76393 0.91016 1.63099 1.46779 851 c c - >
1399 1.38629 1.38629 1.38629 1.38629
1400 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1401 460 1.42375 1.84387 0.96830 1.50842 852 g g - >
1402 1.40701 1.32659 1.40701 1.40701
1403 0.04402 3.57949 4.18785 0.87187 0.54157 1.22789 0.34660
1404 461 1.54927 2.24043 0.61765 1.95211 854 g g - >
1405 1.38629 1.38629 1.38629 1.38629
1406 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1407 462 1.71034 1.71383 0.87948 1.49601 855 g g - >
1408 1.38629 1.38629 1.38629 1.38629
1409 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1410 463 3.08341 3.79859 0.10012 3.60958 856 G G - >
1411 1.38629 1.38629 1.38629 1.38629
1412 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1413 464 0.26551 2.52451 2.56217 2.57769 857 a A - -
1414 1.47642 1.47642 1.22727 1.38629
1415 0.04570 3.52355 4.18785 1.41818 0.27727 1.22789 0.34660
1416 465 2.29730 3.38465 0.19416 3.16872 862 g G - >
1417 1.38629 1.38629 1.38629 1.38629
1418 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1419 466 2.19118 2.79028 0.29623 2.48654 863 g G - >
1420 1.38629 1.38629 1.38629 1.38629
1421 0.03083 4.18785 4.18785 1.46634 0.26236 1.22789 0.34660
1422 467 2.02682 1.77162 2.02458 0.56891 864 u u - >
1423 1.38629 1.38629 1.38629 1.38629
1424 0.03083 4.18785 4.18785 1.46634 0.26236 0.88146 0.53474
1425 468 0.53529 2.07936 2.01520 1.85662 865 a A - >
1426 1.38629 1.38629 1.38629 1.38629
1427 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1428 469 3.09270 3.81113 0.09897 3.62220 866 G G - ,
1429 1.38629 1.38629 1.38629 1.38629
1430 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1431 470 2.69686 1.71138 2.84109 0.36585 867 u U - }
1432 1.38629 1.38629 1.38629 1.38629
1433 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1434 471 2.03181 2.95734 0.30430 2.53440 868 g g - }
1435 1.38629 1.38629 1.38629 1.38629
1436 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1437 472 0.13105 3.46842 2.90546 3.29845 869 a A - -
1438 1.38629 1.38629 1.38629 1.38629
1439 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1440 473 1.82154 0.55604 2.26450 1.82720 870 c g - }
1441 1.38629 1.38629 1.38629 1.38629
1442 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1443 474 1.15717 2.14848 0.84072 1.98368 871 g g - }
1444 1.38629 1.38629 1.38629 1.38629
1445 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1446 475 0.33191 2.64867 2.18767 2.30737 872 a A - }
1447 1.38629 1.38629 1.38629 1.38629
1448 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1449 476 1.25621 1.86391 1.05775 1.54661 873 g g - }
1450 1.38629 1.38629 1.38629 1.38629
1451 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1452 477 0.55217 1.95176 1.96336 1.95269 874 a a - }
1453 1.38629 1.38629 1.38629 1.38629
1454 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1455 478 0.64623 1.71937 2.23849 1.65976 875 a g - }
1456 1.38629 1.38629 1.38629 1.38629
1457 0.03851 4.19411 3.78580 1.46634 0.26236 1.09861 0.40547
1458 479 0.52748 2.15949 1.76097 2.09842 876 a A - ,
1459 1.38629 1.38629 1.38629 1.38629
1460 0.03087 4.18647 4.18647 1.46634 0.26236 1.25399 0.33598
1461 480 2.95763 2.36767 3.10966 0.21104 877 u U - ,
1462 1.24967 1.33457 1.72027 1.30522
1463 0.09083 2.63633 4.18647 2.43421 0.09175 1.25399 0.33598
1464 481 0.58854 1.89602 1.91356 1.91635 898 a A - ,
1465 1.38629 1.38629 1.38629 1.38629
1466 0.03087 4.18647 4.18647 1.46634 0.26236 1.25399 0.33598
1467 482 1.01215 1.57823 1.67281 1.41672 899 a a - ,
1468 1.38629 1.38629 1.38629 1.38629
1469 0.03087 4.18647 4.18647 1.46634 0.26236 0.84567 0.56084
1470 483 2.00593 0.77828 2.01169 1.30008 900 c c - <
1471 1.38629 1.38629 1.38629 1.38629
1472 0.04643 4.19411 3.49727 1.46634 0.26236 1.09861 0.40547
1473 484 1.23416 1.96526 1.02774 1.55596 901 g g - <
1474 1.40183 1.40183 1.37356 1.36844
1475 0.05441 3.69261 3.57362 0.96743 0.47813 1.38814 0.28707
1476 485 0.79845 2.01603 1.57989 1.55687 903 a a - <
1477 1.38629 1.38629 1.38629 1.38629
1478 0.06386 4.16598 3.07156 1.46634 0.26236 0.53326 0.88356
1479 486 1.66151 1.71405 1.72397 0.79483 904 u u - <
1480 1.38629 1.38629 1.38629 1.38629
1481 0.03159 4.16367 4.16367 1.46634 0.26236 1.15948 0.37637
1482 487 1.26167 1.59000 1.14510 1.63629 905 g g - <
1483 1.42082 1.41899 1.31288 1.39643
1484 0.07101 2.93492 4.17241 0.50464 0.92564 1.48685 0.25629
1485 488 1.53014 1.13181 1.66380 1.30333 907 c c - <
1486 1.38629 1.38629 1.38629 1.38629
1487 0.03132 4.17241 4.17241 1.46634 0.26236 1.06968 0.42025
1488 489 1.38746 1.58815 1.17722 1.43610 908 g g - <
1489 1.38629 1.38629 1.38629 1.38629
1490 0.03884 4.18036 3.78102 1.46634 0.26236 1.36238 0.29578
1491 490 1.52487 1.91692 0.93515 1.41567 909 g g - <
1492 1.36253 1.39434 1.39434 1.39434
1493 0.03645 3.89276 4.17282 1.15258 0.37954 1.48077 0.25808
1494 491 1.69071 1.89106 0.83089 1.47386 911 g g - <
1495 1.38016 1.37548 1.43838 1.35312
1496 0.08474 2.72050 4.17282 0.41634 1.07722 1.48077 0.25808
1497 492 1.24068 1.73250 1.26128 1.38358 913 a c - <
1498 1.38629 1.38629 1.38629 1.38629
1499 0.03735 4.17282 3.85119 1.46634 0.26236 1.48077 0.25808
1500 493 1.53878 0.99483 1.64993 1.49830 914 c c - <
1501 1.38629 1.38629 1.38629 1.38629
1502 0.06824 4.16696 2.98641 1.46634 0.26236 1.56354 0.23496
1503 494 1.63211 1.44683 1.63107 0.98498 915 u u - <
1504 1.38629 1.38629 1.38629 1.38629
1505 0.05500 4.13137 3.28460 1.46634 0.26236 1.95045 0.15340
1506 495 1.48257 1.12549 1.68914 1.33265 916 c c - <
1507 1.50395 1.61988 1.32892 1.15498
1508 0.54850 1.19344 2.12857 1.16179 0.37531 0.98548 0.46722
1509 496 1.25681 1.91491 1.66584 0.97008 931 u u - _
1510 1.38629 1.38629 1.38629 1.38629
1511 0.03585 4.03956 4.03956 1.46634 0.26236 0.31979 1.29572
1512 497 1.56445 1.78134 1.84659 0.76656 932 u U - _
1513 1.38629 1.38629 1.38629 1.38629
1514 0.03131 4.17247 4.17247 1.46634 0.26236 1.48600 0.25654
1515 498 1.20161 1.54764 1.68862 1.19810 933 u a - _
1516 1.38629 1.38629 1.38629 1.38629
1517 0.03131 4.17247 4.17247 1.46634 0.26236 1.11296 0.39837
1518 499 1.53281 1.35563 1.55722 1.15339 934 u u - _
1519 1.38629 1.38629 1.38629 1.38629
1520 0.08949 4.17941 2.65504 1.46634 0.26236 1.37807 0.29044
1521 500 1.55921 1.73013 0.98876 1.42546 935 g g - >
1522 1.38629 1.38629 1.38629 1.38629
1523 0.03293 4.12285 4.12285 1.46634 0.26236 1.59905 0.22576
1524 501 1.07561 1.70526 1.30670 1.57758 936 a a - >
1525 1.40223 1.37391 1.40223 1.36731
1526 0.04337 3.63510 4.13137 0.95918 0.48322 0.76990 0.62187
1527 502 1.67892 1.70409 0.90250 1.48753 938 g g - >
1528 1.38629 1.38629 1.38629 1.38629
1529 0.03149 4.16696 4.16696 1.46634 0.26236 1.24191 0.34085
1530 503 1.54691 1.39664 1.41004 1.21897 939 u g - >
1531 1.40632 1.22729 1.54749 1.38994
1532 0.16063 2.16499 3.39188 0.30879 1.32551 1.48077 0.25808
1533 504 1.51547 1.20397 1.77792 1.16699 942 u c - >
1534 1.38629 1.38629 1.38629 1.38629
1535 0.04080 4.15442 3.71808 1.46634 0.26236 1.50372 0.25142
1536 505 1.70926 1.43116 1.62497 0.95958 943 u c - >
1537 1.43367 1.37972 1.30384 1.43367
1538 0.07290 3.07098 3.73243 0.58066 0.81991 0.68040 0.70606
1539 506 1.63325 1.32492 1.45231 1.18793 945 u c - >
1540 1.38629 1.38629 1.38629 1.38629
1541 0.03132 4.17241 4.17241 1.46634 0.26236 1.48685 0.25629
1542 507 1.51379 1.90357 0.96220 1.39096 946 g g - >
1543 1.38629 1.38629 1.38629 1.38629
1544 0.03132 4.17241 4.17241 1.46634 0.26236 1.48685 0.25629
1545 508 1.61126 1.29731 1.51816 1.17771 947 u c - >
1546 1.38629 1.38629 1.38629 1.38629
1547 0.03132 4.17241 4.17241 1.46634 0.26236 1.48685 0.25629
1548 509 0.93933 1.94365 1.43242 1.48192 948 a a - >
1549 1.40792 1.40792 1.32409 1.40792
1550 0.04532 3.54413 4.17241 0.85718 0.55227 1.48685 0.25629
1551 510 0.79177 1.90573 1.81020 1.44977 950 a A - -
1552 1.38629 1.38629 1.38629 1.38629
1553 0.05065 4.17241 3.38204 1.46634 0.26236 0.60179 0.79370
1554 511 1.89220 1.73447 2.19050 0.57820 951 u u - >
1555 1.36974 1.36974 1.40312 1.40312
1556 0.03660 3.88352 4.17578 1.24997 0.33759 1.43609 0.27162
1557 512 1.77200 1.28474 1.97203 0.88162 954 u c - >
1558 1.38629 1.38629 1.38629 1.38629
1559 0.03121 4.17578 4.17578 1.46634 0.26236 0.64571 0.74294
1560 513 1.82830 2.33997 0.45533 2.21877 955 g g - >
1561 1.13745 1.48521 1.48521 1.48521
1562 0.06786 3.32435 3.51955 1.22458 0.34797 1.09861 0.40547
1563 514 1.56494 1.78097 0.77323 1.82694 959 g g - ,
1564 1.38629 1.38629 1.38629 1.38629
1565 0.03109 4.17948 4.17948 1.46634 0.26236 0.70248 0.68390
1566 515 0.46571 2.17811 1.93829 2.16192 960 a A - ,
1567 1.38629 1.38629 1.38629 1.38629
1568 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1569 516 0.44477 2.19110 2.24016 1.96047 961 a A - ,
1570 1.38629 1.38629 1.38629 1.38629
1571 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1572 517 2.31358 2.20833 2.74013 0.31931 962 u U - ,
1573 1.38629 1.38629 1.38629 1.38629
1574 0.04449 4.19411 3.56028 1.46634 0.26236 1.09861 0.40547
1575 518 2.14005 3.08124 0.25949 2.73336 963 g G - ,
1576 1.39344 1.39344 1.36517 1.39344
1577 0.03558 3.92863 4.18067 1.18040 0.36695 0.72325 0.66393
1578 519 0.76282 2.23133 1.20105 2.07636 965 a A - ,
1579 1.38629 1.38629 1.38629 1.38629
1580 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1581 520 1.53865 2.04930 0.75397 1.68197 966 g g - <
1582 1.38629 1.38629 1.38629 1.38629
1583 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1584 521 1.48849 1.57993 1.79597 0.91048 967 u u - <
1585 1.38629 1.38629 1.38629 1.38629
1586 0.04333 4.19411 3.60019 1.46634 0.26236 1.09861 0.40547
1587 522 1.24322 1.61716 1.34239 1.37887 968 a a - <
1588 1.34685 1.38629 1.42736 1.38629
1589 0.03793 3.81890 4.18180 1.77147 0.18643 1.33791 0.30434
1590 523 1.56668 1.22275 1.57094 1.24135 977 c u - -
1591 1.39737 1.39737 1.39737 1.35379
1592 0.03806 3.81345 4.18180 1.06926 0.42047 1.33791 0.30434
1593 524 0.85461 1.89180 1.53505 1.56875 979 a a - <
1594 1.38629 1.38629 1.38629 1.38629
1595 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1596 525 1.12935 1.62445 1.47831 1.37946 980 a c - <
1597 1.38629 1.38629 1.38629 1.38629
1598 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1599 526 1.57524 1.61480 1.90731 0.80826 981 u u - <
1600 1.40487 1.33256 1.40487 1.40487
1601 0.04290 3.62225 4.18180 0.90891 0.51578 1.33791 0.30434
1602 527 1.60826 1.50084 1.51653 1.02904 983 u u - _
1603 1.38629 1.38629 1.38629 1.38629
1604 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1605 528 2.65239 1.63387 2.79439 0.39572 984 u U - _
1606 1.38629 1.38629 1.38629 1.38629
1607 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1608 529 0.16410 3.15080 3.01044 2.82587 985 a A - _
1609 1.38629 1.38629 1.38629 1.38629
1610 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1611 530 0.68324 1.85419 1.84501 1.71246 986 a A - _
1612 1.39922 1.34848 1.39922 1.39922
1613 0.03925 3.76274 4.18180 1.02420 0.44485 0.74399 0.64476
1614 531 0.31807 2.29998 2.68528 2.26349 988 a A - _
1615 1.31232 1.21827 1.52541 1.52541
1616 0.05693 3.21239 4.19411 1.32895 0.30755 1.09861 0.40547
1617 532 1.38949 1.36095 1.75730 1.13361 993 u u - _
1618 1.38629 1.38629 1.38629 1.38629
1619 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1620 533 1.23833 1.13994 1.76935 1.51480 994 c a - _
1621 1.38629 1.38629 1.38629 1.38629
1622 0.04333 4.19411 3.60019 1.46634 0.26236 1.09861 0.40547
1623 534 1.43787 1.18681 1.64920 1.32739 995 c a - >
1624 1.38629 1.38629 1.38629 1.38629
1625 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1626 535 1.56693 1.21398 1.56132 1.25722 996 c g - >
1627 1.38629 1.38629 1.38629 1.38629
1628 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1629 536 1.82252 1.55604 1.91771 0.73299 997 u u - >
1630 1.37763 1.42837 1.31518 1.42837
1631 0.05800 3.39404 3.78212 0.87609 0.53856 1.33791 0.30434
1632 537 1.58945 1.54200 1.59468 0.97013 1000 u u - >
1633 1.40481 1.33273 1.40481 1.40481
1634 0.04319 3.61618 4.17427 0.91004 0.51502 1.45918 0.26452
1635 538 1.13177 1.64581 1.59931 1.26356 1002 a a - -
1636 1.39689 1.39689 1.35516 1.39689
1637 0.03804 3.81931 4.17427 1.08150 0.41413 0.62522 0.76603
1638 539 1.14187 1.79918 1.47578 1.24917 1004 a a - >
1639 1.38629 1.38629 1.38629 1.38629
1640 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1641 540 1.72621 0.90513 1.90450 1.31433 1005 c c - >
1642 1.38629 1.38629 1.38629 1.38629
1643 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1644 541 1.87403 2.26423 0.44621 2.27750 1006 g G - ,
1645 1.38629 1.38629 1.38629 1.38629
1646 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1647 542 0.33128 2.43611 2.43874 2.23285 1007 a A - ,
1648 1.38629 1.38629 1.38629 1.38629
1649 0.13534 4.19411 2.19380 1.46634 0.26236 1.09861 0.40547
1650 543 2.13550 2.30148 0.44488 1.96039 1008 g G - ,
1651 1.38629 1.38629 1.38629 1.38629
1652 0.03396 4.09273 4.09273 1.46634 0.26236 0.34653 1.22806
1653 544 1.38927 2.01128 1.10755 1.24982 1009 g g - ,
1654 1.38629 1.38629 1.38629 1.38629
1655 0.03874 4.18273 3.78339 1.46634 0.26236 1.02237 0.44588
1656 545 0.45101 2.15115 2.42839 1.84208 1010 a A - ,
1657 1.38629 1.38629 1.38629 1.38629
1658 0.04342 4.18056 3.60453 1.46634 0.26236 1.02160 0.44631
1659 546 1.34049 1.56613 1.57595 1.13128 1011 u u - ,
1660 1.38629 1.38629 1.38629 1.38629
1661 0.03664 4.17477 3.88251 1.46634 0.26236 1.45157 0.26684
1662 547 2.89956 0.21203 3.24559 2.33233 1012 c C - ,
1663 1.38629 1.38629 1.38629 1.38629
1664 0.03141 4.16954 4.16954 1.46634 0.26236 0.92359 0.50599
1665 548 1.02548 1.66739 1.64914 1.34546 1013 a a - ,
1666 1.38629 1.38629 1.38629 1.38629
1667 0.03100 4.18229 4.18229 1.46634 0.26236 1.08675 0.41145
1668 549 0.08396 3.74415 3.51925 3.60237 1014 A A - ,
1669 1.38629 1.38629 1.38629 1.38629
1670 0.04367 4.18647 3.59256 1.46634 0.26236 0.84567 0.56084
1671 550 2.16791 1.68790 1.89521 0.59713 1015 u u - <
1672 1.38629 1.38629 1.38629 1.38629
1673 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1674 551 2.36435 1.72259 2.26214 0.47279 1016 u u - <
1675 1.38629 1.38629 1.38629 1.38629
1676 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1677 552 1.69257 2.51623 0.42840 2.48122 1017 g G - <
1678 1.38629 1.38629 1.38629 1.38629
1679 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1680 553 2.33936 3.39845 0.18780 3.18441 1018 g G - <
1681 1.38629 1.38629 1.38629 1.38629
1682 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1683 554 0.20176 2.96247 3.01466 2.50160 1019 a A - <
1684 1.38629 1.38629 1.38629 1.38629
1685 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1686 555 2.43651 3.44916 0.17249 3.23920 1020 g G - <
1687 1.38629 1.38629 1.38629 1.38629
1688 0.03748 4.18180 3.83911 1.46634 0.26236 1.33791 0.30434
1689 556 2.86084 3.51490 0.13720 3.18849 1021 g G - -
1690 1.38629 1.38629 1.38629 1.38629
1691 0.03122 4.17554 4.17554 1.46634 0.26236 1.09710 0.40622
1692 557 1.75489 2.90406 0.36134 2.58319 1022 g G - -
1693 1.38629 1.38629 1.38629 1.38629
1694 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1695 558 2.02651 0.35338 2.84264 2.22915 1023 c C - -
1696 1.38629 1.38629 1.38629 1.38629
1697 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1698 559 0.19210 2.82970 2.84452 2.85453 1024 a A - -
1699 1.38629 1.38629 1.38629 1.38629
1700 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1701 560 0.08501 3.73194 3.50833 3.58973 1025 A A - -
1702 1.41241 1.41241 1.31180 1.41241
1703 0.04783 3.45980 4.18180 0.79112 0.60392 1.33791 0.30434
1704 561 3.07444 3.78646 0.10124 3.59736 1027 G G - -
1705 1.38629 1.38629 1.38629 1.38629
1706 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1707 562 2.36362 1.70523 2.63089 0.42744 1028 u U - -
1708 1.38629 1.38629 1.38629 1.38629
1709 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1710 563 2.88430 0.23125 3.21152 2.20485 1029 c C - <
1711 1.39527 1.39527 1.39527 1.35985
1712 0.03671 3.87392 4.18180 1.12564 0.39222 1.33791 0.30434
1713 564 2.36423 2.22663 2.76499 0.30773 1031 u U - <
1714 1.38629 1.38629 1.38629 1.38629
1715 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1716 565 2.34070 3.15430 0.22497 2.77213 1032 g G - <
1717 1.38629 1.38629 1.38629 1.38629
1718 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1719 566 2.73377 3.35036 0.16739 2.91716 1033 g G - <
1720 1.38629 1.38629 1.38629 1.38629
1721 0.04505 4.18180 3.54797 1.46634 0.26236 1.33791 0.30434
1722 567 2.70210 2.67694 3.08012 0.20064 1034 u U - -
1723 1.38629 1.38629 1.38629 1.38629
1724 0.03145 4.16820 4.16820 1.46634 0.26236 1.54669 0.23947
1725 568 2.43423 2.92559 0.21513 2.95138 1035 g G - -
1726 1.38629 1.38629 1.38629 1.38629
1727 0.03145 4.16820 4.16820 1.46634 0.26236 1.54669 0.23947
1728 569 2.77893 0.21533 3.21747 2.39076 1036 c C - -
1729 1.38629 1.38629 1.38629 1.38629
1730 0.03145 4.16820 4.16820 1.46634 0.26236 1.54669 0.23947
1731 570 2.95169 0.24512 2.83371 2.24106 1037 c C - -
1732 1.38629 1.38629 1.38629 1.38629
1733 0.03145 4.16820 4.16820 1.46634 0.26236 0.91286 0.51312
1734 571 0.08501 3.73194 3.50833 3.58973 1038 A A - -
1735 1.38629 1.38629 1.38629 1.38629
1736 0.03965 4.18180 3.74657 1.46634 0.26236 1.33791 0.30434
1737 572 2.61360 3.53143 0.14893 3.32883 1039 g G - <
1738 1.38629 1.38629 1.38629 1.38629
1739 0.03128 4.17344 4.17344 1.46634 0.26236 1.47164 0.26078
1740 573 3.12740 0.20512 3.31077 2.25253 1040 c C - <
1741 1.38629 1.38629 1.38629 1.38629
1742 0.03128 4.17344 4.17344 1.46634 0.26236 1.47164 0.26078
1743 574 0.08693 3.71005 3.48872 3.56709 1041 A A - _
1744 1.38629 1.38629 1.38629 1.38629
1745 0.03909 4.17344 3.77483 1.46634 0.26236 1.03641 0.43808
1746 575 2.10125 1.95681 0.45807 2.26446 1042 g G - _
1747 1.38629 1.38629 1.38629 1.38629
1748 0.03126 4.17429 4.17429 1.46634 0.26236 1.06020 0.42524
1749 576 2.89067 0.25056 3.17608 2.08468 1043 c C - _
1750 1.38629 1.38629 1.38629 1.38629
1751 0.04286 4.18180 3.62371 1.46634 0.26236 1.33791 0.30434
1752 577 2.53887 0.31825 2.95695 1.95440 1044 c C - _
1753 1.38629 1.38629 1.38629 1.38629
1754 0.04011 4.17032 3.73509 1.46634 0.26236 0.95888 0.48341
1755 578 2.46705 2.94125 0.20906 2.97553 1045 g G - >
1756 1.38629 1.38629 1.38629 1.38629
1757 0.03128 4.17344 4.17344 1.46634 0.26236 1.47164 0.26078
1758 579 2.76911 0.22311 3.20087 2.33795 1046 c C - >
1759 1.39499 1.36067 1.39499 1.39499
1760 0.04886 3.87396 3.61523 1.13370 0.38837 1.47164 0.26078
1761 580 3.04478 3.74619 0.10508 3.55679 1048 G G - -
1762 1.38629 1.38629 1.38629 1.38629
1763 0.03165 4.16186 4.16186 1.46634 0.26236 1.07180 0.41914
1764 581 3.06201 3.76961 0.10283 3.58039 1049 G G - -
1765 1.38629 1.38629 1.38629 1.38629
1766 0.03128 4.17344 4.17344 1.46634 0.26236 1.03641 0.43808
1767 582 2.93944 2.34307 3.09121 0.21614 1050 u U - -
1768 1.38629 1.38629 1.38629 1.38629
1769 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1770 583 0.08501 3.73194 3.50833 3.58973 1051 A A - -
1771 1.38629 1.38629 1.38629 1.38629
1772 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1773 584 0.08501 3.73194 3.50833 3.58973 1052 A A - -
1774 1.38629 1.38629 1.38629 1.38629
1775 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1776 585 2.43665 1.92505 2.59230 0.36841 1053 u U - -
1777 1.38629 1.38629 1.38629 1.38629
1778 0.04420 4.18180 3.57663 1.46634 0.26236 1.33791 0.30434
1779 586 1.92655 2.22157 2.52968 0.40613 1054 u U - -
1780 1.38629 1.38629 1.38629 1.38629
1781 0.03142 4.16902 4.16902 1.46634 0.26236 0.93011 0.50172
1782 587 3.05111 0.21297 2.90838 2.40847 1055 c C - >
1783 1.38629 1.38629 1.38629 1.38629
1784 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1785 588 3.05111 0.21297 2.90838 2.40847 1056 c C - >
1786 1.41320 1.36010 1.36010 1.41320
1787 0.03965 3.74657 4.18180 1.17012 0.37154 1.33791 0.30434
1788 589 0.30987 2.64719 2.43595 2.22478 1059 a A - >
1789 1.38629 1.38629 1.38629 1.38629
1790 0.03102 4.18180 4.18180 1.46634 0.26236 1.33791 0.30434
1791 590 2.32299 3.21588 0.21486 2.89597 1060 g G - >
1792 1.38629 1.38629 1.38629 1.38629
1793 0.03998 4.18180 3.73306 1.46634 0.26236 1.33791 0.30434
1794 591 2.67335 0.19541 3.27712 2.64864 1061 c C - >
1795 1.38629 1.38629 1.38629 1.38629
1796 0.03129 4.17311 4.17311 1.46634 0.26236 1.47646 0.25935
1797 592 2.58650 2.60651 2.86032 0.23108 1062 u U - >
1798 1.38629 1.38629 1.38629 1.38629
1799 0.03129 4.17311 4.17311 1.46634 0.26236 1.47646 0.25935
1800 593 3.03868 0.24642 3.21608 2.03715 1063 c C - >
1801 1.38629 1.38629 1.38629 1.38629
1802 0.03129 4.17311 4.17311 1.46634 0.26236 1.47646 0.25935
1803 594 2.41694 0.57517 2.29562 1.39636 1064 c C - >
1804 1.38629 1.38629 1.38629 1.38629
1805 0.03129 4.17311 4.17311 1.46634 0.26236 1.47646 0.25935
1806 595 0.72277 1.99949 1.57352 1.76100 1065 a a - >
1807 1.39984 1.39984 1.34674 1.39984
1808 0.04000 3.73789 4.17311 1.01023 0.45277 1.47646 0.25935
1809 596 0.80426 1.87165 1.60045 1.62503 1067 a a - >
1810 1.38629 1.38629 1.38629 1.38629
1811 0.03129 4.17311 4.17311 1.46634 0.26236 0.61045 0.78331
1812 597 1.44214 1.98363 1.83023 0.76435 1068 u U - ,
1813 1.38629 1.38629 1.38629 1.38629
1814 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1815 598 0.31013 2.72658 2.18921 2.41683 1069 a A - }
1816 1.39499 1.39499 1.36067 1.39499
1817 0.03608 3.89463 4.19411 1.13370 0.38837 1.09861 0.40547
1818 599 2.87713 3.69703 0.11788 3.50294 1071 g G - }
1819 1.38629 1.38629 1.38629 1.38629
1820 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1821 600 2.23602 0.64937 2.33735 1.29406 1072 c c - }
1822 1.40687 1.40687 1.32699 1.40687
1823 0.04365 3.58893 4.19411 0.87424 0.53987 1.09861 0.40547
1824 601 1.57173 2.31866 0.58669 1.98233 1074 g g - }
1825 1.38629 1.38629 1.38629 1.38629
1826 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1827 602 2.70844 2.14947 2.93721 0.26945 1075 u U - }
1828 1.38629 1.38629 1.38629 1.38629
1829 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1830 603 0.42292 2.10551 2.35177 2.05664 1076 a A - }
1831 1.38629 1.38629 1.38629 1.38629
1832 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1833 604 2.08051 1.74318 2.33050 0.50597 1077 u u - }
1834 1.38629 1.38629 1.38629 1.38629
1835 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1836 605 0.63425 2.10903 1.79979 1.69840 1078 a a - }
1837 1.38629 1.38629 1.38629 1.38629
1838 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1839 606 1.82897 1.41961 2.07209 0.75144 1079 u c - }
1840 1.38629 1.38629 1.38629 1.38629
1841 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1842 607 1.94441 1.69731 2.08216 0.59949 1080 u u - }
1843 1.38629 1.38629 1.38629 1.38629
1844 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1845 608 0.63633 2.10488 1.81189 1.68437 1081 a A - ,
1846 1.38629 1.38629 1.38629 1.38629
1847 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1848 609 0.49984 2.32845 1.97845 1.84743 1082 a A - ,
1849 1.34644 1.39994 1.39994 1.39994
1850 0.03922 3.75617 4.19411 1.00791 0.45410 1.09861 0.40547
1851 610 0.87943 1.75639 2.08245 1.24588 1084 a a - ,
1852 1.38629 1.38629 1.38629 1.38629
1853 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1854 611 1.47850 2.45003 0.58003 2.07267 1085 g G - ,
1855 1.38629 1.38629 1.38629 1.38629
1856 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1857 612 2.33154 1.52376 2.58874 0.49455 1086 u U - ,
1858 1.38629 1.38629 1.38629 1.38629
1859 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1860 613 3.05996 2.77669 2.97695 0.17445 1087 u U - ,
1861 1.38629 1.38629 1.38629 1.38629
1862 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1863 614 2.40004 3.44629 0.17668 3.23455 1088 g G - ,
1864 1.38629 1.38629 1.38629 1.38629
1865 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1866 615 2.55694 1.03652 2.69327 0.69292 1089 u U - ,
1867 1.38629 1.38629 1.38629 1.38629
1868 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1869 616 2.68225 2.61855 2.71142 0.23289 1090 u U - ,
1870 1.38629 1.38629 1.38629 1.38629
1871 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1872 617 2.32524 3.40747 0.18868 3.19260 1091 g G - ,
1873 1.40263 1.33882 1.40263 1.40263
1874 0.04093 3.68793 4.19411 0.95113 0.48825 1.09861 0.40547
1875 618 2.06316 0.62155 2.32762 1.43419 1093 c c - [
1876 1.38629 1.38629 1.38629 1.38629
1877 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1878 619 1.06964 2.11617 1.02244 1.73353 1094 g g - [
1879 1.38629 1.38629 1.38629 1.38629
1880 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1881 620 2.19160 3.08218 0.25519 2.69365 1095 g G - [
1882 1.38629 1.38629 1.38629 1.38629
1883 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1884 621 2.85303 2.40781 2.82794 0.23170 1096 u U - -
1885 1.38629 1.38629 1.38629 1.38629
1886 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1887 622 3.22346 2.87889 3.35684 0.14025 1097 u U - -
1888 1.38629 1.38629 1.38629 1.38629
1889 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1890 623 0.25259 2.68137 2.47730 2.64830 1098 a A - -
1891 1.38629 1.38629 1.38629 1.38629
1892 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1893 624 0.15261 3.37107 2.71731 3.19097 1099 a A - -
1894 1.38629 1.38629 1.38629 1.38629
1895 0.03528 4.19411 3.93303 1.46634 0.26236 1.09861 0.40547
1896 625 0.08327 3.75232 3.52653 3.61081 1100 A A - -
1897 1.38600 1.33597 1.43949 1.38639
1898 0.04803 3.45013 4.18960 1.03800 0.43721 0.93234 0.50027
1899 626 0.42885 2.30850 1.94417 2.24221 1104 a A - [
1900 1.43905 1.33618 1.38629 1.38629
1901 0.03958 3.74130 4.19411 1.81222 0.17828 1.09861 0.40547
1902 627 1.15980 1.09064 1.80373 1.68326 1113 c a - ,
1903 1.38629 1.38629 1.38629 1.38629
1904 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1905 628 2.33574 3.41291 0.18694 3.19848 1114 g G - (
1906 1.38629 1.38629 1.38629 1.38629
1907 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1908 629 2.43978 0.49855 2.74213 1.42306 1115 c c - (
1909 1.38629 1.38629 1.38629 1.38629
1910 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1911 630 2.38818 1.84973 2.68340 0.38186 1116 u u - (
1912 1.38629 1.38629 1.38629 1.38629
1913 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1914 631 3.09339 0.23161 3.27445 2.09105 1117 c C - (
1915 1.39984 1.39984 1.39984 1.34674
1916 0.06322 3.75888 3.27150 1.01023 0.45277 1.09861 0.40547
1917 632 2.29347 2.71851 0.25807 2.80394 1119 g G - -
1918 1.38629 1.38629 1.38629 1.38629
1919 0.03136 4.17098 4.17098 1.46634 0.26236 0.58498 0.81444
1920 633 2.75255 2.20964 2.97555 0.25428 1120 u U - -
1921 1.38629 1.38629 1.38629 1.38629
1922 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1923 634 0.25633 2.33268 2.87969 2.61832 1121 a A - -
1924 1.38629 1.38629 1.38629 1.38629
1925 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1926 635 2.35302 2.90041 0.22785 2.92481 1122 g g - (
1927 1.38629 1.38629 1.38629 1.38629
1928 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1929 636 2.91144 2.24524 3.06454 0.23190 1123 u U - (
1930 1.38629 1.38629 1.38629 1.38629
1931 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1932 637 2.18581 1.46520 2.49037 0.55565 1124 u u - (
1933 1.38629 1.38629 1.38629 1.38629
1934 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1935 638 1.87051 2.13454 0.64642 1.59093 1125 g G - -
1936 1.38629 1.38629 1.38629 1.38629
1937 0.03915 4.19411 3.75888 1.46634 0.26236 1.09861 0.40547
1938 639 1.13366 2.14036 0.86248 1.97745 1126 g a - -
1939 1.38629 1.38629 1.38629 1.38629
1940 0.03089 4.18585 4.18585 1.46634 0.26236 1.26563 0.33137
1941 640 0.87887 1.66660 1.91492 1.39229 1127 a a - -
1942 1.38629 1.38629 1.38629 1.38629
1943 0.03089 4.18585 4.18585 1.46634 0.26236 0.83040 0.57248
1944 641 1.50577 1.46341 1.66622 1.02792 1128 u u - -
1945 1.38629 1.38629 1.38629 1.38629
1946 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1947 642 1.59753 1.41058 1.82366 0.93606 1129 u u - -
1948 1.38629 1.38629 1.38629 1.38629
1949 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
1950 643 1.41995 1.74614 1.76922 0.88343 1130 u u - -
1951 1.38629 1.38629 1.38629 1.38629
1952 0.04093 4.19411 3.68793 1.46634 0.26236 1.09861 0.40547
1953 644 1.22187 1.34218 1.58594 1.43008 1131 a a - -
1954 1.38629 1.38629 1.38629 1.38629
1955 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
1956 645 1.25064 1.85800 1.13831 1.43829 1132 g a - -
1957 1.38629 1.38629 1.38629 1.38629
1958 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
1959 646 1.40227 1.92783 0.93612 1.53085 1133 g g - -
1960 1.38629 1.38629 1.38629 1.38629
1961 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
1962 647 1.55167 1.66979 1.19538 1.21325 1134 g u - -
1963 1.38629 1.38629 1.38629 1.38629
1964 0.06777 4.18412 2.98997 1.46634 0.26236 1.29717 0.31925
1965 648 1.56970 1.48796 1.28803 1.23702 1135 u u - -
1966 1.38629 1.38629 1.38629 1.38629
1967 0.03209 4.14844 4.14844 1.46634 0.26236 1.78502 0.18367
1968 649 1.50058 1.46240 1.31674 1.28261 1136 u u - -
1969 1.38629 1.38629 1.38629 1.38629
1970 0.03209 4.14844 4.14844 1.46634 0.26236 1.56003 0.23589
1971 650 1.45985 1.52562 1.44955 1.15339 1137 u u - -
1972 1.38629 1.38629 1.38629 1.38629
1973 0.03196 4.15241 4.15241 1.46634 0.26236 1.74176 0.19263
1974 651 1.40061 1.49523 1.37303 1.28729 1138 u u - -
1975 1.40949 1.50273 1.20182 1.45860
1976 0.22333 1.69052 4.15241 0.46429 0.99043 1.74176 0.19263
1977 652 1.45820 1.64533 1.17660 1.32399 1142 g u - -
1978 1.38629 1.38629 1.38629 1.38629
1979 0.03950 4.15241 3.77195 1.46634 0.26236 1.15153 0.38002
1980 653 1.39347 1.52829 1.32332 1.31440 1143 u u - -
1981 1.38629 1.38629 1.38629 1.38629
1982 0.03178 4.15777 4.15777 1.46634 0.26236 1.68007 0.20624
1983 654 1.55519 1.69472 1.34395 1.06599 1144 u u - -
1984 1.38629 1.38629 1.38629 1.38629
1985 0.03178 4.15777 4.15777 1.46634 0.26236 1.68007 0.20624
1986 655 1.51887 1.48968 1.23415 1.32986 1145 g u - -
1987 1.38629 1.38629 1.38629 1.38629
1988 0.03178 4.15777 4.15777 1.46634 0.26236 1.45779 0.26494
1989 656 1.45830 1.60838 1.28244 1.23858 1146 u u - -
1990 1.38629 1.38629 1.38629 1.38629
1991 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
1992 657 1.64082 1.51750 1.51151 1.00419 1147 u u - -
1993 1.38629 1.38629 1.38629 1.38629
1994 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
1995 658 1.41008 1.75338 1.12533 1.35425 1148 g g - -
1996 1.38629 1.38629 1.38629 1.38629
1997 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
1998 659 1.43967 1.68104 1.22212 1.26511 1149 g u - -
1999 1.38629 1.38629 1.38629 1.38629
2000 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2001 660 1.34506 1.52503 1.49501 1.21196 1150 u u - -
2002 1.38629 1.38629 1.38629 1.38629
2003 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2004 661 1.39091 1.51506 1.43796 1.22435 1151 u u - -
2005 1.38629 1.38629 1.38629 1.38629
2006 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2007 662 1.62791 1.57219 1.32997 1.10388 1152 u u - -
2008 1.38629 1.38629 1.38629 1.38629
2009 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2010 663 1.36737 1.39759 1.44608 1.33736 1153 u a - -
2011 1.38629 1.38629 1.38629 1.38629
2012 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2013 664 1.40732 1.63103 1.41491 1.15035 1154 u u - -
2014 1.38629 1.38629 1.38629 1.38629
2015 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2016 665 1.49563 1.45277 1.27308 1.33939 1155 g u - -
2017 1.38629 1.38629 1.38629 1.38629
2018 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2019 666 1.44692 1.43372 1.34270 1.32747 1156 u u - -
2020 1.38629 1.38629 1.38629 1.38629
2021 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2022 667 1.36465 1.47583 1.62374 1.14325 1157 u u - -
2023 1.38629 1.38629 1.38629 1.38629
2024 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2025 668 1.24419 1.79153 1.34527 1.25649 1158 a a - -
2026 1.38629 1.38629 1.38629 1.38629
2027 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2028 669 1.52238 1.43635 1.46110 1.16464 1159 u u - -
2029 1.38629 1.38629 1.38629 1.38629
2030 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2031 670 1.41630 1.44885 1.34284 1.34153 1160 u u - -
2032 1.38629 1.38629 1.38629 1.38629
2033 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2034 671 1.55364 1.44175 1.45369 1.14476 1161 u u - -
2035 1.38629 1.38629 1.38629 1.38629
2036 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2037 672 1.53319 1.69198 1.19187 1.21623 1162 g u - -
2038 1.38629 1.38629 1.38629 1.38629
2039 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2040 673 1.44124 1.68944 1.25892 1.22152 1163 u u - -
2041 1.38629 1.38629 1.38629 1.38629
2042 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2043 674 1.35831 1.67021 1.41281 1.16719 1164 u u - -
2044 1.38629 1.38629 1.38629 1.38629
2045 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2046 675 1.33244 1.68445 1.48321 1.12790 1165 u u - -
2047 1.38629 1.38629 1.38629 1.38629
2048 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2049 676 1.37450 1.42712 1.48598 1.27028 1166 u u - -
2050 1.38629 1.38629 1.38629 1.38629
2051 0.03166 4.16166 4.16166 1.46634 0.26236 1.63257 0.21744
2052 677 1.50898 1.69495 1.20643 1.21743 1167 g u - -
2053 1.38629 1.38629 1.38629 1.38629
2054 0.03840 4.16166 3.81246 1.46634 0.26236 1.63257 0.21744
2055 678 1.45466 1.66194 1.41006 1.10075 1168 u u - -
2056 1.38629 1.38629 1.38629 1.38629
2057 0.03187 4.15512 4.15512 1.46634 0.26236 1.71108 0.19927
2058 679 1.45423 1.41325 1.48316 1.21689 1169 u u - -
2059 1.38629 1.38629 1.38629 1.38629
2060 0.03187 4.15512 4.15512 1.46634 0.26236 1.71108 0.19927
2061 680 1.25600 1.55660 1.51295 1.25843 1170 a a - -
2062 1.38629 1.38629 1.38629 1.38629
2063 0.05388 4.15512 3.30313 1.46634 0.26236 1.71108 0.19927
2064 681 1.39511 1.43795 1.46049 1.26351 1171 u u - -
2065 1.38629 1.38629 1.38629 1.38629
2066 0.03257 4.13381 4.13381 1.46634 0.26236 1.92851 0.15708
2067 682 1.45827 1.53422 1.56540 1.07080 1172 u u - -
2068 1.38629 1.38629 1.38629 1.38629
2069 0.03257 4.13381 4.13381 1.46634 0.26236 1.92851 0.15708
2070 683 1.44132 1.63055 1.15699 1.37384 1173 g g - -
2071 1.38629 1.38629 1.38629 1.38629
2072 0.03257 4.13381 4.13381 1.46634 0.26236 1.92851 0.15708
2073 684 1.52232 1.47884 1.36322 1.21047 1174 u u - -
2074 1.38629 1.38629 1.38629 1.38629
2075 0.03752 4.13381 3.87273 1.46634 0.26236 1.92851 0.15708
2076 685 1.49622 1.29829 1.57164 1.21969 1175 u u - -
2077 1.38629 1.38629 1.38629 1.38629
2078 0.03273 4.12902 4.12902 1.46634 0.26236 1.97096 0.15004
2079 686 1.36690 1.50560 1.40397 1.28157 1176 u u - -
2080 1.38629 1.38629 1.38629 1.38629
2081 0.04138 4.12902 3.71186 1.46634 0.26236 1.97096 0.15004
2082 687 1.40553 1.54432 1.34650 1.26884 1177 u u - -
2083 1.38629 1.38629 1.38629 1.38629
2084 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2085 688 1.55760 1.29820 1.52135 1.21093 1178 u u - -
2086 1.38629 1.38629 1.38629 1.38629
2087 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2088 689 1.49992 1.45228 1.30740 1.30087 1179 u u - -
2089 1.38629 1.38629 1.38629 1.38629
2090 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2091 690 1.57200 1.47504 1.33750 1.20031 1180 u u - -
2092 1.38629 1.38629 1.38629 1.38629
2093 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2094 691 1.34841 1.39912 1.38737 1.41140 1181 a a - -
2095 1.38629 1.38629 1.38629 1.38629
2096 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2097 692 1.43558 1.42512 1.54559 1.17650 1182 u u - -
2098 1.38629 1.38629 1.38629 1.38629
2099 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2100 693 1.40508 1.61031 1.35334 1.21588 1183 u u - -
2101 1.38629 1.38629 1.38629 1.38629
2102 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2103 694 1.43557 1.43916 1.48150 1.21201 1184 u u - -
2104 1.38629 1.38629 1.38629 1.38629
2105 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2106 695 1.56151 1.44752 1.67783 0.99900 1185 u u - -
2107 1.38629 1.38629 1.38629 1.38629
2108 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2109 696 1.53088 1.38438 1.47563 1.18895 1186 u u - -
2110 1.38629 1.38629 1.38629 1.38629
2111 0.03301 4.12065 4.12065 1.46634 0.26236 2.04060 0.13920
2112 697 1.54554 1.47500 1.54722 1.06367 1187 u u - -
2113 1.38629 1.38629 1.38629 1.38629
2114 0.04102 4.12065 3.73160 1.46634 0.26236 2.04060 0.13920
2115 698 1.46741 1.51244 1.46000 1.14926 1188 u u - -
2116 1.38629 1.38629 1.38629 1.38629
2117 0.03327 4.11290 4.11290 1.46634 0.26236 2.10057 0.13055
2118 699 1.50244 1.53813 1.46701 1.10257 1189 u u - -
2119 1.38629 1.38629 1.38629 1.38629
2120 0.03327 4.11290 4.11290 1.46634 0.26236 2.10057 0.13055
2121 700 1.40719 1.59194 1.30584 1.27049 1190 u u - -
2122 1.38629 1.38629 1.38629 1.38629
2123 0.03722 4.11290 3.90317 1.46634 0.26236 2.10057 0.13055
2124 701 1.49973 1.52690 1.37731 1.17978 1191 u u - -
2125 1.38629 1.38629 1.38629 1.38629
2126 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2127 702 1.52528 1.50710 1.31741 1.22738 1192 u u - -
2128 1.38629 1.38629 1.38629 1.38629
2129 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2130 703 1.37630 1.65737 1.55053 1.06504 1193 u u - -
2131 1.38629 1.38629 1.38629 1.38629
2132 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2133 704 1.44550 1.57634 1.35791 1.20250 1194 u u - -
2134 1.38629 1.38629 1.38629 1.38629
2135 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2136 705 1.39204 1.51177 1.37042 1.28405 1195 u u - -
2137 1.38629 1.38629 1.38629 1.38629
2138 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2139 706 1.52848 1.53569 1.40718 1.13012 1196 u u - -
2140 1.38629 1.38629 1.38629 1.38629
2141 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2142 707 1.55070 1.59579 1.29767 1.16480 1197 u u - -
2143 1.38629 1.38629 1.38629 1.38629
2144 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2145 708 1.38272 1.61228 1.24679 1.33847 1198 g a - -
2146 1.38629 1.38629 1.38629 1.38629
2147 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2148 709 1.50117 1.30852 1.53564 1.23240 1199 u u - -
2149 1.38629 1.38629 1.38629 1.38629
2150 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2151 710 1.46932 1.38335 1.47473 1.23670 1200 u u - -
2152 1.38629 1.38629 1.38629 1.38629
2153 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2154 711 1.33671 1.50977 1.34651 1.36185 1201 a a - -
2155 1.38629 1.38629 1.38629 1.38629
2156 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2157 712 1.49498 1.49947 1.43372 1.15811 1202 u u - -
2158 1.38629 1.38629 1.38629 1.38629
2159 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2160 713 1.52505 1.15655 1.60774 1.31872 1203 c c - -
2161 1.38629 1.38629 1.38629 1.38629
2162 0.03340 4.10908 4.10908 1.46634 0.26236 2.12873 0.12668
2163 714 1.34295 1.48083 1.49617 1.24656 1204 u u - -
2164 1.38629 1.38629 1.38629 1.38629
2165 0.03742 4.10908 3.89675 1.46634 0.26236 2.12873 0.12668
2166 715 1.39794 1.54697 1.41426 1.21437 1205 u u - -
2167 1.38629 1.38629 1.38629 1.38629
2168 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2169 716 1.61460 1.41114 1.28412 1.27200 1206 u u - -
2170 1.38629 1.38629 1.38629 1.38629
2171 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2172 717 1.49720 1.57811 1.23867 1.27257 1207 g u - -
2173 1.38629 1.38629 1.38629 1.38629
2174 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2175 718 1.45579 1.52696 1.33798 1.24753 1208 u u - -
2176 1.38629 1.38629 1.38629 1.38629
2177 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2178 719 1.39694 1.59503 1.35948 1.22776 1209 u u - -
2179 1.38629 1.38629 1.38629 1.38629
2180 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2181 720 1.50976 1.48144 1.36783 1.21379 1210 u u - -
2182 1.38629 1.38629 1.38629 1.38629
2183 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2184 721 1.46174 1.43623 1.34034 1.31458 1211 u u - -
2185 1.38629 1.38629 1.38629 1.38629
2186 0.03353 4.10519 4.10519 1.46634 0.26236 2.15649 0.12299
2187 722 1.39271 1.55604 1.37565 1.24496 1212 u u - -
2188 1.38629 1.38629 1.38629 1.38629
2189 0.07113 4.10519 2.95317 1.46634 0.26236 2.15649 0.12299
2190 723 1.37283 1.64387 1.39699 1.18404 1213 u u - -
2191 1.38629 1.38629 1.38629 1.38629
2192 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2193 724 1.35165 1.46953 1.61165 1.16605 1214 u u - -
2194 1.38629 1.38629 1.38629 1.38629
2195 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2196 725 1.52409 1.29920 1.64534 1.15048 1215 u u - -
2197 1.38629 1.38629 1.38629 1.38629
2198 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2199 726 1.61402 1.53115 1.40836 1.07856 1216 u u - -
2200 1.38629 1.38629 1.38629 1.38629
2201 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2202 727 1.27323 1.61745 1.39296 1.29708 1217 a a - -
2203 1.38629 1.38629 1.38629 1.38629
2204 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2205 728 1.49536 1.52890 1.37280 1.18528 1218 u u - -
2206 1.38629 1.38629 1.38629 1.38629
2207 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2208 729 1.63011 1.54541 1.10182 1.35246 1219 g g - -
2209 1.38629 1.38629 1.38629 1.38629
2210 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2211 730 1.47367 1.45840 1.56597 1.11042 1220 u u - -
2212 1.38629 1.38629 1.38629 1.38629
2213 0.03479 4.06885 4.06885 1.46634 0.26236 2.38004 0.09711
2214 731 1.32172 1.69205 1.17019 1.43182 1221 g a - -
2215 1.38629 1.38629 1.38629 1.38629
2216 0.30728 4.06885 1.39651 1.46634 0.26236 2.38004 0.09711
2217 732 1.40651 1.42153 1.37267 1.34619 1222 u u - -
2218 1.38629 1.38629 1.38629 1.38629
2219 0.04545 3.80701 3.80701 1.46634 0.26236 3.18961 0.04206
2220 733 1.48338 1.30472 1.31812 1.45139 1223 c a - -
2221 1.38629 1.38629 1.38629 1.38629
2222 0.04545 3.80701 3.80701 1.46634 0.26236 3.18961 0.04206
2223 734 1.61203 1.54480 1.23098 1.22025 1224 u u - -
2224 1.38629 1.38629 1.38629 1.38629
2225 0.04545 3.80701 3.80701 1.46634 0.26236 3.18961 0.04206
2226 735 1.40283 1.70953 1.24642 1.25311 1225 g u - -
2227 1.38629 1.38629 1.38629 1.38629
2228 0.04545 3.80701 3.80701 1.46634 0.26236 3.18961 0.04206
2229 736 1.46401 1.53495 1.19834 1.38019 1226 g u - -
2230 1.38629 1.38629 1.38629 1.38629
2231 0.04545 3.80701 3.80701 1.46634 0.26236 3.18961 0.04206
2232 737 1.60015 1.49958 1.34306 1.15879 1227 u u - -
2233 1.54216 1.43325 1.38836 1.21045
2234 0.75493 0.67779 3.80701 4.00212 0.01845 3.18961 0.04206
2235 738 1.60868 1.40577 1.16681 1.41341 1357 g g - -
2236 1.38629 1.38629 1.38629 1.38629
2237 0.04545 3.80701 3.80701 1.46634 0.26236 2.77056 0.06467
2238 739 1.43259 1.59819 1.34443 1.20946 1358 u u - -
2239 1.38629 1.38629 1.38629 1.38629
2240 0.04491 3.81851 3.81851 1.46634 0.26236 2.61132 0.07627
2241 740 1.41380 1.61659 1.22141 1.33410 1359 g u - -
2242 1.38629 1.38629 1.38629 1.38629
2243 0.04418 3.83473 3.83473 1.46634 0.26236 2.37880 0.09724
2244 741 1.44300 1.63191 1.38676 1.14463 1360 u u - -
2245 1.38629 1.38629 1.38629 1.38629
2246 0.04310 3.85891 3.85891 1.46634 0.26236 2.57139 0.07951
2247 742 1.48125 1.59630 1.18379 1.33224 1361 g u - -
2248 1.38629 1.38629 1.38629 1.38629
2249 0.04248 3.87299 3.87299 1.46634 0.26236 2.05523 0.13704
2250 743 1.49654 1.62359 1.42086 1.08649 1362 u u - -
2251 1.38629 1.38629 1.38629 1.38629
2252 0.04099 3.90805 3.90805 1.46634 0.26236 1.33742 0.30452
2253 744 1.57450 1.47876 1.37506 1.16429 1363 u u - -
2254 1.38629 1.38629 1.38629 1.38629
2255 0.03780 3.98749 3.98749 1.46634 0.26236 2.17419 0.12070
2256 745 1.44826 1.49194 1.50224 1.14742 1364 u u - -
2257 1.38629 1.38629 1.38629 1.38629
2258 0.03727 4.00127 4.00127 1.46634 0.26236 1.45401 0.26609
2259 746 1.43318 1.49026 1.33570 1.29769 1365 u u - -
2260 1.38629 1.38629 1.38629 1.38629
2261 0.03566 4.04454 4.04454 1.46634 0.26236 2.50225 0.08545
2262 747 1.58825 1.42598 1.29443 1.26801 1366 u u - -
2263 1.38629 1.38629 1.38629 1.38629
2264 0.03566 4.04454 4.04454 1.46634 0.26236 2.50225 0.08545
2265 748 1.44331 1.39797 1.37424 1.33285 1367 u u - -
2266 1.38629 1.38629 1.38629 1.38629
2267 0.03566 4.04454 4.04454 1.46634 0.26236 2.50225 0.08545
2268 749 1.33205 1.57188 1.10209 1.62845 1368 g a - -
2269 1.38629 1.38629 1.38629 1.38629
2270 0.03566 4.04454 4.04454 1.46634 0.26236 2.50225 0.08545
2271 750 1.56587 1.68714 1.09653 1.30190 1369 g g - -
2272 1.38629 1.38629 1.38629 1.38629
2273 0.03566 4.04454 4.04454 1.46634 0.26236 1.64868 0.21357
2274 751 1.53401 1.50684 1.35963 1.18428 1370 u u - -
2275 1.38629 1.38629 1.38629 1.38629
2276 0.03483 4.06788 4.06788 1.46634 0.26236 2.38526 0.09658
2277 752 1.36602 1.56613 1.24148 1.39808 1371 g a - -
2278 1.38629 1.38629 1.38629 1.38629
2279 0.03483 4.06788 4.06788 1.46634 0.26236 1.31142 0.31394
2280 753 1.42847 1.38632 1.36891 1.36279 1372 u u - -
2281 1.38629 1.38629 1.38629 1.38629
2282 0.03370 4.10032 4.10032 1.46634 0.26236 2.19001 0.11869
2283 754 1.66275 1.21670 1.34356 1.37333 1373 c c - -
2284 1.38629 1.38629 1.38629 1.38629
2285 0.03370 4.10032 4.10032 1.46634 0.26236 2.19001 0.11869
2286 755 1.45692 1.40725 1.55741 1.16619 1374 u u - -
2287 1.38629 1.38629 1.38629 1.38629
2288 0.03370 4.10032 4.10032 1.46634 0.26236 2.19001 0.11869
2289 756 1.48416 1.80403 1.05183 1.34948 1375 g g - -
2290 1.38629 1.38629 1.38629 1.38629
2291 0.03370 4.10032 4.10032 1.46634 0.26236 2.19001 0.11869
2292 757 1.60565 1.51089 1.18617 1.29778 1376 g u - -
2293 1.38629 1.38629 1.38629 1.38629
2294 0.03370 4.10032 4.10032 1.46634 0.26236 1.21460 0.35216
2295 758 1.29391 1.55071 1.47729 1.25368 1377 u a - -
2296 1.38629 1.38629 1.38629 1.38629
2297 0.03278 4.12732 4.12732 1.46634 0.26236 1.74285 0.19240
2298 759 1.26866 1.61691 1.35142 1.34166 1378 a a - -
2299 1.38629 1.38629 1.38629 1.38629
2300 0.03264 4.13174 4.13174 1.46634 0.26236 1.94711 0.15395
2301 760 1.36778 1.39138 1.59478 1.22539 1379 u u - -
2302 1.38629 1.38629 1.38629 1.38629
2303 0.03264 4.13174 4.13174 1.46634 0.26236 0.73686 0.65127
2304 761 1.50602 1.61840 1.28925 1.18903 1380 u u - -
2305 1.38629 1.38629 1.38629 1.38629
2306 0.03143 4.16884 4.16884 1.46634 0.26236 1.13840 0.38615
2307 762 1.29128 1.94909 1.51281 1.01504 1381 u u - -
2308 1.38629 1.38629 1.38629 1.38629
2309 0.03119 4.17641 4.17641 1.46634 0.26236 1.42629 0.27470
2310 763 1.68439 1.65062 1.86640 0.75965 1382 u U - -
2311 1.38629 1.38629 1.38629 1.38629
2312 0.03119 4.17641 4.17641 1.46634 0.26236 1.01797 0.44836
2313 764 1.54784 1.53485 2.01509 0.82440 1383 u u - -
2314 1.38629 1.38629 1.38629 1.38629
2315 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2316 765 0.59852 1.99399 1.93462 1.77345 1384 a A - -
2317 1.38629 1.38629 1.38629 1.38629
2318 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2319 766 2.38197 0.35762 2.50718 2.06521 1385 c C - -
2320 1.38629 1.38629 1.38629 1.38629
2321 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2322 767 2.40729 1.19219 2.44217 0.65505 1386 u U - -
2323 1.38629 1.38629 1.38629 1.38629
2324 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2325 768 1.73735 1.82030 1.32048 0.92879 1387 u u - -
2326 1.38629 1.38629 1.38629 1.38629
2327 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2328 769 2.33155 2.14534 2.72231 0.32836 1388 u U - -
2329 1.39915 1.39915 1.34868 1.39915
2330 0.03911 3.76695 4.18412 1.02585 0.44393 1.29717 0.31925
2331 770 1.89778 3.17142 0.28063 2.94035 1390 g G - -
2332 1.38629 1.38629 1.38629 1.38629
2333 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2334 771 0.36207 2.20338 2.34915 2.32396 1391 a A - -
2335 1.38629 1.38629 1.38629 1.38629
2336 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2337 772 0.97284 1.87504 1.32863 1.59061 1392 a a - -
2338 1.38629 1.38629 1.38629 1.38629
2339 0.03492 4.18412 3.95913 1.46634 0.26236 1.29717 0.31925
2340 773 1.10128 1.47656 1.82566 1.28006 1393 a a - -
2341 1.38629 1.38629 1.38629 1.38629
2342 0.03107 4.18027 4.18027 1.46634 0.26236 1.13887 0.38593
2343 774 0.39361 2.24608 2.37611 2.06627 1394 a A - -
2344 1.38629 1.38629 1.38629 1.38629
2345 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2346 775 0.20841 2.93826 2.99627 2.46278 1395 a A - -
2347 1.38629 1.38629 1.38629 1.38629
2348 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2349 776 0.37658 2.16438 2.41873 2.20780 1396 a A - -
2350 1.38629 1.38629 1.38629 1.38629
2351 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2352 777 1.58756 1.86214 1.92496 0.70450 1397 u U - -
2353 1.38629 1.38629 1.38629 1.38629
2354 0.03095 4.18412 4.18412 1.46634 0.26236 1.29717 0.31925
2355 778 1.77171 1.23230 1.87127 0.95605 1398 u u - -
2356 1.38629 1.38629 1.38629 1.38629
2357 0.03753 4.18412 3.83493 1.46634 0.26236 1.29717 0.31925
2358 779 0.80500 2.02303 1.51163 1.60889 1399 a A - -
2359 1.38629 1.38629 1.38629 1.38629
2360 0.03115 4.17773 4.17773 1.46634 0.26236 1.40533 0.28142
2361 780 1.53598 2.26056 0.64027 1.87526 1400 g g - -
2362 1.38629 1.38629 1.38629 1.38629
2363 0.05135 4.17773 3.36052 1.46634 0.26236 1.40533 0.28142
2364 781 0.76068 1.90580 1.80416 1.51715 1401 a A - -
2365 1.38629 1.38629 1.38629 1.38629
2366 0.03177 4.15816 4.15816 1.46634 0.26236 0.94456 0.49241
2367 782 1.92748 2.89888 0.33177 2.50407 1402 g G - -
2368 1.38629 1.38629 1.38629 1.38629
2369 0.03124 4.17486 4.17486 1.46634 0.26236 0.63304 0.75710
2370 783 2.31106 1.59424 2.19517 0.53368 1403 u U - -
2371 1.38629 1.38629 1.38629 1.38629
2372 0.03948 4.19411 3.74537 1.46634 0.26236 1.09861 0.40547
2373 784 2.72981 3.34551 0.16878 2.90355 1404 g G - -
2374 1.38629 1.38629 1.38629 1.38629
2375 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
2376 785 1.67987 1.02979 2.21556 1.05720 1405 c u - -
2377 1.38629 1.38629 1.38629 1.38629
2378 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
2379 786 2.86073 2.15890 3.01243 0.25084 1406 u U - -
2380 1.38629 1.38629 1.38629 1.38629
2381 0.03090 4.18553 4.18553 1.46634 0.26236 1.27154 0.32906
2382 787 2.18788 0.74330 2.50125 1.10769 1407 c c - -
2383 1.38629 1.38629 1.38629 1.38629
2384 0.03090 4.18553 4.18553 1.46634 0.26236 0.82280 0.57839
2385 788 0.59903 1.73951 2.06440 1.90949 1408 a A - -
2386 1.38629 1.38629 1.38629 1.38629
2387 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2388 789 0.39477 2.48781 2.45119 1.85227 1409 a A - -
2389 1.38629 1.38629 1.38629 1.38629
2390 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2391 790 0.73124 2.04862 1.58065 1.69318 1410 a A - -
2392 1.38629 1.38629 1.38629 1.38629
2393 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2394 791 1.94772 2.81116 0.33929 2.46519 1411 g G - -
2395 1.38629 1.38629 1.38629 1.38629
2396 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2397 792 2.57401 0.35823 2.73942 1.83100 1412 c C - -
2398 1.38629 1.38629 1.38629 1.38629
2399 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2400 793 0.66087 2.06007 1.63781 1.82173 1413 a A - -
2401 1.38629 1.38629 1.38629 1.38629
2402 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2403 794 1.66453 2.67574 0.42723 2.41297 1414 g G - -
2404 1.38629 1.38629 1.38629 1.38629
2405 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2406 795 1.75052 2.33327 0.53593 1.93648 1415 g G - -
2407 1.38629 1.38629 1.38629 1.38629
2408 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2409 796 1.82975 0.75352 2.02577 1.43992 1416 c c - -
2410 1.38629 1.38629 1.38629 1.38629
2411 0.03063 4.19411 4.19411 1.46634 0.26236 1.09861 0.40547
2412 797 1.38105 1.52875 1.60324 1.10673 1417 u u - -
2413 1.38629 1.38629 1.38629 1.38629
2414 0.30166 4.19411 1.40516 1.46634 0.26236 1.09861 0.40547
2415 798 1.25554 1.59294 1.53178 1.21875 1418 u a - -
2416 1.38629 1.38629 1.38629 1.38629
2417 0.03998 3.93243 3.93243 1.46634 0.26236 2.90493 0.05631
2418 799 1.36813 1.67618 1.45332 1.12535 1419 u u - -
2419 1.29580 1.49585 1.40895 1.35533
2420 0.64271 0.96153 2.38787 2.35800 0.09939 0.84339 0.56256
2421 800 1.10317 1.64686 1.78511 1.17847 1463 a a - -
2422 1.38629 1.38629 1.38629 1.38629
2423 0.03760 3.99274 3.99274 1.46634 0.26236 0.35745 1.20216
2424 801 1.50421 1.58360 1.50448 1.04857 1464 u u - -
2425 1.38629 1.38629 1.38629 1.38629
2426 0.03187 4.15511 4.15511 1.46634 0.26236 0.97108 0.47590
2427 802 1.43081 1.61836 1.42782 1.13063 1465 u u - -
2428 1.38629 1.38629 1.38629 1.38629
2429 0.03132 4.17216 4.17216 1.46634 0.26236 1.16891 0.37209
2430 803 1.59419 1.56143 1.33858 1.12432 1466 u u - -
2431 1.38629 1.38629 1.38629 1.38629
2432 0.03114 4.17799 4.17799 1.46634 0.26236 1.06389 0.42329
2433 804 1.58433 1.72520 0.87608 1.60762 1467 g g - -
2434 1.38629 1.38629 1.38629 1.38629
2435 0.05131 4.18412 3.35881 1.46634 0.26236 1.29717 0.31925
2436 805 1.66382 0.86919 1.84468 1.45577 1468 c c - -
2437 1.40612 1.32907 1.40612 1.40612
2438 0.05421 3.82755 3.47368 1.22356 0.34840 1.33660 0.30481
2439 806 1.58487 1.34076 1.78394 1.00675 1471 u u - -
2440 1.38629 1.38629 1.38629 1.38629
2441 0.03192 4.15350 4.15350 1.46634 0.26236 1.72959 0.19523
2442 807 1.85637 1.71342 2.00149 0.63794 1472 u U - -
2443 1.38629 1.38629 1.38629 1.38629
2444 0.03192 4.15350 4.15350 1.46634 0.26236 1.72959 0.19523
2445 808 1.97190 2.61623 0.38322 2.24367 1473 g G - -
2446 1.38629 1.38629 1.38629 1.38629
2447 0.03192 4.15350 4.15350 1.46634 0.26236 1.72959 0.19523
2448 809 0.89548 1.83618 1.50431 1.56067 1474 a a - -
2449 1.38629 1.38629 1.38629 1.38629
2450 0.03192 4.15350 4.15350 1.46634 0.26236 1.72959 0.19523
2451 810 0.64376 1.87779 1.97514 1.69819 1475 a A - -